Next Article in Journal
Replacing Concentrate with Yeast- or EM-Fermented Cassava Peel (YFCP or EMFCP): Effects on the Feed Intake, Feed Digestibility, Rumen Fermentation, and Growth Performance of Goats
Next Article in Special Issue
Dietary Supplementation of Eubiotic Fiber Based on Lignocellulose on Performance and Welfare of Gestating and Lactating Sows
Previous Article in Journal
Oral Sampling of Little Brown Bat (Myotis lucifugus) Maternity Colonies for SARS-CoV-2 in the Northeast and Mid-Atlantic, USA
Previous Article in Special Issue
Evaluation on the Growth Performance, Nutrient Digestibility, Faecal Microbiota, Noxious Gas Emission, and Faecal Score on Weaning Pigs Supplement with and without Probiotics Complex Supplementation in Different Level of Zinc Oxide
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Effects of Phytase and Non-Starch Polysaccharide-Hydrolyzing Enzymes on Trace Element Deposition, Intestinal Morphology, and Cecal Microbiota of Growing–Finishing Pigs

1
Key Laboratory of Agro-Ecological Processes in Subtropical Region, Hunan Provincial Key Laboratory of Animal Nutritional Physiology and Metabolic Process, Hunan Research Center of Livestock and Poultry Sciences, South Central Experimental Station of Animal Nutrition and Feed Science in the Ministry of Agriculture, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China
2
Department of Animal Science, Hunan Agriculture University, Changsha 410125, China
3
College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Animals 2023, 13(4), 549; https://doi.org/10.3390/ani13040549
Submission received: 15 January 2023 / Accepted: 30 January 2023 / Published: 4 February 2023
(This article belongs to the Special Issue Effect of Feed Efficiency on Growth Performance of Pigs)

Simple Summary

Phytase and NSPase have been widely used to improve growth performance in swine by improving nutrient utilization. However, the effects of phytase and NSPase (β-glucanase, xylanase, and β-mannanase) with corn–soybean meal-based diets on the trace element deposition of pigs still remains unknown. In this study, the effects of phytase, β-glucanase, xylanase, and β-mannanase on the trace element deposition and intestinal health of growing–finishing pigs were compared. In conclusion, phytase and xylanase supplementation increased the zinc deposition in pigs. Additionally, the supplementation of NSPases may improve the gut health of pigs by modulating the intestinal morphology and microbiota.

Abstract

This study investigated the effects of supplementing phytase and non-starch polysaccharide-degrading enzymes (NSPases) to corn–soybean meal-based diet on the growth performance, trace element deposition, and intestinal health of growing–finishing pigs. Fifty pigs were randomly assigned into the control (basal diet), phytase (basal diet + 100 g/t of phytase), β-mannanase (basal diet + 40 g/t of β-mannanase), β-glucanase (basal diet + 100 g/t of β-glucanase), and xylanase (basal diet + 100 g/t of xylanase) groups. The results show that the supplementation of phytase and NSPases had no impacts (p  >  0.05) on the growth performance of pigs. Compared with the control group, pigs fed with xylanase had higher (p < 0.05) Zn concentrations in the ileum and muscle and those fed with phytase had higher (p < 0.05) Zn concentrations in the ileum. Phytase and xylanase supplementation decreased (p < 0.05) fecal Zn concentrations in pigs compared with the control group (p < 0.05). In addition, phytase, β-mannanase, β-glucanase, and xylanase supplementation up-regulated (p < 0.05) the FPN1 expression, whereas xylanase up-regulated (p < 0.05) the Znt1 expression in the duodenum of pigs compared with the control group. Moreover, phytase, β-glucanase, and xylanase supplementation up-regulated (p < 0.05) the jejunal Znt1 expression compared with the control group. The intestinal morphology results show that the phytase, β-mannanase, and xylanase groups had increased villus heights (VHs), an increased villus height–crypt depth ratio (VH:CD), and decreased crypt depths (CDs) in the duodenum, whereas phytase, β-mannanase, β-glucanase, and xylanase groups had decreased VH and VH:CD, and increased CD in the jejunum compared with the control group (p < 0.05). Pigs fed with exogenous enzymes had decreased bacterial diversity in the cecum. The dietary supplementation of NSPases increased the relative abundance of Firmicutes and decreased spirochaetes (p < 0.05). Compared with the control group, dietary NSPase treatment decreased (p < 0.05) the opportunistic pathogens, such as Treponema_2 and Eubacterium_ruminantium. Moreover, the relative abundances of Lachnospiraceae_XPB1014 and Lachnospiraceae were enriched in the β-glucanase and β-mannanase groups (p < 0.05), respectively. In conclusion, phytase and xylanase supplementation may promote zinc deposition in pigs. Additionally, the supplementation of NSPases may improve the gut health of pigs by modulating the intestinal morphology and microbiota.

1. Introduction

Trace elements such as iron (Fe), copper (Cu), and zinc (Zn) are essential nutrients for the normal growth of animals. Generally, trace elements from the diet are absorbed by the gastrointestinal tract (GIT) and enter into the blood circulation. However, the interactions between trace elements and other substances in diets impaired the absorption of trace elements in the GIT [1]. Therefore, enhancing trace element utilization in diets could be a potential strategy to improve the nutritional quality of diets. Corn and soybean meals are commonly used as feed ingredients for pigs because of their high nutritional values; however, the available trace elements in corn and soybean are limited due to the presence of phytate and non-starch polysaccharides (NSPs) [2,3,4]. Phytate, a hexaphosphoric ester of cyclohexane, consists of insoluble complexes with divalent cations that cannot be absorbed by the small intestine [5]. NSPs in corn and soybean meal are predominantly composed of β-glucans, arabinoxylans, and mannans. The functional properties of some NSPs, such as solubility, viscosity, and water- and ion-binding capacity, can impair mineral absorption in the GIT of pigs [6]. Monogastric animals cannot digest NSPs and phytate due to the lack of endogenous NSP-degrading enzymes (NSPases) and phytases [7]. Therefore, the anti-nutritional effects of NSPs and phytate may improve due to the impact of the supplementation of NSPases and phytase [8,9]. Phytase can break down the phytate molecules and release phosphorus and minerals [10]. NSPases can partially hydrolyze NSPs and thus reduce digesta viscosity and rupture plant cell walls to release cellular nutrients for digestion [4,11]. Thus, NSPases have been mostly applied as feed supplements to promote the growth performance of animals [12,13]. Moreover, the dietary supplementation of NSPases in corn–soybean meal-based diets may produce numerous short-chain oligosaccharides, which may act as prebiotics to modulate intestinal microbiota [14]. Pigs in growing–finishing stage have very large populations, consume large amounts of feed, and excrete the maximum amount of trace elements as slurry [15,16]. However, it is unclear if supplementing β-mannanase, β-glucanase, and xylanase alone in corn–soybean meal-based diets will affect the trace element deposition of growing–finishing pigs. Therefore, the present study was conducted to evaluate the effects of dietary NSPases (β-mannanase, β-glucanase, and xylanase) and phytase supplementation with corn–soybean meal-based diets on the growth performance, trace element deposition, intestinal morphology, and cecal microbiota of growing–finishing pigs.

