Resveratrol Promotes Proliferation, Antioxidant Properties, and Progesterone Production in Yak (Bos grunniens) Granulosa Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Isolation and Identification of GCs
2.3. Effects of RES on Viability of Yak GCs
2.4. Effect of RES on Proliferation and Apoptosis of GCs
2.5. Effect of RES on Cell Cycle of GCs
2.6. ROS Staining Assay
2.7. Effect of RES on MDA and GSH of GCs
2.8. Oil Red O Staining
2.9. Determination of ATP
2.10. Effect of RES on Steroidogenesis of Yak GCs
2.11. Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)
2.12. Statistical Analysis
3. Results
3.1. Identification of Yak GCs
3.2. Effects of RES Concentration and Treatment Time on GC Viability
3.3. Effect of RES on Proliferation and Apoptosis of GCs
3.4. Effect of RES on Cell Cycle of GCs
3.5. Effect of RES on Antioxidant Properties of GCs
3.6. Effect of RES on Lipid Droplets (LDs) and ATP Production by GCs
3.7. Effect of RES on Steroidogenesis of GCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- McGee, E.A.; Hsueh, A.J. Initial and cyclic recruitment of ovarian follicles. Endocr. Rev. 2000, 21, 200–214. [Google Scholar] [PubMed]
- Martinez, C.A.; Rizos, D.; Rodriguez-Martinez, H.; Funahashi, H. Oocyte-cumulus cells crosstalk: New comparative insights. Theriogenology 2023, 205, 87–93. [Google Scholar] [CrossRef]
- Eppig, J.J. Oocyte control of ovarian follicular development and function in mammals. Reproduction 2001, 122, 829–838. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, T.; Kayamori, T.; Murayama, C.; Miyamoto, A. Bone morphogenetic protein (BMP)-4 and BMP-7 suppress granulosa cell apoptosis via different pathways: BMP-4 via PI3K/PDK-1/Akt and BMP-7 via PI3K/PDK-1/PKC. Biochem. Biophys. Res. Commun. 2012, 417, 869–873. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Jia, Y.; Meng, S.; Luo, Y.; Yang, Q.; Pan, Z. Mechanisms of and potential medications for oxidative stress in ovarian granulosa cells: A review. Int. J. Mol. Sci. 2023, 24, 9205. [Google Scholar] [CrossRef] [PubMed]
- Matsuda, F.; Inoue, N.; Manabe, N.; Ohkura, S. Follicular growth and atresia in mammalian ovaries: Regulation by survival and death of granulosa cells. J. Reprod. Dev. 2012, 58, 44–50. [Google Scholar] [CrossRef] [PubMed]
- Shadel, G.S.; Horvath, T.L. Mitochondrial ROS signaling in organismal homeostasis. Cell 2015, 163, 560–569. [Google Scholar] [CrossRef]
- Lei, Z.; Ali, I.; Yang, M.; Yang, C.; Li, Y.; Li, L. Non-Esterified Fatty Acid-Induced Apoptosis in Bovine Granulosa Cells via ROS-Activated PI3K/AKT/FoxO1 Pathway. Antioxidants 2023, 12, 434. [Google Scholar] [CrossRef]
- Meng, L.; Wu, Z.; Zhao, K.; Tao, J.; Chit, T.; Zhang, S.; Wang, C.C.; Teerds, K. Transcriptome analysis of porcine granulosa cells in healthy and atretic follicles: Role of steroidogenesis and oxidative stress. Antioxidants 2020, 10, 22. [Google Scholar] [CrossRef]
