Bacillus subtilis Feed Supplementation Combined with Oral E. coli Immunization in Sows as a Tool to Reduce Neonatal Diarrhea in Piglets
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Feedback Feeding
2.3. Animal Management and Experiment Design
2.4. Diarrhea Rate Assessment
2.5. Sample Collection
2.6. Antibody Level Analysis
2.7. Intestinal Tissue Histopathological Determination
2.8. Intestinal Tissue Tight Junction Proteins and Mucin Level Detection
2.9. Mammary Tissue Histopathological Changes and IgA Protein Level Detection
2.10. Intestinal Microbiota Analysis
2.11. Flow Cytometry Analysis
2.12. Statistical Analysis
3. Results
3.1. B. subtilis Improved the Reproductive Performance of Sows Challenged with E. coli and the Growth Performance of their Offspring
3.2. B. subtilis Enhanced the Immune Response of Sows to E. coli
3.3. IgA-Producing Plasma Cell Accumulation in the Intestinal Lymph Nodes and Transfer to Mammary Tissues might Participate in the Immune Response Enhanced by B. subtilis
3.4. B. subtilis Enhanced the Immune Response and Intestinal Barrier Function of Weaned Piglets Born to E. coli-Challenged Sows
3.5. B. subtilis Increased the Gut Microbiota Diversity of Suckling Piglets Born to E. coli-Challenged Sows
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jacobson, M. On the Infectious Causes of Neonatal Piglet Diarrhoea—A Review. Vet Sci 2022, 9, 422. [Google Scholar] [CrossRef] [Scilit]
- Pokharel, P.; Dhakal, S.; Dozois, C.M. The Diversity of Escherichia coli Pathotypes and Vaccination Strategies against This Versatile Bacterial Pathogen. Microorganisms 2023, 11, 344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dubreuil, J.D.; Isaacson, R.E.; Schifferli, D.M. Animal Enterotoxigenic Escherichia coli. EcoSal Plus 2016, 7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cox, E.; Loos, M.; Coddens, A.; Devriendt, B.; Goddeeris, B. Post-weaning E. coli infections in pigs and importance of the immune system. In Proceedings of the Association Française de Médecine Vétérinaire Porcine (AFMVP), Maisons-Alfort, France, 6–7 December 2012. [Google Scholar]
- Luppi, A. Swine enteric colibacillosis: Diagnosis, therapy and antimicrobial resistance. Porcine Health Manag. 2017, 3, 16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kongsted, H.; Stege, H.; Toft, N.; Nielsen, J.P. The effect of New Neonatal Porcine Diarrhoea Syndrome (NNPDS) on average daily gain and mortality in 4 Danish pig herds. BMC Vet. Res. 2014, 10, 90. [Google Scholar] [CrossRef] [Scilit]
- Jabif, M.F.; Gumina, E.; Hall, J.W.; Hernandez-Velasco, X.; Layton, S. Evaluation of a Novel Mucosal Administered Subunit Vaccine on Colostrum IgA and Serum IgG in Sows and Control of Enterotoxigenic Escherichia coli in Neonatal and Weanling Piglets: Proof of Concept. Front. Vet. Sci. 2021, 8, 640228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, T.; Gao, C.; Hao, J.; Lu, X.; Xie, K.; Wang, X.; Li, J.; Zhou, H.; Cui, W.; Shan, Z.; et al. Strategy of Developing Oral Vaccine Candidates Against Co-infection of Porcine Diarrhea Viruses Based on a Lactobacillus Delivery System. Front. Microbiol. 2022, 13, 872550. [Google Scholar] [CrossRef] [Scilit]