2. Materials and Methods

2.1. Animals, Diets, and Experimental Design

The experimental protocol used in the present study was approved by the Animal Care and Use Committee of the Institute of Subtropical Agriculture, Chinese Academy of Sciences (IACUC # 201302).
Fifty healthy crossbred (Landrace × Large White) pigs with an average body weight of 55.95 ± 6.46 kg were selected and randomly assigned to one of five groups with ten replicates (pens) per group and one pig per pen. The five treatment groups included the control (fed a basal diet), phytase (fed a basal diet supplemented with 100 g/t of phytase), β-mannanase (fed a basal diet supplemented with 40 g/t of β-mannanase), β-glucanase (fed a basal diet supplemented with 100 g/t of β-glucanase), and xylanase (fed a basal diet supplemented with 100 g/t of xylanase). Phytase, β-mannanase, β-glucanase, and xylanase were mixed separately with the powder-form basal diet. All pigs had free access to feed and water at all times. The diets were formulated according to the NRC recommendation (NRC, 2012) to meet the nutrient requirements of growing–finishing pigs [17]. The ingredients and calculated nutrient levels of the basal diet are presented in Table 1. The exogenous enzymes (phytase, β-mannanase, β-glucanase, and xylanase) were provided by the Wuhan Sunhy Biology Co., Lid. (Wuhan, China). The phytase, β-mannanase, β-glucanase, and xylanase contained 5000U of phytase/g, 1000 U of β-mannanase/g, 5000 U of β-glucanase/g, and 10,000 U of xylanase/g, respectively.
The animal trial lasted 30 days. Fecal collection was completed in the 30 d. At the end of the experiment, six pigs with an average body weight per group were randomly selected and euthanized under commercial conditions by electrical stunning (250 V, 0.5 A, for 5~6 s). The intestinal (duodenum, jejunum, and ileum), kidney, muscle, and liver tissue samples were collected, immediately frozen into liquid nitrogen, and stored at −80 °C until further analyses. Additionally, cecal digesta were collected and immediately stored at −80 °C for microbiota analysis.

2.2. Growth Performance

The pigs were individually weighed at the beginning and end of the experiment. Feed consumption per pen was recorded daily. The average daily gain (ADG), average daily feed intake (ADFI), and feed-to-gain ratio (F/G ratio) were calculated as previously described [18].

2.3. Trace Element Analysis

The concentrations of Fe, Cu, and Zn in the jejunum, ileum, muscle, liver, kidney, and fecal were determined by the method described by Nguyen et al. [19]. Briefly, approximately 1.00 g of each sample was accurately weighed into Teflon tubes (Milestone, Sorisole, Bergamo, Italy) and then digested with 8 mL of HNO3 and 1 mL of H2O2 using an UltraWAVE microwave digestion system (Milestone, Sorisole, Bergamo, Italy). The digested samples were diluted to 10 mL with 1% nitric acid to analyze the trace element concentrations using an inductively coupled plasma emission spectrometer (ICP-720ES; Agilent, Palo Alto, CA, USA).

2.4. Analysis of mRNA Expression

Quantitative real-time PCR (RT-qPCR) analysis was performed, as described previously [20]. Briefly, the total RNA of the duodenum, jejunum, and ileum was extracted using the TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) and then reversely transcribed into complementary DNA (cDNA) using RevertAid reverse transcriptase (Takara, Otsu, Japan). RT-qPCR analysis was performed with SYBR green I fluorescent dye (Takara, Otsu, Japan). The relative levels of the mRNA expression of the target genes were calculated using the 2−ΔΔCt method [21,22]. All primer sequences are presented in Table 2.

2.5. Assessment of Small Intestinal Morphology

The paraformaldehyde-fixed duodenal, jejunal, and ileal samples were dehydrated and embedded in paraffin following the procedures described by Liu et al. [23]. Five µm thick transverse sections were stained with hematoxylin and eosin (H&E). The villus height (VH) and crypt depth (CD) were measured using a light microscope (Leica DMI3000B microscopy, Germany), and the VH-to-CD ratio (VH:CD) was calculated.

2.6. Cecal Microbiota Analysis

Cecal microbial DNA was extracted using the stool DNA kit (Omega Bio-Tek, Norcross, GA, USA). The genes of all microbial 16S rRNA sequences in the hypervariable regions of V4-V5 were amplified by PCR using the universal primers 515F 5′-barcode- GTGCCAGCMGCCGCGG)-3′ and 907R 5′-CCGTCAATTCMTTTRAGTTT-3′. The PCR-amplified products were extracted by 1.5% agarose gel electrophoresis, purified using an AxyPrep DNA gel extraction kit (Axygen Biosciences, Union City, CA, USA), and quantified using the QuantiFluor™ ST (Promega, Madison, WI, USA). The purified amplicons were pooled in equimolar from each sample and paired-end and sequenced (2 × 250) on an Illumina MiSeq platform (Illumina, San Diego, CA, USA), according to the standard protocols by Shanghai MajorBio pharm Technology Co., Ltd. (Shanghai, China). The raw reads can be found at: https://dataview.ncbi.nlm.nih.gov/object/PRJNA904409. Raw fastq files were demultiplexed and quality-filtered using QIIME (version 1.17). Operational units (OTUs) were clustered with 97% similarity cutoff using UPARSE (version 7.1) and chimeric sequences were identified and removed using UCHIME. The taxonomy of each 16S rRNA gene sequence was analyzed by the RDP classifier (http://rdp.cme.msu.edu/) against the silva (SSU115)16S rRNA database using a confidence threshold of 70% [24].