- Del Rio, D.; Stewart, A.J.; Pellegrini, N. A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress. Nutr. Metab. Cardiovasc. Dis. 2005, 15, 316–328. [Google Scholar] [CrossRef]
- Liu, T.; Sun, L.; Zhang, Y.; Wang, Y.; Zheng, J. Imbalanced GSH/ROS and sequential cell death. J. Biochem. Mol. Toxicol. 2022, 36, e22942. [Google Scholar] [CrossRef] [PubMed]
- Luo, M.; Yang, Z.Q.; Huang, J.C.; Wang, Y.S.; Guo, B.; Yue, Z.P. Genistein protects ovarian granulosa cells from oxidative stress via cAMP-PKA signaling. Cell. Biol. Int. 2020, 44, 433–445. [Google Scholar] [CrossRef] [PubMed]
- Zhou, R.; Yi, L.; Ye, X.; Zeng, X.; Liu, K.; Qin, Y.; Zhang, Q.; Mi, M. Resveratrol ameliorates lipid droplet accumulation in liver through a SIRT1/ ATF6-dependent mechanism. Cell. Physiol. Biochem. 2018, 51, 2397–23420. [Google Scholar] [CrossRef]
- Yenuganti, V.R.; Viergutz, T.; Vanselow, J. Oleic acid induces specific alterations in the morphology, gene expression and steroid hormone production of cultured bovine granulosa cells. Gen. Comp. Endocrinol. 2016, 232, 134–144. [Google Scholar] [CrossRef]
- White, D., 3rd; Yang, Q. Genetically encoded ATP biosensors for direct monitoring of cellular ATP dynamics. Cells 2022, 11, 1920. [Google Scholar] [CrossRef]
- Ragonese, F.; Monarca, L.; De Luca, A.; Mancinelli, L.; Mariani, M.; Corbucci, C.; Gerli, S.; Iannitti, R.G.; Leonardi, L.; Fioretti, B. Resveratrol depolarizes the membrane potential in human granulosa cells and promotes mitochondrial biogenesis. Fertil. Steril. 2021, 115, 115,1063–1073. [Google Scholar] [CrossRef] [PubMed]
- Tian, B.; Liu, J. Resveratrol: A review of plant sources, synthesis, stability, modification and food application. J. Sci. Food. Agric. 2020, 100, 1392–1404. [Google Scholar] [CrossRef]
- Meng, T.; Xiao, D.; Muhammed, A.; Deng, J.; Chen, L.; He, J. Anti-Inflammatory action and mechanisms of resveratrol. Molecules 2021, 26, 229. [Google Scholar] [CrossRef]
- Ortega, I.; Duleba, A.J. Ovarian actions of resveratrol. Ann. N. Y. Acad. Sci. 2015, 1348, 86–96. [Google Scholar] [CrossRef]
- Pasquariello, R.; Verdile, N.; Brevini, T.A.L.; Gandolfi, F.; Boiti, C.; Zerani, M.; Maranesi, M. The role of resveratrol in mammalian reproduction. Molecules 2020, 25, 4554. [Google Scholar] [CrossRef]
- Jozkowiak, M.; Hutchings, G.; Jankowski, M.; Kulcenty, K.; Mozdziak, P.; Kempisty, B.; Spaczynski, R.Z.; Piotrowska-Kempisty, H. The stemness of human ovarian granulosa cells and the role of resveratrol in the differentiation of MSCs-A review based on cellular and molecular knowledge. Cells 2020, 9, 1418. [Google Scholar] [CrossRef] [PubMed]
- Grive, K.J.; Sauerbrun-Cutler, M.T. Resveratrol improves granulosa cell activity through mitochondrial biogenesis. Fertil. Steril. 2021, 115, 909–910. [Google Scholar] [CrossRef]
- Liang, Y.; Xu, M.L.; Gao, X.; Wang, Y.; Zhang, L.N.; Li, Y.C.; Guo, Q. Resveratrol improves ovarian state by inhibiting apoptosis of granulosa cells. Gynecol. Endocrinol. 2023, 39, 2181652. [Google Scholar] [CrossRef] [PubMed]