- Langel, S.N.; Paim, F.C.; Lager, K.M.; Vlasova, A.N.; Saif, L.J. Lactogenic immunity and vaccines for porcine epidemic diarrhea virus (PEDV): Historical and current concepts. Virus Res. 2016, 226, 93–107. [Google Scholar] [CrossRef] [Scilit]
- Bourgeois, A.L.; Wierzba, T.F.; Walker, R.I. Status of vaccine research and development for enterotoxigenic Escherichia coli. Vaccine 2016, 34, 2880–2886. [Google Scholar] [CrossRef] [Scilit]
- Hill, C.; Raizman, E.; Snider, T.; Goyal, S.; Perez, A.M. Emergence of Porcine Epidemic Diarrhea in North America; FAO: Rome, Italy, 2014. [Google Scholar]
- Lager, K.M.; Kulshreshtha, V. Development and application of the effective vaccine and other strategies against recent porcine epidemic diarrhea outbreaks. Jpn. J. Vet. Res. 2016, 64, S39–S42. [Google Scholar]
- Burkey, T.E.; Skjolaas, K.A.; Minton, J.E. BOARD-INVITED REVIEW: Porcine mucosal immunity of the gastrointestinal tract. J. Anim. Sci. 2009, 87, 1493–1501. [Google Scholar] [CrossRef] [Scilit]
- Srivastava, A.; Gowda, D.V.; Madhunapantula, S.V.; Shinde, C.G.; Iyer, M. Mucosal vaccines: A paradigm shift in the development of mucosal adjuvants and delivery vehicles. Apmis 2015, 123, 275–288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brandtzaeg, P. The mucosal immune system and its integration with the mammary glands. J. Pediatr. 2010, 156 (2 Suppl.), S8–S15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Usami, K.; Niimi, K.; Matsuo, A.; Suyama, Y.; Sakai, Y.; Sato, S.; Fujihashi, K.; Kiyono, H.; Uchino, S.; Furukawa, M.; et al. The gut microbiota induces Peyer’s-patch-dependent secretion of maternal IgA into milk. Cell Rep. 2021, 36, 109655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, S.; Mou, C.; Cao, Y.; Zhang, E.; Yang, Q. Immune response in piglets orally immunized with recombinant Bacillus subtilis expressing the capsid protein of porcine circovirus type 2. Cell Commun. Signal 2020, 18, 23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sudan, S.; Fletcher, L.; Zhan, X.; Dingle, S.; Patterson, R.; Huber, L.A.; Friendship, R.; Kiarie, E.G.; Li, J. Comparative efficacy of a novel Bacillus subtilis-based probiotic and pharmacological zinc oxide on growth performance and gut responses in nursery pigs. Sci. Rep. 2023, 13, 4659. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, J.; Wang, J.; Huang, K.; Liu, Q.; Xu, X.; Liu, G.; Zhang, H.; Zhu, M. Selenium-enriched Bacillus subtilis yb−114246 improved growth and immunity of broiler chickens through modified ileal bacterial composition. Sci. Rep. 2021, 11, 21690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, H.; Xu, C.; Wang, J.; Hu, C.; Ji, F.; Xie, J.; Yang, Y.; Yu, X.; Diao, X.; Lv, R. Effects of Dietary Probiotics and Acidifiers on the Production Performance, Colostrum Components, Serum Antioxidant Activity and Hormone Levels, and Gene Expression in Mammary Tissue of Lactating Sows. Animals 2023, 13, 1536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.; Wang, S.; Zhang, D.; Wang, J.; Zhang, W.; Wang, Y.; Ji, H. Effects of dietary supplementation with Pediococcus acidilactici ZPA017 on reproductive performance, fecal microbial flora and serum indices in sows during late gestation and lactation. Anim. Biosci. 2020, 33, 120–126. [Google Scholar] [CrossRef] [Scilit]