2.7. Statistical Analysis

Except for microbiome analysis, all statistical analyses were performed using IBM SPSS 22.0 software (SPSS Inc, Chicago, IL, USA). The differences among experimental treatments were performed using one-way ANOVA analysis followed by a Tukey test [25,26]. The Kruskal–Wallis (KW) nonparametric analysis of variance was used to establish the statistical significance of 16S rRNA gene sequencing data. Data are presented as mean value ± standard error of the mean (SEM). Differences were considered significant when p < 0.05 and noted with different superscript letters.

3. Results

3.1. Growth Performance

The growth performance results of growing–finishing pigs are presented in Table 3. Dietary phytase, β-mannanase, β-glucanase, and xylanase supplementation had no significant effects on the growth performance of growing–finishing pigs (p > 0.05).

3.2. Trace Element Concentrations in Selected Tissues

The results of trace mineral concentrations (Zn, Fe, and Cu) in the jejunum, ileum, liver, kidney, and muscle are presented in Table 4. Phytase, xylanase, and β-mannanase supplementation increased (p < 0.05) ileal Zn concentrations, making them higher than those fed with the control diet. The phytase group increased (p < 0.05) the Fe concentrations in the kidney and muscle compared with the control group. The concentrations of Zn in the muscle of pigs from the xylanase group were significantly higher than for the control pigs (p < 0.05).

3.3. Fecal Trace Element Concentrations

The results of fecal trace element concentrations are shown in Table 5. Phytase and xylanase supplementation significantly decreased (p < 0.05) the fecal Zn concentrations compared with the control group. In addition, the fecal Fe concentrations significantly decreased (p < 0.05) in the phytase group. Meanwhile, exogenous enzyme supplementation had no effect on fecal Cu concentrations (p > 0.05).

3.4. Expression of Genes Associated with Trace Element Absorption and Tight-Junction Proteins

The relative mRNA levels of trace element transporters in the small intestine are shown in Figure 1. β-mannanase and β-glucanase diets up-regulated (p < 0.05) the divalent metal-ion transporter-1 (DMT1) expression, while xylanase supplementation up-regulated (p < 0.05) the zinc transporter 1 (Znt1) expression in the duodenum of pigs compared with the control group. Moreover, compared with the control group, the supplementation of phytase, β-mannanase, β-glucanase, and xylanase up-regulated (p < 0.05) the ferroportin 1 (FPN1) expression in the duodenum of pigs (Figure 1A). In the jejunum, the supplementation of phytase, β-glucanase, and xylanase up-regulated (p < 0.05) the Znt1 expression (Figure 1B). In the ileum, compared with the control group, phytase and xylanase supplementation down-regulated (p < 0.05) the solute carrier family 39-member 4 (ZIP4) expression (Figure 1C).

3.5. Small Intestinal Morphology

The effects of NSPases and phytase on the duodenal, jejunal, and ileal morphologies of growing–finishing pigs are shown in Table 6 and Figure 2. Dietary phytase, β-mannanase, and xylanase supplementation increased (p < 0.05) VH and VH:CD, and decreased (p < 0.05) CD in the duodenum of pigs compared with the control group. In addition, dietary phytase, β-mannanase, β-glucanase, and xylanase supplementation decreased (p < 0.05) VH and VH:CD in the jejunum of pigs.

3.6. Expression of Genes Associated with Tight-Junction Proteins

As shown in Figure 3, compared with the control group, the supplementation of xylanase up-regulated (p < 0.05) the zonula occludens-1 (ZO-1) expression in the duodenum (Figure 3A). In addition, compared to the β-mannanase, the xylanase diet up-regulated (p < 0.05) the claudin-1 mRNA expression in the duodenum (Figure 3A). Meanwhile, exogenous enzyme supplementation had no effect on the relative mRNA levels of tight-junction proteins in the jujenum and ileum (p > 0.05).

3.7. Cecal Microbiota Analysis

A total of 1,128,688 valid reads were generated from the 30 samples through MiSeq sequencing analysis. Dietary phytase, β-glucanase, and xylanase supplementation decreased (p < 0.05) the Shannon index in the cecum of pigs compared with the control group (Table 7). Moreover, compared with the control group, the supplementation of phytase, β-glucanase, and xylanase increased (p < 0.05) the Simpson index (Table 7).
The six most dominant phyla of the microbial community among the different treatment groups were Firmicutes, Bacteroridetes, Proteobacteria, Verrucomicrobia, Spirochaetes, and Tenericutes (Figure 4A). Compared with the control group, the relative abundance of Firmicutes was higher (p < 0.05) in the β-mannanase, β-glucanase, and xylanase groups, whereas the abundance of Spirochaetes was lower (p < 0.05) in the phytase, β-mannanase, β-glucanase, and xylanase groups. Compared with the control group, dietary phytase and β-mannanase supplementation also lowered (p < 0.05) the relative abundance of Tenericutes (Figure 5A). At the genus level, Terisporobacter, Lactobacillus, Eubacterium_copostanoligenes, and Clostridium_sensu_stricto_1 were the top four abundant genera (Figure 4B). Compared with the control group, dietary phytase supplementation increased (p < 0.05) the relative abundances of Romboutsia and decreased (p < 0.05) the relative abundances of Ruminococcaceae_UCG-014, Prevotellaceae_NK3B31, Eubacterium_ruminantium, and Oscillospira in the cecum of pigs. β-mannanase supplementation significantly increased (p < 0.05) the relative abundances of Romboutsia and decreased (p < 0.05) the relative abundances of Eubacterium_ruminantium and Oscillospira compared with the control group. Compared with the control group, dietary β-glucanase supplementation significantly increased (p < 0.05) the relative abundances of Romboutsia and Lachnospiraceae_XPB1014 and decreased the relative abundances of Prevotellaceae_NK3B31, Eubacterium_ruminantium, and Oscillospira. Moreover, the relative abundances of Eubacterium_ruminantium and Oscillospira were decreased (p < 0.05) in the xylanase group (Figure 5B).
The effects of NSPases and phytase on cecal microbiota in pigs were also identified using linear discriminant analysis (LDA) and effect size (LefSe) analysis (LDA score > 4) (Figure 6). The genera Lachnospiraceae_XPB1014 and Romboutsia were enriched in the β-glucanase group, the family Lachnospiraceae was enriched in the β-mannanase group, and the phylum Firmicutes was enriched in the xylanase group. However, the families Prevotellaceae_NK3B31, Ruminococcaceae_UCG-005, and Spirochaetae were enriched in the control group. Moreover, the phylum Spirochaetes, the class Spirochaetes, the order Spirochaetales, the family Spirochaetaceae, and the genus Treponema_2 were also enriched in the control group.