- Park, S.A.; Joo, N.R.; Park, J.H.; Oh, S.M. Role of the SIRT1/p53 regulatory axis in oxidative stress-mediated granulosa cell apoptosis. Mol. Med. Rep. 2021, 23, 20. [Google Scholar] [CrossRef] [PubMed]
- Tatone, C.; Di Emidio, G.; Vitti, M.; Di Carlo., M.; Santini, S., Jr.; D’Alessandro, A.M.; Falone, S.; Amicarelli, F. Sirtuin functions in female fertility: Possible role in oxidative stress and aging. Oxid. Med. Cell. Longev. 2015, 2015, 659687. [Google Scholar] [CrossRef] [PubMed]
- Nie, Z.; Hua, R.; Zhang, Y.; Zhang, N.; Zhang, Y.; Li, Q.; Wu, H. Resveratrol protects human luteinised granulosa cells against hydrogen peroxide-induced oxidative injury through the Sirt1. Reprod. Fertil. Dev. 2021, 33, 831–840. [Google Scholar] [CrossRef]
- Wang, F.; Tian, X.; Zhang, L.; He, C.; Ji, P.; Li, Y.; Tan, D.; Liu, G. Beneficial effect of resveratrol on bovine oocyte maturation and subsequent embryonic development after in vitro fertilization. Fertil. Steril. 2014, 101, 577–586. [Google Scholar] [CrossRef]
- Moreira-Pinto, B.; Costa, L.; Felgueira, E.; Fonseca, B.M.; Rebelo, I. Low doses of resveratrol protect human granulosa cells from induced-oxidative stress. Antioxidants 2021, 10, 561. [Google Scholar] [CrossRef]
- Morita, Y.; Wada-Hiraike, O.; Yano, T.; Shirane, A.; Hirano, M.; Hiraike, H.; Koyama, S.; Oishi, H.; Yoshino, O.; Miyamoto, Y.; et al. Resveratrol promotes expression of SIRT1 and StAR in rat ovarian granulosa cells: An implicative role of SIRT1 in the ovary. Reprod. Biol. Endocrinol. 2012, 10, 14. [Google Scholar] [CrossRef]
- Song, T.; Chen, J.; Yang, S.; Liu, B.; Zhang, L.; Zhang, Q.; Cheng, J.C.; Fang, L. Resveratrol stimulates StAR expression and progesterone production by GPER-mediated downregulation of Snail expression in human granulosa cells. J. Food. Drug. Anal. 2023, 31, 315–325. [Google Scholar] [CrossRef]
- Qiu, Q.; Zhang, G.; Ma, T.; Qian, W.; Wang, J.; Ye, Z.; Cao, C.; Hu, Q.; Kim, J.; Larkin, D.M.; et al. The yak genome and adaptation to life at high altitude. Nat. Genet. 2012, 44, 946–949. [Google Scholar] [CrossRef]
- Zi, X.D. Reproduction in female yaks (Bos grunniens) and opportunities for improvement. Theriogenology 2003, 59, 1303–1312. [Google Scholar] [CrossRef]
- Ortega, I.; Wong, D.H.; Villanueva, J.A.; Cress, A.B.; Sokalska, A.; Stanley, S.D.; Duleba, A.J. Effects of resveratrol on growth and function of rat ovarian granulosa cells. Fertil. Steril. 2012, 98, 1563–1573. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Liu, Y.; Han, Z.; Xu, Q.; Zhang, N.; Wang, J.; Zheng, X.; Ding, Y.; Yin, Z.; Zhang, X. Integrated analysis of lncRNA and mRNA for the apoptosis of porcine ovarian granulosa cells after polyphenol resveratrol treatment. Front. Vet. Sci. 2023, 9, 1065001. [Google Scholar] [CrossRef] [PubMed]
