Establishment of a Real-Time PCR Assay for the Detection of Devriesea agamarum in Lizards
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Isolates Used to Establish the qPCR
2.2. DNA Preparation
2.3. Design of Primers and Oligonucleotide Probe, PCR Protocol and Optimisation of Annealing Temperature
2.4. Determination of Specificity at 66 °C and of Repeatability and Sensitivity of the Assay
2.5. Testing of Samples Submitted to a Commercial Veterinary Laboratory
3. Results
3.1. Development of the PCR
3.2. Specificity, Repeatability and Sensitivity of the Assay
3.3. Testing of Clinical Samples
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Haesendonck, R.; van Nieuwerburgh, F.; Haesebrouck, F.; Deforce, D.; Pasmans, F.; Martel, A. Genome Sequence of Devriesea agamarum, isolated from agamid lizards with dermatitis. Genome Announc. 2015, 3, e00949-15. [Google Scholar] [CrossRef] [PubMed]
- Hellebuyck, T.; Martel, A.; Chiers, K.; Haesebrouck, F.; Pasmans, F. Devriesea agamarum causes dermatitis in bearded dragons (Pogona vitticeps). Vet. Microbiol. 2009, 134, 267–271. [Google Scholar] [CrossRef] [PubMed]
- Devloo, R.; Martel, A.; Hellebuyck, T.; Vranckx, K.; Haesebrouck, F.; Pasmans, F. Bearded dragons (Pogona vitticeps) asymptomatically infected with Devriesea agamarum are a source of persistent clinical infection in captive colonies of dab lizards (Uromastyx sp.). Vet. Microbiol. 2011, 150, 297–301. [Google Scholar] [CrossRef] [PubMed]
- Lukac, M.; Horvatek-Tomic, D.; Prukner-Radovcic, E. Findings of Devriesea agamarum associated infections in spiny-tailed lizards (Uromastyx sp.) in Croatia. J. Zoo Wildl. Med. 2013, 44, 430–434. [Google Scholar] [CrossRef]
- Schmidt-Ukaj, S.; Hochleithner, M.; Richter, B.; Hochleithner, C.; Brandstetter, D.; Knotek, Z. A survey of diseases in captive bearded dragons: A retrospective study of 529 patients. Vet. Med. 2017, 62, 508–515. [Google Scholar] [CrossRef]
- Rossier, C.; Hoby, S.; Wenker, C.; Brawand, S.G.; Thomann, A.; Brodard, I.; Jermann, T.; Posthaus, H. Devrieseasis in a plumed basilisk (Basiliscus plumfrons) and chinese water dragons (Physignathus cocincinus) in a zoologic collection. J. Zoo Wildl. Med. 2016, 47, 280–285. [Google Scholar] [CrossRef]
- Hellebuyck, T.; Questel, K.; Pasmans, F.; van Brantegem, L.; Philip, P.; Martel, A. A virulent clone of Devriesea agamarum affects endangered Lesser Antillean iguanas (Iguana delicatissima). Sci. Rep. 2017, 7, 12491. [Google Scholar] [CrossRef]
- Schmidt-Ukaj, S.; Loncaric, I.; Klang, A.; Spergser, J.; Häbich, A.-C.; Knotek, Z. Infection with Devriesea agamarum and Chrysosporium guarroi in an inland bearded dragon (Pogona vitticeps). Vet. Dermatol. 2014, 25, 555–558, e97. [Google Scholar] [CrossRef]
- Gallego, M.; Juan-Sallés, C.; Hellebuyck, T. Devriesea agamarum associated cheilitis in a North African spiny-tailed lizard (Uromastyx acanthinura) in Spain. Open Vet. J. 2018, 8, 224–228. [Google Scholar] [CrossRef]
- Hedley, J.; Whitehead, M.L.; Munns, C.; Pellett, S.; Abou-Zahr, T.; Calvo Carrasco, D.; Wissink-Argilaga, N. Antibiotic stewardship for reptiles. J. Small Anim. Pract. 2021, 62, 829–839. [Google Scholar] [CrossRef]