4. Discussion

In the present study, dietary NSPases and phytase had no impacts on the growth performance of growing–finishing pigs, indicating that the dietary phytase, β-mannanase, β-glucanase, and xylanase used in this study did not have negative effects on the growth rate of the pigs. Although phytase, β-mannanase, β-glucanase, and xylanase supplementation alone did not affect the growth performance parameters of growing–finishing pigs, there is still a question of whether these supplements can influence the trace element deposition or not. To evaluate the deposition of trace elements in pigs, we determined the Fe, Cu, and Zn concentrations in the jejunum, ileum, liver, kidney, and muscle. The results show that dietary xylanase supplementation increased the Zn concentrations in the ileum and muscle of pigs. In addition, the supplementation of phytase increased the Fe content in the kidney, muscle, and Zn content in ileum compared with the control group. Zn, Fe, and Cu excretion as feces were also determined in this study. Dietary phytase supplementation decreased fecal Zn and Fe concentrations. Xylanase supplementation decreased fecal Zn concentrations. We also found that phytase supplementation up-regulated the Znt1 expression in the jejunum of pigs, while β-mannanase up-regulated DMT1 expression in the duodenum and β-glucanase up-regulated DMT1 in the duodenum and Znt1 expression in the jejunum. In addition, xylanase supplementation up-regulated the Znt1 expression in the duodenum and jejunum of pigs. Collectively, these results indicate that exogenous enzymes up-regulated the expressions of trace element transporters in the intestine, suggesting that enzymes differentially affected Fe and Zn absorption rates from the small intestine. Thus, the increased trace element concentrations in tissues may be necessary so that more trace elements can be absorbed through the GIT. Phytic acid chelates important cations, forming insoluble complexes in the upper GIT. The use of phytase can reduce the negative effects of phytic acid on the utilization of trace elements [2,27]. Dietary fibers negatively affect the absorption of trace elements in the GIT due to mineral binding or physical entrapment [3]. β-mannanase, β-glucanase, and xylanase can degrade the cell wall structure of polysaccharides in the diet and reduce or eliminate the encapsulation effect of the cell wall polysaccharides, leading to the absorption of more trace elements through the intestine. Our results are consistent with a previous investigation which reported that the treatment of plant-based foods with exogenous enzymes showed beneficial effects on Fe and Zn bioavailability [28,29]. Those results indicate that phytase and xylanase may improve Zn deposition by regulating the gene expressions of trace element transporters and reducing the excretion of fecal trace elements.
Intestinal morphology and gut barriers significantly impact nutrient absorption [30]. In the present study, a histological examination of the small intestine revealed that dietary phytase, β-mannanase, β-glucanase, and xylanase had a positive effect on the duodenal morphology among the pigs in the different treatment groups, i.e., in the form of increased VH and VH:CD and decreased CD in all treatment groups. In addition, we observed that jejunal VH and VH:CD values were lower for the phytase, β-mannanase, β-glucanase, and xylanase groups than the control group. We also found that compared with the control group, phytase supplementation increased the ileal VH. Luo et al. [31] observed that dietary xylanase supplementation showed higher intestinal fold heights and microvillus heights of large yellow croakers. Similarly, Moita et al. [32] found that the dietary supplementation of phytase increased the VH and villus width of the broiler chickens. A previous study by Wu et al. [33] reported that dietary xylanase and phytase reduced the size of the duodenal villi height of broiler chickens fed with a wheat-based diet. The discrepancies in these results might be attributable to fact that the pigs fed corn–soybean meal-based diets supplemented with NSPases increased the production of soluble NSPs in the intestine. Tight junctions constitute intestinal barrier function [34]. Three of the key proteins of the tight junctions are ZO-1, occludin, and claudin-1. The improved expression of tight junctions can enhance the intestinal barrier function [35]. Our results show that the mRNA levels of ZO-1 were increased in pigs fed xylanase diet. This suggests that xylanase contributed to improving the integrity of the intestinal barrier in growing–finishing pigs.
Another possible reason for increased trace element utilization in the presence of exogenous enzymes is that exogenous enzymes can modulate undigested substrates and alter the gut microbiota composition. The supplementation of phytase and NSPases has been shown to change the composition or number of microbes in animals [36,37]. In the present study, the microbial diversity indices indicate that pigs fed with dietary phytase, β-mannanase, β-glucanase, and xylanase diets had lower Shannon and higher Simpson indices for cecal microbiota than the pigs fed with the basal diet. These results indicate that the use of exogenous enzymes sufficiently changed the conditions of the gastrointestinal environment. At the phylum level, Firmicutes was the dominant phylum in both control and treatment groups, followed by Bacteroidetes, Proteobacteria, Verrucomicrobia, and Spirochaetes. Firmicutes was the major phylum of Gram-positive bacteria, which has been found to be involved in energy resorption and obesity [38,39]. A previous study reported that a diet supplemented with high fibers decreased the abundance of bacteria from the phylum Firmicutes [40]. In the present study, dietary β-mannanase, β-glucanase, and xylanase supplementation significantly increased the abundance of Firmicutes, indicating that the dietary supplementation of NSPases to pigs could effectively hydrolyze fibers and thus limit substrates for cecal microbial fermentation. Another significant change in microbiota abundance was found in phylum Spirochaetes, which are helical, and some of them are pathogenic to humans and animals [41]. Notably, in the present study, we observed a decrease in the abundance of the phylum Spirochaetse, the class Spirochaetes, the order Spirochaetales, and the family Spirochaetaceae in the enzyme-treated groups. At the genus level, opportunistic pathogens, such as Treponema_2 and Eubacterium ruminantium, were also decreased in the NSPases groups compared with the control group. These results indicate that the supplementation of exogenous enzymes could decrease harmful bacteria in the cecum of pigs. Lachnospiraceae is also associated with maintaining gut health [42]. In the present study, the genus Lachnospiraceae_XPB1014 was increased in the β-glucanase group, while the family Lachnospiraceae was increased in the β-mannanase group. This is probably due to the fact that the supplementation of exogenous enzymes could improve the digestion of NSPs in the small intestine and reduce the amount of substrate that is available for putrefactive and starch-utilizing bacteria in the large intestine.