- Bezerra, M.É.S.; Gouveia, B.B.; Barberino, R.S.; Menezes, V.G.; Macedo, T.J.S.; Cavalcante, A.Y.P.; Monte, A.P.O.; Santos, J.M.S.; Matos, M.H.T. Resveratrol promotes in vitro activation of ovine primordial follicles by reducing DNA damage and enhancing granulosa cell proliferation via phosphatidylinositol 3-kinase pathway. Reprod. Domest. Anim. 2018, 53, 1298–12305. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.D.; Liu, Y.; Wu, J.F.; Gong, S.N.; Ma, Y.; Zi, X.D. Regulation of proliferation, apoptosis, hormone secretion and gene expression by acetyl-L-carnitine in yak (Bos grunniens) granulosa cells. Theriogenology 2023, 203, 61–68. [Google Scholar] [CrossRef] [PubMed]
- James, N.; Kini, S.; Pai, S.; Shenoy, N.; Kabekkodu, S.P. Comparative evaluation of corneal storage medias used as tooth avulsion medias in maintaining the viability of periodontal ligament cells using the cell counting kit-8 assay. Clin. Cosmet. Invest. Dent. 2022, 14, 87–94. [Google Scholar] [CrossRef]
- Cheng, Y.; Shen, Z.; Gao, Y.; Chen, F.; Xu, H.; Mo, Q.; Chu, X.; Peng, C.L.; McKenzie, T.T.; Palacios, B.E.; et al. Phase transition and remodeling complex assembly are important for SS18-SSX oncogenic activity in synovial sarcomas. Nat. Commun. 2022, 13, 2724. [Google Scholar] [CrossRef]
- Gong, Y.; Luo, S.; Fan, P.; Zhu, H.; Li, Y.; Huang, W. Growth hormone activates PI3K/Akt signaling and inhibits ROS accumulation and apoptosis in granulosa cells of patients with polycystic ovary syndrome. Reprod. Biol. Endocrinol. 2020, 18, 121. [Google Scholar] [CrossRef]
- Ji, X.; Lee, Y.J.; Eyster, T.; Parrillo, A.; Galosy, S.; Ao, Z.; Patel, P.; Zhu, Y. Characterization of cell cycle and apoptosis in Chinese hamster ovary cell culture using flow cytometry for bioprocess monitoring. Biotechnol. Prog. 2021, 38, e3211. [Google Scholar] [CrossRef]
- Wang, Y.; Yang, C.; Elsheikh, N.A.H.; Li, C.; Yang, F.; Wang, G.; Li, L. HO-1 reduces heat stress-induced apoptosis in bovine granulosa cells by suppressing oxidative stress. Aging 2019, 11, 5535–5547. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Song, Y.; Qi, H.; Liu, H.; Wu, T.; Wang, R.; Gao, C.; Liu, X.; Song, Y.; Qi, H.; et al. Energy stress modulation of AMPK/FoxO3 signaling inhibits mitochondria-associated ferroptosis. Redox. Biol. 2023, 63, 102760. [Google Scholar]
- Chen, L.; Wang, F.; Qu, S.; He, X.; Zhu, Y.; Zhou, Y.; Yang, K.; Li, Y.X.; Liu, M.; Peng, X.; et al. Therapeutic potential of perillaldehyde in ameliorating vulvovaginal candidiasis by reducing vaginal oxidative stress and apoptosis. Antioxidants 2022, 11, 178. [Google Scholar] [CrossRef] [PubMed]
- Ran, M.; Hu, S.; Ouyang, Q.; Xie, H.; Zhang, X.; Lin, Y.; Li, X.; Hu, J.; Li, L.; He, H.; et al. miR-202-5p inhibits lipid metabolism and steroidogenesis of goose hierarchical granulosa cells by targeting ACSL3. Animals 2023, 13, 325. [Google Scholar] [CrossRef] [PubMed]