- Martel, A.; Pasmans, F.; Hellebuyck, T.; Haesebrouck, F.; Vandamme, P. Devriesea agamarum gen. nov., sp. nov., a novel actinobacterium associated with dermatitis and septicaemia in agamid lizards. Int. J. Syst. Evol. Microbiol. 2008, 58, 2206–2209. [Google Scholar] [CrossRef] [PubMed]
- Hellebuyck, T.; Pasmans, F.; Haesebrouck, F.; Martel, A. Designing a successful antimicrobial treatment against Devriesea agamarum infections in lizards. Vet. Microbiol. 2009, 139, 189–192. [Google Scholar] [CrossRef] [PubMed]
- Hellebuyck, T.; Pasmans, F.; Blooi, M.; Haesebrouck, F.; Martel, A. Prolonged environmental persistence requires efficient disinfection procedures to control Devriesea agamarum-associated disease in lizards. Lett. Appl. Microbiol. 2011, 52, 28–32. [Google Scholar] [CrossRef] [PubMed]
- Hellebuyck, T.; van Steendam, K.; Deforce, D.; Blooi, M.; van Nieuwerburgh, F.; Bullaert, E.; Ducatelle, R.; Haesebrouck, F.; Pasmans, F.; Martel, A. Autovaccination confers protection against Devriesea agamarum associated septicemia but not dermatitis in bearded dragons (Pogona vitticeps). PLoS ONE 2014, 9, e113084. [Google Scholar] [CrossRef] [PubMed]
- Brockmann, M.; Aupperle-Lellbach, H.; Gentil, M.; Heusinger, A.; Müller, E.; Marschang, R.E.; Pees, M. Challenges in microbiological identification of aerobic bacteria isolated from the skin of reptiles. PLoS ONE 2020, 15, e0240085. [Google Scholar] [CrossRef] [PubMed]
- Bauwens, L.; Vercammen, F.; Hendrickx, F.; Pasmans, F.; Martel, A. Prevalence of Devriesea agamarum in the lizard collection of The Royal Zoological Society of Antwerp. J. Zoo Aquar. Res. 2014, 2, 88. [Google Scholar]
- Brockmann, M.; Aupperle-Lellbach, H.; Müller, E.; Heusinger, A.; Pees, M.; Marschang, R.E. Aerobes Keimspektrum und Resistenzlage bei Hautläsionen von Reptilien. Tierarztl. Prax. Ausg. K Kleintiere. Heimtiere. 2020, 48, 78–88. [Google Scholar] [CrossRef]
- Pasmans, F.; Martel, A.; Jacobson, E.R. Bacterial Diseases of Reptiles. In Infectious Diseases and Pathology of Reptiles: Color Atlas and Text; Jacobson, E.R., Ed.; CRC Press: Boca Raton, FL, USA, 2021; pp. 705–794. [Google Scholar]
- Marschang, R.E.; Origgi, F.C.; Stenglein, M.D.; Hyndman, T.H.; Wellehan, J.F.; Jacobson, E.R. Viruses and Viral Diseases of Reptiles. In Infectious Diseases and Pathology of Reptiles: Color Atlas and Text; Jacobson, E.R., Ed.; CRC Press: Boca Raton, FL, USA, 2021; pp. 575–703. [Google Scholar]
- Paré, J.A.; Conley, K.J. Mycotic Diseases of Reptiles. In Infectious Diseases and Pathology of Reptiles: Color Atlas and Text; Jacobson, E.R., Ed.; CRC Press: Boca Raton, FL, USA, 2021; pp. 795–857. [Google Scholar]
- Young, G.; Turner, S.; Davies, J.K.; Sundqvist, G.; Figdor, D. Bacterial DNA persists for extended periods after cell death. J. Endod. 2007, 33, 1417–1420. [Google Scholar] [CrossRef]
- Bayram, L.C.; Abay, S.; Saticioglu, İ.B.; Güvenc, T.; Ekebas, G.; Aydi, F. Panophthalmitis in a Gentoo Penguin (Pygoscelis Papua) from the Antarctic Peninsula: Evaluation of Microbiological and Histopathological Analysis Outcomes. Res. Sq. 2021, Preprint. [Google Scholar] [CrossRef]
- Swaney, M.H.; Nelsen, A.; Sandstrom, S.; Kalan, L.R. Sweat and sebum preferences of the human skin microbiota. Microbiol. Spectr. 2023, 11, e04180-22. [Google Scholar] [CrossRef]