5. Conclusions

In summary, the dietary supplementation of phytase and xylanase have positive effects on Zn deposition in pigs, as demonstrated by improving Zn concentrations, regulating the gene expressions of trace element transporters, and decreasing fecal Zn concentrations. In addition, dietary phytase, β-mannanase, β-glucanase, and xylanase altered the intestinal morphology and decreased the microbial richness indices and the relative abundances of opportunistic pathogens. The present study provides theoretical support for applying exogenous enzymes to improve trace element utilization and regulate gut health in livestock production.

Author Contributions

H.N., F.L. and Y.Y. designed the research; F.L., K.M. and J.L. conducted animal experiment; F.L. and H.N. analyzed the data and wrote the paper; M.A.K.A. and H.N. revised and edited the paper; H.N. and F.L. had primary responsibility for final content. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key Research and Development Programs of China (2022YFD1300504); the Scientific and Technological Project of Changsha City (kh2201234); and Special Funds for Construction of Innovative Provinces in Hunan Province (2019RS3022).

Institutional Review Board Statement

The study was conducted in accordance with the guidelines of the Declaration of Helsinki, and approved by the Institutional Review Board (or Ethics Committee) of Animal Care and Use Committee of the Institute of Subtropical Agriculture, Chinese Academy of Sciences ((IACUC # 201302).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