- Yamagami, T.; Miyama, T.; Toyomaki, H.; Sekiguchi, S.; Sasaki, Y.; Sueyoshi, M.; Makita, K. Analysis of the effect of feedback feeding on the farm-level occurrence of porcine epidemic diarrhea in Kagoshima and Miyazaki Prefectures, Japan. J. Vet. Med. Sci. 2021, 83, 1772–1781. [Google Scholar] [CrossRef] [Scilit]
- Barros, M.M.; Castro, J.; Araújo, D.; Campos, A.M.; Oliveira, R.; Silva, S.; Outor-Monteiro, D.; Almeida, C. Swine Colibacillosis: Global Epidemiologic and Antimicrobial Scenario. Antibiotics 2023, 12, 682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, C.; Peng, K.; She, Y.; Fu, F.; Shi, Q.; Lin, Y.; Xu, C. Preparation of novel trivalent vaccine against enterotoxigenic Escherichia coli for preventing newborn piglet diarrhea. Am. J. Vet. Res. 2023, 84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Q.; Li, J.; Cao, M.; Li, Y.; Zhuo, Y.; Fang, Z.; Che, L.; Xu, S.; Feng, B.; Lin, Y.; et al. Dietary supplementation of Bacillus subtilis PB6 improves sow reproductive performance and reduces piglet birth intervals. Anim. Nutr. 2020, 6, 278–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Christianson, W.T. Stillbirths, mummies, abortions, and early embryonic death. Vet. Clin. N. Am. Food Anim. Pract. 1992, 8, 623–639. [Google Scholar] [CrossRef] [Scilit]
- Lefebvre, R.C. Fetal mummification in the major domestic species: Current perspectives on causes and management. Vet. Med. 2015, 6, 233–244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leenhouwers, J.I.; Lende, T.V.D.; Knol, E.F. Analysis of stillbirth in different lines of pig. Livest. Prod. Sci. 1999, 57, 243–253. [Google Scholar] [CrossRef] [Scilit]
- Nam, N.H.; Truong, N.D.; Thanh, D.T.H.; Duan, P.N.; Hai, T.M.; Dao, B.T.A.; Sukon, P. Bacillus subtilis QST 713 Supplementation during Late Gestation in Gilts Reduces Stillbirth and Increases Piglet Birth Weight. Vet. Med. Int. 2022, 2022, 2462241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baker, A.A.; Davis, E.; Spencer, J.D.; Moser, R.; Rehberger, T. The effect of a Bacillus-based direct-fed microbial supplemented to sows on the gastrointestinal microbiota of their neonatal piglets. J. Anim. Sci. 2013, 91, 3390–3399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pereira, W.A.; Franco, S.M.; Reis, I.L.; Mendona, C.M.N.; Piazentin, A.C.M.; Azevedo, P.O.S.; Tse, M.L.P.; Martinis, E.C.P.D.; Gierus, M.; Oliveira, R.P.S. Beneficial effects of probiotics on the pig production cycle: An overview of clinical impacts and performance. Vet. Microbiol. 2022, 269, 109431. [Google Scholar] [CrossRef] [Scilit]
- Wolf, J.; Žáková, E.; Groeneveld, E. Within-litter variation of birth weight in hyperprolific Czech Large White sows and its relation to litter size traits, stillborn piglets and losses until weaning. Livest. Sci. 2008, 115, 195–205. [Google Scholar] [CrossRef] [Scilit]
- Gu, X.L.; Li, H.; Song, Z.H.; Ding, Y.N.; He, X.; Fan, Z.Y. Effects of isomaltooligosaccharide and Bacillus supplementation on sow performance, serum metabolites, and serum and placental oxidative status. Anim. Reprod. Sci. 2019, 207, 52–60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gu, X.; Chen, J.; Li, H.; Song, Z.; Chang, L.; He, X.; Fan, Z. Isomaltooligosaccharide and Bacillus regulate the duration of farrowing and weaning-estrous interval in sows during the perinatal period by changing the gut microbiota of sows. Anim. Nutr. 2021, 7, 72–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuxin, L.I.; Haiyan, W.; Bo, H. Effects of Pichia Guilliermondii Mannan Oligosaccharide on Growth Performance and Immune Function in Pigs. Feed Rev. 2018, 10, 1–3. [Google Scholar]