- Gómez-Garcés, J.L.; Oteo, J.; García, G.; Aracil, B.; Alós, J.I.; Funke, G. Bacteremia by Dermabacter hominis, a rare pathogen. J. Clin. Microbiol. 2001, 39, 2356–2357. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.-J.; Cho, C.-H.; Kwon, M.-J.; Nam, M.-H.; Lee, K.-N.; Lee, C.-K. A Patient with Fatal Septicemia Caused by a Rare Pathogen Dermabacter Hominis. Infect Chemother 2011, 43, 86. [Google Scholar] [CrossRef]
- Fernández-Natal, I.; Sáez-Nieto, J.A.; Medina-Pascual, M.J.; Albersmeier, A.; Valdezate, S.; Guerra-Laso, J.M.; Rodríguez, H.; Marrodán, T.; Parras, T.; Tauch, A.; et al. Dermabacter hominis: A usually daptomycin-resistant gram-positive organism infrequently isolated from human clinical samples. New Microbes New Infect. 2013, 1, 35–40. [Google Scholar] [CrossRef] [PubMed]
- Schaub, C.; Dräger, S.; Hinic, V.; Bassetti, S.; Frei, R.; Osthoff, M. Relevance of Dermabacter hominis isolated from clinical samples, 2012-2016: A retrospective case series. Diagn. Microbiol. Infect. Dis. 2020, 98, 115118. [Google Scholar] [CrossRef]

| No. | Isolate | Host | Sample Material | Laboratory |
|---|---|---|---|---|
| 1 | MT664091.1/0219 Bf | Brachylophus fasciatus | Swab (skin) | Laboklin GmbH & Co. KG, Germany |
| 2 | MT664092.1/0919 Ur | Uromastyx sp. | Swab (skin) | Laboklin GmbH & Co. KG, Germany |
| 3 | MT664093.1/0319 Ur | Uromastyx sp. | Swab (skin) | Laboklin GmbH & Co. KG, Germany |
| 4 | IMP2 vacc | Agama impalearis | Swab (dermatitis), liver | Faculty of Veterinary Medicine, Ghent University |
| 5 | 30.7 | Uromastyx dispar | Swab (dermatitis, cheilitis) | Faculty of Veterinary Medicine, Ghent University |
| 6 | 34.1 | Uromastyx acanthinura | Swab (dermal abscess) | Faculty of Veterinary Medicine, Ghent University |
| 7 | 23 | Pogona vitticeps | Swab (oral cavity) | Faculty of Veterinary Medicine, Ghent University |
| 8 | 24 | Pogona vitticeps | Swab (oral cavity) | Faculty of Veterinary Medicine, Ghent University |
| 9 | 25 | Pogona vitticeps | Swab (oral cavity) | Faculty of Veterinary Medicine, Ghent University |
| 10 | 26 | Crotaphytus collaris | Swab (dermatitis) | Faculty of Veterinary Medicine, Ghent University |
| 11 | 28 | Eublepharis macularius | Swab (oral cavity) | Faculty of Veterinary Medicine, Ghent University |
| 12 | 30b | Ctenonotus gingivus | Swab (cloaca) | Faculty of Veterinary Medicine, Ghent University |
| 13 | 4d | Iguana delicatissima | Swab (dermal abscess) | Faculty of Veterinary Medicine, Ghent University |
| 14 | L26 | Pogona vitticeps | Swab (oral cavity) | Faculty of Veterinary Medicine, Ghent University |
| No. | Bacterial Species | DSMZ Number | Original Depositor (Acc. to DSMZ) |
|---|---|---|---|
| 1 | Acinetobacter baumannii | DSM 30007 | J.V. Cook |
| 2 | Bacillus atrophaeus | DSM 675 | E. McCoy |
| 3 | Cytobacillus firmus | DSM 359 | G. Bredemann |
| 4 | Brachybacterium faecium | DSM 4810 | H.E. Schefferle |
| 5 | Dermabacter hominis | DSM 30958 | C. Moissl-Eichinger |
| 6 | Enterococcus faecalis | DSM 2570 | Kaiser-Permanente |
| 7 | Enterococcus faecium | DSM 20477 | A. Grumbach |
| 8 | Enterococcus faecium | DSM 2146 | J.M. Skerman (Streptococcus faecalis) |
| 9 | Escherichia coli | DSM 1103 | F. Schoenknecht |
| 10 | Escherichia coli | DSM 1576 | G.C. Crooks |