All data used in the current study are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Goff, J.P. Invited review: Mineral absorption mechanisms, mineral interactions that affect acid-base and antioxidant status, and diet considerations to improve mineral status. J. Dairy Sci. 2018, 101, 2763–2813. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Gibson, R.S.; Raboy, V.; King, J.C. Implications of phytate in plant-based foods for iron and zinc bioavailability, setting dietary requirements, and formulating programs and policies. Nutr. Rev. 2018, 76, 793–804. [Google Scholar] [CrossRef] [Scilit]
  3. Baye, K.; Guyot, J.P.; Mouquet-Rivier, C. The unresolved role of dietary fibers on mineral absorption. Crit. Rev. Food Sci. Nutr. 2017, 57, 949–957. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Zhai, H.; Adeola, O.; Liu, J. Phosphorus nutrition of growing pigs. Anim Nutr 2022, 9, 127–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Zhang, Y.Y.; Stockmann, R.; Ng, K.; Ajlouni, S. Revisiting phytate-element interactions: Implications for iron, zinc and calcium bioavailability, with emphasis on legumes. Crit. Rev. Food Sci. Nutr. 2022, 62, 1696–1712. [Google Scholar] [CrossRef] [Scilit]
  6. Whisner, C.M.; Martin, B.R.; Nakatsu, C.H.; McCabe, G.P.; McCabe, L.D.; Peacock, M.; Weaver, C.M. Soluble maize fibre affects short-term calcium absorption in adolescent boys and girls: A randomised controlled trial using dual stable isotopic tracers. Br. J. Nutr. 2014, 112, 446–456. [Google Scholar] [CrossRef] [Scilit]
  7. Masey O’Neill, H.V.; Smith, J.; Bedford, M.R. Multicarbohydrase enzymes for non-ruminants. Asian-Australas J. Anim. Sci. 2014, 27, 290–301. [Google Scholar] [CrossRef] [Scilit]
  8. Chu, G.M.; Komori, M.; Hattori, R.; Matsui, T. Dietary phytase increases the true absorption and endogenous fecal excretion of zinc in growing pigs given a corn-soybean meal based diet. Anim. Sci. J. 2009, 80, 46–51. [Google Scholar] [CrossRef] [Scilit]
  9. Kim, J.S.; Ingale, S.L.; Hosseindoust, A.R.; Lee, S.H.; Lee, J.H.; Chae, B.J. Effects of mannan level and β-mannanase supplementation on growth performance, apparent total tract digestibility and blood metabolites of growing pigs. Animal 2017, 11, 202–208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Bournazel, M.; Lessire, M.; Klein, S.; Meme, N.; Peyronnet, C.; Quinsac, A.; Duclos, M.J.; Narcy, A. Phytase supplementation in diets rich in fiber from rapeseed enhances phosphorus and calcium digestibility but not retention in broiler chickens. Poult. Sci. 2018, 97, 1627–1640. [Google Scholar] [CrossRef] [Scilit]
  11. Staack, L.; Della, E.A.; Jørgensen, B.; Pettersson, D.; Rangel, N. Cassava cell wall characterization and degradation by a multicomponent NSP-targeting enzyme (NSPase). Sci. Rep. 2019, 9, 10150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Park, S.; Li, W.; St-Pierre, B.; Wang, Q.; Woyengo, T.A. Growth performance, nutrient digestibility, and fecal microbial composition of weaned pigs fed multi-enzyme supplemented diets. J. Anim. Sci. 2020, 98, skaa306. [Google Scholar] [CrossRef] [Scilit]
  13. Ward, N.E. Debranching enzymes in corn/soybean meal-based poultry feeds: A review. Poult. Sci. 2021, 100, 765–775. [Google Scholar] [CrossRef] [Scilit]
  14. Yan, H.; Wei, W.; Hu, L.; Zhang, Y.; Zhang, H.; Liu, J. Reduced feeding frequency improves feed efficiency associated with altered fecal microbiota and bile acid composition in pigs. Front. Microbiol. 2021, 12, 761210. [Google Scholar] [CrossRef] [Scilit]
  15. Li, N.; Li, H.; Su, G.; Chen, J. Heavy metal distribution profiles in soil and groundwater near pig farms in China. Chemosphere 2022, 294, 133721. [Google Scholar] [CrossRef] [Scilit]
  16. Hou, L.; Wang, L.; Wen, X.; Yang, X.; Gao, K.; Zhu, C.; Li, L.; Xiao, H.; Jiang, Z. Meta-analysis of energy intake of growing-finishing pigs in China. J. Anim. Physiol. Anim. Nutr. 2022, 106, 78–87. [Google Scholar] [CrossRef] [Scilit]
  17. National Research Council. Nutrient Requirements of Swine, 11th ed.; National Academy Press: Washington, DC, USA, 2012. [Google Scholar]
  18. Liu, J.; Cai, X.; Xiong, H.; Zhang, H. Effects of feeding frequency on meat quality traits and Longissimus muscle proteome in finishing pigs. J. Anim. Physiol. Anim. Nutr. 2017, 101, 1175–1184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Nguyen, H.T.T.; Morgan, N.; Roberts, J.R.; Swick, R.A.; Toghyani, M. Copper hydroxychloride is more efficacious than copper sulfate in improving broiler chicken’s growth performance, both at nutritional and growth-promoting levels. Poult. Sci. 2020, 99, 6964–6973. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Liu, J.B.; Yan, H.L.; Cao, S.C.; Hu, Y.D.; Zhang, H.F. Effects of absorbents on growth performance, blood profiles and liver gene expression in broilers fed diets naturally contaminated with aflatoxin. Asian-Australas J. Anim. Sci. 2020, 33, 294–304. [Google Scholar] [CrossRef] [Scilit]
  21. Stammler, F.; Glasner, J.; Hiergeist, A.; Holler, E.; Weber, D.; Oefner, P.J.; Gessner, A.; Spang, R. Adjusting microbiome profiles for differences in microbial load by spike-in bacteria. Microbiome 2016, 4, 28. [Google Scholar] [CrossRef] [Scilit]
  22. Falcone, E.L.; Abusleme, L.; Swamydas, M.; Lionakis, M.S.; Ding, L.; Hsu, A.P.; Zelazny, A.M.; Moutsopoulos, N.M.; Kuhns, D.B.; Deming, C. Colitis susceptibility in p47(phox-/-) mice is mediated by the microbiome. Microbiome 2016, 4, 13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Liu, J.B.; Cao, S.C.; Liu, J.; Xie, Y.N.; Zhang, H.F. Effect of probiotics and xylo-oligosaccharide supplementation on nutrient digestibility, intestinal health and noxious gas emission in weanling pigs. Asian-Australas J. Anim. Sci. 2018, 31, 1660–1669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Amato, K.R.; Yeoman, C.J.; Kent, A.; Righini, N.; Carbonero, F.; Estrada, A.; Gaskins, H.R.; Stumpf, R.M.; Yildirim, S.; Torralba, M.; et al. Habitat degradation impacts black howler monkey (Alouatta pigra) gastrointestinal microbiomes. ISME J. 2013, 7, 1344–1353. [Google Scholar] [CrossRef] [Scilit]
  25. Laforest-Lapointe, I.; Messier, C.; Kembel, S.W. Host species identity, site and time drive temperate tree phyllosphere bacterial community structure. Microbiome 2016, 4, 27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Stewart, C.J.; Embleton, N.D.; Marrs, E.C.L.; Smith, D.P.; Nelson, A.; Abdulkadir, B.; Skeath, T.; Petrosino, J.F.; Perry, J.D.; Berrington, J.E.; et al. Temporal bacterial and metabolic development of the preterm gut reveals specific signatures in health and disease. Microbiome 2016, 4, 67. [Google Scholar] [CrossRef] [Scilit]