- Salmon, H. Mammary gland immunology and neonate protection in pigs. Homing of lymphocytes into the MG. Adv. Exp. Med. Biol. 2000, 480, 279–286. [Google Scholar]
- Melkebeek, V.; Goddeeris, B.M.; Cox, E. ETEC vaccination in pigs. Vet. Immunol. Immunopathol. 2013, 152, 37–42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sampath, V.; Cho, S.; Jeong, J.; Mun, S.; Lee, C.H.; Hermes, R.G.; Taechavasonyoo, A.; Smeets, N.; Kirwan, S.; Han, K.; et al. Dietary Bacillus spp. supplementation to both sow and progenies improved post-weaning growth rate, gut function, and reduce the pro-inflammatory cytokine production in weaners challenged with Escherichia coli K88. Anim. Microbiome 2024, 6, 3. [Google Scholar]
- Perricone, V.; Comi, M.; Bontempo, V.; Lecchi, C.; Ceciliani, F.; Crestani, M.; Ferrari, A.; Savoini, G.; Agazzi, A. Effects of nucleotides administration on growth performance and immune response of post-weaning piglets. Ital. J. Anim. Sci. 2020, 19, 295–301. [Google Scholar] [CrossRef] [Scilit]
- Konieczka, P.; Ferenc, K.; Jørgensen, J.N.; Hansen, L.H.B.; Zabielski, R.; Olszewski, J.; Gajewski, Z.; Mazur-Kuśnirek, M.; Szkopek, D.; Szyryńska, N.; et al. Feeding Bacillus-based probiotics to gestating and lactating sows is an efficient method for improving immunity, gut functional status and biofilm formation by probiotic bacteria in piglets at weaning. Anim. Nutr. 2023, 13, 361–372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, X.; Xu, J.; Ren, E.; Su, Y.; Zhu, W. Co-occurrence of early gut colonization in neonatal piglets with microbiota in the maternal and surrounding delivery environments. Anaerobe 2018, 49, 30–40. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Zeng, X.; Zhang, G.; Hou, C.; Li, N.; Yu, H.; Shang, L.; Zhang, X.; Trevisi, P.; Yang, F.; et al. Maternal milk and fecal microbes guide the spatiotemporal development of mucosa-associated microbiota and barrier function in the porcine neonatal gut. BMC Biol. 2019, 17, 106. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Guo, Y.; Wen, Z.; Jiang, X.; Ma, X.; Han, X. Weaning Stress Perturbs Gut Microbiome and Its Metabolic Profile in Piglets. Sci. Rep. 2018, 8, 18068. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Werner, J.J.; Garcia, M.L.; Perkins, S.D.; Yarasheski, K.E.; Smith, S.R.; Muegge, B.D.; Stadermann, F.J.; DeRito, C.M.; Floss, C.; Madsen, E.L.; et al. Microbial community dynamics and stability during an ammonia-induced shift to syntrophic acetate oxidation. Appl. Environ. Microbiol. 2014, 80, 3375–3383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kiernan, D.P.; O'Doherty, J.V.; Sweeney, T. The Effect of Maternal Probiotic or Synbiotic Supplementation on Sow and Offspring Gastrointestinal Microbiota, Health, and Performance. Animals 2023, 13, 2996. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dou, S.; Gadonna-Widehem, P.; Rome, V.; Hamoudi, D.; Rhazi, L.; Lakhal, L.; Larcher, T.; Bahi-Jaber, N.; Pinon-Quintana, A.; Guyonvarch, A.; et al. Characterisation of Early-Life Fecal Microbiota in Susceptible and Healthy Pigs to Post-Weaning Diarrhoea. PLoS ONE 2017, 12, e0169851. [Google Scholar] [CrossRef] [Scilit]