- Spicer, L.J.; Schütz, L.F. Effects of grape phenolics, myricetin and piceatannol, on bovine granulosa and theca cell proliferation and steroid production in vitro. Food. Chem. Toxicol. 2022, 167, 113288. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Recchia, K.; Jorge, A.S.; Pessôa, L.V.F.; Botigelli, R.C.; Zugaib, V.C.; de Souza, A.F.; Martins, D.D.S.; Ambrósio, C.E.; Bressan, F.F.; Pieri, N.C.G. Actions and roles of FSH in germinative cells. Int. J. Mol. Sci. 2021, 22, 10110. [Google Scholar] [CrossRef]
- Fontana, J.; Martínková, S.; Petr, J.; Žalmanová, T.; Trnka, J. Metabolic cooperation in the ovarian follicle. Physiol. Res. 2020, 69, 33–48. [Google Scholar] [CrossRef]
- Shaito, A.; Posadino, A.M.; Younes, N.; Hasan, H.; Halabi, S.; Alhababi, D.; Al-Mohannadi, A.; Abdel-Rahman, W.M.; Eid, A.H.; Nasrallah, G.K.; et al. Potential adverse effects of resveratrol: A literature review. Int. J. Mol. Sci. 2020, 21, 2084. [Google Scholar] [CrossRef]
- Geske, F.J.; Gerschenson, L.E. The biology of apoptosis. Hum. Pathol. 2001, 32, 1029–1038. [Google Scholar] [CrossRef]
- Liu, H.; Zhang, S.; Liu, C.; Wu, J.; Wang, Y.; Yuan, L.; Du, X.; Wang, R.; Marwa, P.W.; Zhuang, D.; et al. Resveratrol ameliorates microcystin-LR-induced testis germ cell apoptosis in rats via SIRT1 signaling pathway activation. Toxins 2018, 10, 235. [Google Scholar] [CrossRef] [PubMed]
- Rubin, S.M.; Sage, J.; Skotheim, J.M. Integrating old and new paradigms of G1/S control. Mol. Cell. 2020, 80, 183–192. [Google Scholar] [CrossRef]
- Wang, X.B.; Huang, J.; Zou, J.G.; Su, E.B.; Shan, Q.J.; Yang, Z.J.; Cao, K.J. Effects of resveratrol on number and activity of endothelial progenitor cells from human peripheral blood. Clin. Exp. Pharmacol. Physiol. 2007, 34, 1109–1115. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.; Li, J. MicroRNA-519d-3p inhibits cell proliferation and cell cycle G1/S transition in glioma by targeting CCND1. Biosci. Biotechnol. Biochem. 2020, 84, 297–304. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Xiang, N.; Xu, L.; Zeng, S. Inhibition of PCNA antisense oligonucleotides mediated by liposome on mRNA expression and proliferation of h-RPE cells. J. Huazhong. Univ. Sci. Technolog. Med. Sci. 2006, 26, 392–395. [Google Scholar] [CrossRef]
- Wang, Y.; Jiang, Y.; Fan, X.; Tan, H.; Zeng, H.; Wang, Y.; Chen, P.; Huang, M.; Bi, H. Hepato-protective effect of resveratrol against acetaminophen-induced liver injury is associated with inhibition of CYP-mediated bioactivation and regulation of SIRT1-p53 signaling pathways. Toxicol. Lett. 2015, 236, 82–89. [Google Scholar] [CrossRef]
- Mao, X.; Gu, C.; Chen, D.; Yu, B.; He, J. Oxidative stress-induced diseases and tea polyphenols. Oncotarget 2017, 8, 81649–81661. [Google Scholar] [CrossRef]
- Chen, F.; Zhu, X. Activin a reduces porcine granulosa cells apoptosis via ERβ-dependent ROS modulation. Vet. Sci 2022, 9, 704. [Google Scholar] [CrossRef]
- Cai, M.; Wang, J.; Sun, H.; Guo, Q.; Zhang, C.; Yao, H.; Zhao, C.; Jia, Y.; Zhu, H. Resveratrol attenuates hydrogen peroxide-induced injury of rat ovarian granulosa-lutein cells by resisting oxidative stress via the SIRT1/Nrf2/ARE signaling pathway. Curr. Pharm. Des. 2023, 29, 947–956. [Google Scholar] [CrossRef]