  27. Troesch, B.; Jing, H.; Laillou, A.; Fowler, A. Absorption studies show that phytase from Aspergillus niger significantly increases iron and zinc bioavailability from phytate-rich foods. Food Nutr. Bull. 2013, 34 (Suppl. 2), S90–S101. [Google Scholar] [CrossRef] [Scilit]
  28. Dong, B.; Liu, S.; Wang, C.; Cao, Y. Effects of xylanase supplementation to wheat-based diets on growth performance, nutrient digestibility and gut microbes in weanling pigs. Asian-Australas J. Anim. Sci. 2018, 31, 1491–1499. [Google Scholar] [CrossRef] [Scilit]
  29. Kim, S.-K.; Cho, M.-W.; Kim, J.-S.; Jang, K.-B.; Kim, S.-A.; Mun, D.-Y.; Kim, B.-H.; Kim, Y.-H.; Park, J.-C.; Choe, J.-H.; et al. Effects of Eco-friendly Multi-enzyme on Growth Performance, Intestinal Morphology, and Nutrient Digestibility of weaned Pigs. Korean J. Org. Agric. 2018, 26, 141–149. [Google Scholar] [CrossRef] [Scilit]
  30. Groschwitz, K.R.; Hogan, S.P. Intestinal barrier function: Molecular regulation and disease pathogenesis. J. Allergy Clin. Immunol. 2009, 124, 3–20; quiz 21-2. [Google Scholar] [CrossRef] [Scilit]
  31. Luo, J.; Li, Y.; Jin, M.; Zhu, T.; Li, C.; Zhou, Q. Effects of dietary exogenous xylanase supplementation on growth performance, intestinal health, and carbohydrate metabolism of juvenile large yellow croaker, Larimichthys crocea. Fish Physiol. Biochem. 2020, 46, 1093–1110. [Google Scholar] [CrossRef] [Scilit]
  32. Moita, V.H.C.; Duarte, M.E.; Kim, S.W. Supplemental Effects of Phytase on Modulation of Mucosa-Associated Microbiota in the Jejunum and the Impacts on Nutrient Digestibility, Intestinal Morphology, and Bone Parameters in Broiler Chickens. Animals 2021, 11, 3351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Wu, Y.B.; Ravindran, V.; Thomas, D.G.; Birtles, M.J.; Hendriks, W.H. Influence of phytase and xylanase, individually or in combination, on performance, apparent metabolisable energy, digestive tract measurements and gut morphology in broilers fed wheat-based diets containing adequate level of phosphorus. Br. Poult. Sci. 2004, 45, 76–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Suzuki, T. Regulation of the intestinal barrier by nutrients: The role of tight junctions. Anim. Sci. J. 2020, 91, e13357. [Google Scholar] [CrossRef] [Scilit]
  35. Zihni, C.; Mills, C.; Matter, K.; Balda, M.S. Tight junctions: From simple barriers to multifunctional molecular gates. Nat. Rev. Mol. Cell Biol. 2016, 17, 564–580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Kiarie, E.; Romero, L.F.; Nyachoti, C.M. The role of added feed enzymes in promoting gut health in swine and poultry. Nutr. Res. Rev. 2013, 26, 71–88. [Google Scholar] [CrossRef] [Scilit]
  37. Bedford, M.R.; Cowieson, A.J. Exogenous enzymes and their effects on intestinal microbiology. Anim. Feed. Sci. Technol. 2012, 173, 76–85. [Google Scholar] [CrossRef] [Scilit]
  38. Pedersen, R.; Andersen, A.D.; Mølbak, L.; Stagsted, J.; Boye, M. Changes in the gut microbiota of cloned and non-cloned control pigs during development of obesity: Gut microbiota during development of obesity in cloned pigs. BMC Microbiol. 2013, 13, 30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Ley, R.E.; Peterson, D.A.; Gordon, J.I.J.C. Ecological and Evolutionary Forces Shaping Microbial Diversity in the Human Intestine. Cell 2006, 124, 837–848. [Google Scholar] [CrossRef] [Scilit]
  40. Tian, G.; Wu, X.; Chen, D.; Yu, B.; He, J. Adaptation of gut microbiome to different dietary nonstarch polysaccharide fractions in a porcine model. Mol. Nutr. Food Res. 1956, 44, 201761. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Gupta, R.S.; Mahmood, S.; Adeolu, M. A phylogenomic and molecular signature based approach for characterization of the phylum Spirochaetes and its major clades: Proposal for a taxonomic revision of the phylum. Front. Microbiol. 2013, 4, 217. [Google Scholar] [CrossRef] [Scilit]
  42. Guan, L.; Wang, K.; Gao, Y.; Li, J.; Yan, S.; Ji, N.; Ren, C.; Wang, J.; Zhou, Y.; Li, B.; et al. Biochemical and Structural Characterization of a Novel Bacterial Tannase From Lachnospiraceae bacterium in Ruminant Gastrointestinal Tract. Front. Bioeng. Biotechnol. 2021, 9, 806788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Gene expression levels associated with trace element absorption (Znt1, ZIP4, DMT1, and FPN1) in the duodenum (A), jejunum (B), and ileum (C). Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase. Data are expressed as mean ± SEM (n = 6). Means within with different superscripts are significantly different (p < 0.05). DMT1, divalent metal-ion transporter-1; ZIP4, solute carrier family 39 member 4; FPN1, ferroportin 1; ZnT1, zinc transporter 1.
Figure 1. Gene expression levels associated with trace element absorption (Znt1, ZIP4, DMT1, and FPN1) in the duodenum (A), jejunum (B), and ileum (C). Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase. Data are expressed as mean ± SEM (n = 6). Means within with different superscripts are significantly different (p < 0.05). DMT1, divalent metal-ion transporter-1; ZIP4, solute carrier family 39 member 4; FPN1, ferroportin 1; ZnT1, zinc transporter 1.
Animals 13 00549 g001
Figure 2. The intestinal morphology was histologically analyzed by hematoxylin and eosin (HE, 500 µm). Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basl diet + 100 g/t of xylanase.
Figure 2. The intestinal morphology was histologically analyzed by hematoxylin and eosin (HE, 500 µm). Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basl diet + 100 g/t of xylanase.
Animals 13 00549 g002
Figure 3. Gene expression levels of the tight-junction proteins (ZO-1, claudin-1, and occludin) in the duodenum (A), jejunum (B), and ileum (C). Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase. Data are expressed as mean ± SEM (n = 6). Means within with different superscripts are significantly different (p < 0.05). ZO-1, zonula occludens-1.
Figure 3. Gene expression levels of the tight-junction proteins (ZO-1, claudin-1, and occludin) in the duodenum (A), jejunum (B), and ileum (C). Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase. Data are expressed as mean ± SEM (n = 6). Means within with different superscripts are significantly different (p < 0.05). ZO-1, zonula occludens-1.
Animals 13 00549 g003
Figure 4. The effects of dietary NSPases and phytase on microbiota composition at the phylum and genus levels of growing–finishing pigs. (A) Relative contribution of the top 6 phyla in each group. (B) Relative contribution of the top 10 genera in each group. Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase.