- Peng, L.; Li, Z.R.; Green, R.S.; Holzman, I.R.; Lin, J. Butyrate enhances the intestinal barrier by facilitating tight junction assembly via activation of AMP-activated protein kinase in Caco-2 cell monolayers. J. Nutr. 2009, 139, 1619–1625. [Google Scholar] [CrossRef] [Scilit]




| Item | Lactating Sow Feed 1 | Pregnant Sow Feed 2 |
|---|---|---|
| composition g/kg | ||
| Corn | 705 | 650 |
| Soybean pulp | 175 | 160 |
| Wheat bran | 50.0 | 108.5 |
| Soybean oil | 8.5 | 25.0 |
| Fish meal | 20 | 15 |
| Antioxidant | 0.5 | 0.5 |
| Mold inhibitor | 1 | 1 |
| 4% Premix | 40 | 40 |
| nutritive value | ||
| Metabolizable energy MJ/kg | 14.02 | 30.01 |
| Crude protein/% | 18.0 | 12.8 |
| Crude fiber/% | 3.0 | 6.0 |
| Lysine/% | 1.1 | 0.4 |
| Calcium/% | 0.76 | 0.75 |
| Phosphorus/% | 0.62 | 0.60 |
| Genes | Sequence of Forward and Reverse Primers |
|---|---|
| ZO-1 | F: ATGAGCAGGTCCCGTCCCAAG R: GGCGGAGGCAGCGGTTTG |
| occludin | F: GACAGACTACACAACTGGCGG R: TGTACTCCTGCAGGCCACTG |
| claudin 1 | F: CCATCGTCAGCACCGCACTG R: CGACACGCAGGACATCCACAG |
| muc-2 | F: CTGTGCGACTACAACTTCGC R: AGATGGTGTCGTCCTTGACC |
| β-actin | F: CTGCGGCATCCACGAAACT R: AGGGCCGTGATCTCCTTCTG |
| Items | FB 2 | FB + BS 2 | p-Value 1 |
|---|---|---|---|
| sows | |||
| Litter size (total births) | 15 (2) | 15 (4) | 0.86 |
| Litter weight at birth (kg) | 16.78 ± 0.48 | 18.40 ± 0.44 | 0.02 |
| Live-born piglet weight (kg) | 1.29 ± 0.49 | 1.30 ± 0.52 | 0.83 |
| piglets | |||
| Number of weaned piglets | 12 (1) | 12 (2) | 0.03 |
| Litter weight at weaning (kg) | 62.67 ± 0.75 | 67.40 ± 0.79 | <0.001 |
| Litter weight gain from birth to weaning (kg) | 45.89 ± 0.90 | 49.00 ± 0.80 | 0.02 |
| Piglet weight at weaning (kg) | 5.45 ± 0.09 | 5.54 ± 0.07 | 0.44 |
| Piglet daily weight gain from birth to weaning (g) | 259.30 ± 4.48 | 263.76 ± 3.47 | 0.44 |
| Piglet survival rate (%) | 88.73 (173/195) | 93.85 (183/195) | 0.05 |
| Diarrhea rate during lactation (%) | 15.03 (26/173) | 8.20 (15/183) | 0.03 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, J.; Yang, D.A.; Qu, H.; Liu, D.; Huang, K. Bacillus subtilis Feed Supplementation Combined with Oral E. coli Immunization in Sows as a Tool to Reduce Neonatal Diarrhea in Piglets. Animals 2024, 14, 1978. https://doi.org/10.3390/ani14131978
Liu J, Yang DA, Qu H, Liu D, Huang K. Bacillus subtilis Feed Supplementation Combined with Oral E. coli Immunization in Sows as a Tool to Reduce Neonatal Diarrhea in Piglets. Animals. 2024; 14(13):1978. https://doi.org/10.3390/ani14131978
Chicago/Turabian StyleLiu, Jianxin, Danchen Aaron Yang, Haobo Qu, Dandan Liu, and Kehe Huang. 2024. "Bacillus subtilis Feed Supplementation Combined with Oral E. coli Immunization in Sows as a Tool to Reduce Neonatal Diarrhea in Piglets" Animals 14, no. 13: 1978. https://doi.org/10.3390/ani14131978
APA StyleLiu, J., Yang, D. A., Qu, H., Liu, D., & Huang, K. (2024). Bacillus subtilis Feed Supplementation Combined with Oral E. coli Immunization in Sows as a Tool to Reduce Neonatal Diarrhea in Piglets. Animals, 14(13), 1978. https://doi.org/10.3390/ani14131978