| 11 | Flavobacterium psychrophilum | DSM 21280 | J.-F. Bernardet |
| 12 | Klebsiella oxytoca | DSM 5175 | R. Hugh |
| 13 | Klebsiella pneumoniae | DSM 26371 | H. Dalton |
| 14 | Klebsiella pneumoniae | DSM 30104 | CDC, Atlanta; 298-53 |
| 15 | Listeria monocytogenes | DSM 19094 | H. Seeliger |
| 16 | Mycobacterium phlei | DSM 750 | IPH |
| 17 | Nocardia nova | DSM 44481 | N. F. Conant |
| 18 | Proteus hauseri | DSM 30118 | K.B. Lehmann |
| 19 | Proteus mirabilis | DSM 4479 | CDC PR 14 |
| 20 | Pseudomonas aeruginosa | DSM 1128 | C.P. Hegarty |
| 21 | Pseudomonas aeruginosa | DSM 1117 | A. Madeiros |
| 22 | Salmonella enterica | DSM 19587 | CDC |
| 23 | Salmonella enterica | DSM 17420 | CDC |
| 24 | Staphylococcus aureus | DSM 2569 | E.H. Gerlach |
| 25 | Staphylococcus aureus | DSM 1104 | F. Schoenknecht |
| 26 | Staphylococcus aureus | DSM 46320 | W. Witte |
| 27 | Staphylococcus aureus | DSM 799 | AMC |
| 28 | Streptococcus dysgalactiae | DSM 20662 | T.M. Higgs |
| 29 | Staphylococcus epidermidis | DSM 1798 | FDA |
| 30 | Streptococcus equi ssp. equi | DSM 20561 | R.E.O. Williams |
| 31 | Staphylococcus felis | DSM 7377 | S. Igimi |
| 32 | Staphylococcus intermedius | DSM 20373 | V. Hajek |
| 33 | Streptococcus pyogenes | DSM 11728 | E. Mortimer |
| 34 | Yersinia enterocolitica | DSM 4780 | J.M. Coffey |
| Forward Primer Devag16_For | GATGACTGCAGAGATGTGGTG |
| Reverse Primer Devag16_Rev | TTTGTACCGGCCATTGTAGCAT |
| Oligonucleotide probe FAM BHQ1 | CATGTTGCCAGCACTTCGG |
| Animal No. | Species | Clinical Signs and History and Additional Information | Country of Origin | Time from Sampling to Sample Preparation: | Sample Material | Bacterial Culture | PCR Result |
|---|---|---|---|---|---|---|---|
| 1 | Uromastyx sp. | Suspicious skin lesion Same wildlife park as animal 2 | NL | unknown | Skin | N.D. | Positive (CT 23.71) |
| 2 | Uromastyx sp. | Suspected lesions/ dermatitis Same wildlife park as animal 1 | NL | unknown | Swabs (skin) | N.D. | Positive (CT 30.53) |
| 3 | Pogona sp. | Black discoloration of the scales after shedding, especially on the tail. | NL | 5d | Skin | + Glutamibacter creatinolyticus + Micrococcus sp. + aerobic spore-forming bacteria | Negative |
| Swab (skin) | Negative | ||||||
| 4 | Uromastyx sp. | Partner to animal 5 | NL | 2d | Swab (oral mucosa) | ++ Pantoea agglomerans ++ Pseudomonas aeruginosa ++ aerobic spore-forming bacteria | Positive (CT 28.47) |
| 5 | Uromastyx sp. | Partner to animal 4 | NL | 2d | Swab (oral mucosa) | ++ Exiguobacterium mexicanum ++ Kluyvera intermedia ++ Pseudomonas chlororaphis ++ aerobic spore-forming bacteria | Negative |
| 6 | Uromastyx sp. | Reported to have been treated with antibiotics | NL | 2d | Swab (oral mucosa) | ++ Acinetobacter variabilis +++ Arthrobacter globiformis + Bacillus cereus | Positive (CT 28.44) |
| 7 | Pogona vitticeps | No clinical signs | DE | 1d | Swab (oral mucosa) | ++ Proteus mirabilis | Positive (CT 33.17) |
| 8 | Pogona vitticeps | No clinical signs | DE | 1d | Swab (oral mucosa) | +++ Enterobacter cloacae + Pseudomonas aeruginosa | Equivocal (CT 35.71) |
| 9 | Pogona vitticeps | No clinical signs Partner to animal 10 Confiscated | DE | 1d | Swab (oral mucosa) | ++ Bordetella hinzii | Negative |