- Abbasi, B.; Dong, Y.; Rui, R. Resveratrol hinders postovulatory aging by modulating oxidative stress in porcine oocytes. Molecules 2021, 26, 6346. [Google Scholar] [CrossRef] [PubMed]
- Habashy, W.S.; Milfort, M.C.; Rekaya, R.; Aggrey, S.E. Cellular antioxidant enzyme activity and biomarkers for oxidative stress are affected by heat stress. Int. J. Biometeorol. 2019, 63, 1569–1584. [Google Scholar] [CrossRef] [PubMed]
- Piras, A.R.; Ariu, F.; Maltana, A.; Leoni, G.G.; Martino, N.A.; Mastrorocco, A.; Dell’Aquila, M.E.; Bogliolo, L. Protective effect of resveratrol against cadmium-induced toxicity on ovine oocyte in vitro maturation and fertilization. J. Anim. Sci. Biotechnol. 2022, 13, 83. [Google Scholar] [CrossRef]
- Elis, S.; Desmarchais, A.; Maillard, V.; Uzbekova, S.; Monget, P.; Dupont, J. Cell proliferation and progesterone synthesis depend on lipid metabolism in bovine granulosa cells. Theriogenology 2015, 83, 840–853. [Google Scholar] [CrossRef]
- Abe, T.; Kawahara-Miki, R.; Hara, T.; Noguchi, T.; Hayashi, T.; Shirasuna, K.; Kuwayama, T.; Iwata, H. Modification of mitochondrial function, cytoplasmic lipid content and cryosensitivity of bovine embryos by resveratrol. J. Reprod. Dev. 2017, 63, 455–461. [Google Scholar] [CrossRef] [PubMed]
- Sutton-McDowall, M.L.; Gilchrist, R.B.; Thompson, J.G. The pivotal role of glucose metabolism in determining oocyte developmental competence. Reproduction 2010, 139, 685–695. [Google Scholar] [CrossRef]
- Cinco, R.; Digman, M.A.; Gratton, E.; Luderer, U. Spatial characterization of bioenergetics and metabolism of primordial to preovulatory follicles in whole Ex vivo murine ovary. Biol. Reprod. 2016, 95, 129. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.; He, H.; Jiang, X.; Yang, L.; Liu, D.; Yang, L.; Geng, G.; Cheng, J.; Chen, H.; Hua, R.; et al. Raf-ERK1/2 signalling pathways mediate steroid hormone synthesis in bovine ovarian granulosa cells. Reprod. Domest. Anim. 2019, 54, 741–749. [Google Scholar] [CrossRef]
- Ishihara, Y.; Sakurai, H.; Oguro, A.; Tsuji, M.; Vogel, C.F.A.; Yamazaki, T. Retinoid X receptor-mediated neuroprotection via CYP19 upregulation and subsequent increases in estradiol synthesis. J. Steroid. Biochem. Mol. Biol. 2019, 193, 105421. [Google Scholar] [CrossRef]
- Wang, Y.; Lee, K.W.; Chan, F.L.; Chen, S.; Leung, L.K. The red wine polyphenol resveratrol displays bilevel inhibition on aromatase in breast cancer cells. Toxicol. Sci. 2006, 92, 71–77. [Google Scholar] [CrossRef]
- Torres, V.; Hamdi, M.; Millán de la Blanca, M.G.; Urrego, R.; Echeverri, J.; López-Herrera, A.; Rizos, D.; Gutiérrez-Adán, A.; Sánchez-Calabuig, M.J. Resveratrol-cyclodextrin complex affects the expression of genes associated with lipid metabolism in bovine in vitro produced embryos. Reprod. Domest. Anim. 2018, 53, 850–858. [Google Scholar] [CrossRef] [PubMed]