| 10 | Pogona vitticeps | No clinical signs Partner to animal 9 Confiscated | DE | 1d | Swab (oral mucosa) | + Bordetella hinzii + Peribacillus muralis ++ Enterococcus faecalis + Pantoea agglomerans | Negative |
| 11 | Pogona vitticeps | No clinical signs Abandoned | DE | 1d | Swab (oral mucosa) | ++ Morganella morganii ++ Klebsiella oxytoca | Positive (CT 27.56) |
| 12 | Pogona vitticeps | No clinical signs Abandoned | DE | 1d | Swab (oral mucosa) | ++ Klebsiella oxytoca + Proteus mirabilis | Negative |
| 13 | Pogona henrylawsoni | No clinical signs Abandoned juvenile same enclosure as animals 14 and 15 | DE | unknown | Swab (oral mucosa) | + Aeromonas hydrophila (+) aerobic spore-forming bacteria | Negative |
| 14 | Pogona henrylawsoni | No clinical signs Abandoned juvenile same enclosure as animals 13 and 15 | DE | unknown | Swab (oral mucosa) | ++ Proteus mirabilis (+) aerobic spore-forming bacteria | Negative |
| 15 | Pogona henrylawsoni | No clinical signs Abandoned juvenile same enclosure as animals 13 and 14 | DE | unknown | Swab (oral mucosa) | + Aeromonas hydrophila (+) alpha-hemolytic streptococci | Negative |
| 16 | Pogona vitticeps | No clinical signs | DE | unknown | Swab (oral mucosa) | + Aeromonas hydrophila + Pseudomonas aeruginosa (+) aerobic spore-forming bacteria | Positive (CT 27.20) |
| 17 | Pogona vitticeps | No clinical signs | DE | unknown | Swab (oral mucosa) | +++ Klebsiella oxytoca | Equivocal (CT 35.26) |
| 18 | Pogona vitticeps | No clinical signs | DE | unknown | Swab (oral mucosa) | ++ Klebsiella oxytoca | Equivocal (CT 35.07) |
| 19 | Scincidae | Unknown | DE | 2d | Skin | N.D. | Negative |
| 20 | Iguanidae | Hyperkeratosis (dorsal) | DE | 2d | Skin | N.D. | Negative |
| 21 | Uromastyx sp. | Skin lesion | DE | 2d | Skin | N.D. | Positive (CT 21.34) |
| 22 | Uromastyx sp. | Skin lesion Animals 22, 23 and 24 kept in the same enclosure | DE | unknown | Swab (outer skin of the mouth) | + Pseudomonas aeruginosa + Serratia marcescens | Positive (CT 28.45) |
| Swab (oral mucosa) | + Pseudomonas aeruginosa + Serratia marcescens | Positive (CT 34.89) | |||||
| Skin | N.D. | Positive (CT 31.56) | |||||
| Swab (skin) | N.D. | Positive (CT 30.88) | |||||
| 23 | Uromastyx sp. | Skin lesion Animals 22, 23 and 24 kept in the same enclosure | DE | unknown | Swab (outer skin of the mouth) | + Enterobacter cloacae | Positive (CT 32.20) |
| Swab (oral mucosa) | + Enterobacter cloacae | Positive (CT 32.06) | |||||
| Skin | N.D. | Positive (CT 31.97) | |||||
| Swab (Skin) | N.D. | Positive (CT 34.05) | |||||
| 24 | Uromastyx sp. | Skin lesion Animals 22, 23 and 24 kept in the same enclosure | DE | unknown | Swab (outer skin of the mouth) | + Pseudomonas synxantha | Equivocal (CT 35.24) |
| Swab (oral mucosa) | + Pantoea agglomerans | Negative | |||||
| Skin | N.D. | Positive (CT 33.84) | |||||
| Swab (Skin) | N.D. | Equivocal (CT 35.75) | |||||
| 25 | Corucia zebrata | Multiple animals with minimal to moderate stomatitis | NL | 2d | Swab (skin) | N.D. | Negative |
| Skin | +++ Pseudomonas aeruginosa | Negative | |||||
| 26 | Chlamydosaurus kingii | No clinical signs Kept with animal 27 | DE | 5d | Swab (oral mucosa) | + Proteus mirabilis ++ Serratia marcescens | Negative |
| 27 | Chlamydosaurus kingii | No clinical signs Kept with animal 26 | DE | 5d | Swab (oral mucosa) | + Klebsiella oxytoca + Stenotrophomonas maltophilia + aerobic spore-forming bacteria | Negative |
| 28 | Laemanctus serratus | No clinical signs Kept with animals 29 and 30 | DE | 5d | Swab (oral mucosa) | + Klebsiella oxytoca + Morganella morganii | Positive (CT 31.20) |
| 29 | Laemanctus serratus | No clinical signs Kept with animals 28 and 30 | DE | 5d | Swab (oral mucosa) | + Deinococcus proteolyticus + Morganella morganii + Serratia marcescens | Positive (CT 34.35) |
| 30 | Laemanctus serratus | No clinical signs Kept with animals 28 and 29 | DE | 5d | Swab (oral mucosa) | + Morganella morganii + Proteus mirabilis | Positive (CT 29.10) |
| 31 | Laudakia stellio picea | No clinical signs Kept with animal 32 | DE | 5d | Swab (oral mucosa) | (+) aerobic spore-forming bacteria | Equivocal (CT 35.80) |
| 32 | Laudakia stellio picea | No clinical signs Kept with animal 31 | DE | 5d | Swab (oral mucosa) | + Pseudomonas sp. + Serratia marcescens + aerobic spore-forming bacteria | Equivocal (CT 36.87) |
| 33 | Pogona vitticeps | No clinical signs Kept with animal 34 | DE | 5d | Swab (oral mucosa) | (+) Staphylococcus epidermidis | Positive (CT 34.07) |
| 34 | Pogona vitticeps | No clinical signs Kept with animal 33 | DE | 5d | Swab (oral mucosa) | + Staphylococcus aureus (+) aerobic spore-forming bacteria | Positive (CT 32.61) |
| 35 | Pogona vitticeps | Juvenile No clinical signs Kept with animals 36, 37 and 38 | DE | 5d | Swab (oral mucosa) | (+) aerobic spore-forming bacteria | Negative |
| 36 | Pogona vitticeps | Juvenile No clinical signs Kept with animals 35, 37 and 38 | DE | 5d | Swab (oral mucosa) | + Achromobacter xylosoxidans | Negative |
| 37 | Pogona vitticeps | Juvenile No clinical signs Kept with animals 35, 36 and 38 | DE | 5d | Swab (oral mucosa) | + Serratia marcescens (+) aerobic spore-forming bacteria | Negative |
| 38 | Pogona vitticeps | Juvenile No clinical signs Kept with animals 35, 36 and 37 | DE | 5d | Swab (oral mucosa) | + Proteus mirabilis | Negative |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Brockmann, M.; Leineweber, C.; Hellebuyck, T.; Martel, A.; Pasmans, F.; Gentil, M.; Müller, E.; Marschang, R.E. Establishment of a Real-Time PCR Assay for the Detection of Devriesea agamarum in Lizards. Animals 2023, 13, 881. https://doi.org/10.3390/ani13050881
Brockmann M, Leineweber C, Hellebuyck T, Martel A, Pasmans F, Gentil M, Müller E, Marschang RE. Establishment of a Real-Time PCR Assay for the Detection of Devriesea agamarum in Lizards. Animals. 2023; 13(5):881. https://doi.org/10.3390/ani13050881
Chicago/Turabian StyleBrockmann, Maria, Christoph Leineweber, Tom Hellebuyck, An Martel, Frank Pasmans, Michaela Gentil, Elisabeth Müller, and Rachel E. Marschang. 2023. "Establishment of a Real-Time PCR Assay for the Detection of Devriesea agamarum in Lizards" Animals 13, no. 5: 881. https://doi.org/10.3390/ani13050881
APA StyleBrockmann, M., Leineweber, C., Hellebuyck, T., Martel, A., Pasmans, F., Gentil, M., Müller, E., & Marschang, R. E. (2023). Establishment of a Real-Time PCR Assay for the Detection of Devriesea agamarum in Lizards. Animals, 13(5), 881. https://doi.org/10.3390/ani13050881