- Kolesarova, A.; Capcarova, M.; Maruniakova, N.; Lukac, N.; Ciereszko, R.E.; Sirotkin, A.V. Resveratrol inhibits reproductive toxicity induced by deoxynivalenol. J. Environ. Sci. Health. A Tox. Hazard. Subst. Environ. Eng. 2012, 47, 1329–1334. [Google Scholar] [CrossRef] [PubMed]
- Basini, G.; Tringali, C.; Baioni, L.; Bussolati, S.; Spatafora, C.; Grasselli, F. Biological effects on granulosa cells of hydroxylated and methylated resveratrol analogues. Mol. Nutr. Food. Res. 2010, 54 (Suppl. S2), S236–S243. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence (5′-3′) | PCR Product Size (bp) | GenBank ID |
---|---|---|---|
BCL-2 | F: TTCGCCGAGATGTCCAGT R: CCCTCCGAACTCAAAGAAGG | 132 | NM_001166486.1 |
BAX | F: CGAGTGGCGGCTGAAATGT R: GGCCTTGAGCACCAGTTTG | 93 | NM_173894.1 |
P53 | F: CCCATCCTCACCATCATCAC R: GCACAAACACGCACCTCAA | 80 | NM_174201.2 |
PCNA | F:AGAGCTGAAGATAACGCGG R: GATCTCGGCATATACGTGCAA | 181 | NM_001034494.1 |
CASP3 | F: GACCATAGCAAAAGGAGCAGT R: TTCTGCAATAGTCCCCTCTG | 130 | NM_001077840.1 |
KU70 | F: AATTGACTCCTTTTGACATGAGCAT R: CCATAGAACACCACTGCCAAGA | 100 | NM_001192246.1 |
CCND1 | F:GCCGAGGAGAACAAGCAG R: CGTCAGGCGGTGATAGGA | 180 | NM_001046273.2 |
CDK4 | F: CACTCTGGTATCGTGCTCCA R: GGGCAGTCCAATCAGGTCAA | 170 | NM_001037594.2 |
CYP11A1 | F: CAGGGCTCCGGAAAGTTTGT R: GGGACACTGGTGTGGAACAT | 173 | NM_176644.2 |
SOD2 | F: ACCTCAACGTCGCCGAGG R: CCAACCGGAGCCTTGGAC | 260 | NM_201527.2 |
GPX1 | F: CCTGAAGTACGTCCGACCAG R:GTCAGGCTCGATGTCGATGG | 289 | NM_174076.3 |
CAT | F: TCACTCAGGTGCGGACTTTC R: GGATGCGGGAGCCATATTCA | 162 | NM_001166486.1 |
StAR | F: TGGCATGGCCACACTCTATG R: GTCCTTGAGGGACTTCCAGC | 111 | NM_174189.3 |
HSD3B1 | F: TCCGGGTGCTAGACAAAGTC R: TGACGTCAATGACAGAGGCG | 171 | NM_174343.3 |
SIRT1 | F: CTGAAGAATCTGGTGGTGAAGTT R: TGTTAGAGGTGTCCAGCATGATG | 186 | NM_001192980 |
β-actin | F: CCATCGGCAATGAGCGGTTCC R: CGTGTTGGCGTAGAGGTCCTTG | 132 | NM_173979.3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiang, X.; Ma, Y.; Gong, S.; Zi, X.; Zhang, D. Resveratrol Promotes Proliferation, Antioxidant Properties, and Progesterone Production in Yak (Bos grunniens) Granulosa Cells. Animals 2024, 14, 240. https://doi.org/10.3390/ani14020240
Jiang X, Ma Y, Gong S, Zi X, Zhang D. Resveratrol Promotes Proliferation, Antioxidant Properties, and Progesterone Production in Yak (Bos grunniens) Granulosa Cells. Animals. 2024; 14(2):240. https://doi.org/10.3390/ani14020240
Chicago/Turabian StyleJiang, Xudong, Yao Ma, Sanni Gong, Xiangdong Zi, and Dawei Zhang. 2024. "Resveratrol Promotes Proliferation, Antioxidant Properties, and Progesterone Production in Yak (Bos grunniens) Granulosa Cells" Animals 14, no. 2: 240. https://doi.org/10.3390/ani14020240
APA StyleJiang, X., Ma, Y., Gong, S., Zi, X., & Zhang, D. (2024). Resveratrol Promotes Proliferation, Antioxidant Properties, and Progesterone Production in Yak (Bos grunniens) Granulosa Cells. Animals, 14(2), 240. https://doi.org/10.3390/ani14020240