Figure 4. The effects of dietary NSPases and phytase on microbiota composition at the phylum and genus levels of growing–finishing pigs. (A) Relative contribution of the top 6 phyla in each group. (B) Relative contribution of the top 10 genera in each group. Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase.
Animals 13 00549 g004
Figure 5. Taxonomic comparison of the cecal microbial community of growing–finishing pigs from the control, phytase, β-mannanase, β-glucanase, and xylanase groups. Differences in the microbial communities at (A) the phylum level and (B) the genus level. Data are expressed as mean ± SEM (n = 6). Means within a row with different superscripts are significantly different (p < 0.05). Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase.
Figure 5. Taxonomic comparison of the cecal microbial community of growing–finishing pigs from the control, phytase, β-mannanase, β-glucanase, and xylanase groups. Differences in the microbial communities at (A) the phylum level and (B) the genus level. Data are expressed as mean ± SEM (n = 6). Means within a row with different superscripts are significantly different (p < 0.05). Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase.
Animals 13 00549 g005
Figure 6. LefSe analysis of the cecal microbial community of growing–finishing pigs from the control, phytase, β-mannanase, β-glucanase, and xylanase groups. Species with significant differences have an LDA score greater than the estimated value with a default score 4. The length of the histogram represents the LDA score, indicating the differences in species among the five groups. Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase.
Figure 6. LefSe analysis of the cecal microbial community of growing–finishing pigs from the control, phytase, β-mannanase, β-glucanase, and xylanase groups. Species with significant differences have an LDA score greater than the estimated value with a default score 4. The length of the histogram represents the LDA score, indicating the differences in species among the five groups. Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase.
Animals 13 00549 g006
Table 1. Composition of the basal diet (on an as-fed basis) for pigs.
Table 1. Composition of the basal diet (on an as-fed basis) for pigs.
ItemsInclusion Rate (%)Calculated Nutrient Levels
Corn58.60Digestible energy (MJ/kg)14.20
Soybean meal (43% crude protein)29.00Crude Protein (%)18.18
Wheat bran7.80Lys (%)0.98
Soy oil1.55Met + Cys (%)0.55
L-Lys HCl (98%)0.18Thr (%)0.59
Thr0.10Trp (%)0.19
Calcium hydrophosphate0.69Fe (mg/kg)118.0
Limestone0.87Cu (mg/kg)20.0
Salt0.30Zn (mg/kg) 80.3
1% Premix 11.00
Total100
1 Premix provided the following per kg of diet: vitamin D3 (40 IU), vitamin K3 (0.5 mg), vitamin B1 (1.0 mg), vitamin A (800 IU), vitamin E (10 IU), vitamin B2 (3.6 mg), vitamin B6 (1.5 mg), biotin (0.05 mg), folic acid (0.3 mg), D-pantothenic acid (10.0 mg), nicotinic acid (10.0 mg), choline (300.0 mg), Fe as FeSO4·H2O (30.0 mg), Zn as ZnSO4 (50.0 mg), Cu as CuSO4·5H2O (10.0 mg), I as KI (0.14 mg), Mn as MnSO4·H2O (80.0 mg), Se as Na2SeO3 (0.30 mg), Co as CoCl2 (1.0 mg).
Table 2. Primers used in this study.
Table 2. Primers used in this study.
GenesAccession No.5′-3′ Primer Sequences
DMT1NM_001128440.1R: AGGGAATGTTCCTGCCATCG
F: ACTGGTGGCTTCTTCAGTCAG
ZIP4XM_021090449F: TGCTGAACTTGGCATCTGGG
R: CGCCACGTAGAGAAAGAGGC
FPN1XM_003483701.4R: TACCAACGGGGTACTTTGCC
F: AGTGGGGAATGCAATTCAGGA
ZnT1NM_001139470F: CCAGGGGAGCAGGGAACCGA
R: TCAGCCCGTTGGAGTTGCTGC
ZO-1XM_021098896.1F: CCTGCTTCTCCAAAAACTCTT
R: TTCTATGGAGCTCAACACCC
occludinNM_001163647.2F: ACGAGCTGGAGGAAGACTGGATC
R: CCCTTAACTTGCTTCAGTCTATTG
claudin-1NM_001244539.1F: AAGGACAAAACCGTGTGGGA
R: CTCTCCCCACATTCGAGATGATT
β-actinXM_003357928F: CGTTGGCTGGTTGAGAATC
R: CGGCAAGACAGAAATGACAA
F, forward; R, reverse; DMT1, divalent metal-ion transporter-1; ZIP4, solute carrier family 39 member 4; FPN1, ferroportin 1; ZnT1, zinc transporter 1; ZO-1, zonula occludens-1.
Table 3. The effects of dietary NSPases and phytase on the growth performance of growing–finishing pigs.
Table 3. The effects of dietary NSPases and phytase on the growth performance of growing–finishing pigs.
ItemsControlPhytaseβ-Mannanaseβ-GlucanaseXylanasep-Values
ADG (kg)0.85 ± 0.070.94 ± 0.080.92 ± 0.130.94 ± 0.120.92 ± 0.120.583
ADFI (kg)2.45 ± 0.122.66 ± 0.382.64 ± 0.322.71 ± 0.212.67 ± 0.350.599
F/G ratio2.88 ± 0.162.82 ± 0.282.90 ± 0.342.92 ± 0.382.92 ± 0.240.973
Data are expressed as means ± SEM (n = 10). ADG, average daily gain; ADFI, average daily feed intake; F/G, feed-to-gain ratio; control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase.
Table 4. The effects of dietary NSPases and phytase on tissue trace element concentrations in growing–finishing pigs (freeze-dry basis, mg/kg).
Table 4. The effects of dietary NSPases and phytase on tissue trace element concentrations in growing–finishing pigs (freeze-dry basis, mg/kg).
ItemsControlPhytaseβ-Mannanaseβ-GlucanaseXylanasep-Values
Jejunum
Zn 17.68 ± 1.7614.65 ± 0.6215.41 ± 1.9115.97 ± 1.1216.47 ± 0.750.580
Fe 80.04 ± 11.4584.37 ± 9.3759.03 ± 4.6874.52 ± 8.6987.86 ± 16.220.270
Cu 2.78 ± 0.132.37 ± 0.162.86 ± 0.362.86 ± 0.252.99 ± 0.320.517
Ileum
Zn 19.31 ± 0.99 c22.13 ± 0.93 ab22.41 ± 0.47 ab19.88 ± 0.74 bc23.09 ± 0.99 a0.045
Fe 54.28 ± 5.3749.47 ± 5.5354.96 ± 6.9549.82 ± 8.3346.00 ± 2.650.825
Cu 1.92 ± 0.062.11 ± 0.351.76 ± 0.051.83 ± 0.202.41 ± 0.500.428
Liver
Zn 64.04 ± 10.3264.62 ± 7.8161.12 ± 4.9956.04 ± 4.5256.99 ± 4.100.850
Fe 175.7 ± 26.12189.7 ± 28.61119.33 ± 20.27151.35 ± 11.67180.7 ± 18.130.182
Cu 9.29 ± 0.549.76 ± 1.259.48 ± 0.7411.25 ± 1.7110.74 ± 1.530.760
Kidney
Zn 25.7 ± 3.1128.9 ± 2.1924.44 ± 1.1328.11 ± 1.0431.18 ± 4.080.399
Fe 59.26 ± 2.50 b74.13 ± 4.01 a63.79 ± 4.95 ab72.17 ± 5.18 ab62.52 ± 5.72 ab0.030
Cu 10.5 ± 1.127.91 ± 0.598.37 ± 0.829.03 ± 0.7210.24 ± 1.390.278
Muscle
Zn 11.55 ± 0.67 b12.35 ± 0.88 ab13.86 ± 1.12 ab14.44 ± 1.43 ab15.55 ± 0.88 a0.049
Fe 17.90 ± 2.32 b31.23 ± 3.05 a24.16 ± 2.15 ab18.42 ± 2.34 b22.93 ± 3.30 ab0.013
Cu 0.62 ± 0.040.62 ± 0.080.69 ± 0.080.67 ± 0.070.69 ± 0.060.879
Data are expressed as means ± SEM (n = 6). Means within a row with different superscripts are significantly different (p < 0.05). Zn, zinc; Fe, iron; Cu, copper; control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase.
Table 5. The effects of dietary NSPases and phytase on fecal trace element concentrations in growing–finishing pigs (dry basis, g/kg).
Table 5. The effects of dietary NSPases and phytase on fecal trace element concentrations in growing–finishing pigs (dry basis, g/kg).
ItemsControlPhytaseβ-Mannanaseβ-GlucanaseXylanasep-Values
Zn 1.06 ± 0.08 a0.97 ± 0.07 b1.01 ± 0.08 ab1.00 ± 0.03 ab0.95 ± 0.03 b0.037
Fe 1.75 ± 0.34 a 1.23 ± 0.12 b1.56 ± 0.49 a1.64 ± 0.51 a1.84 ± 0.60 a0.002
Cu 0.97 ± 0.090.94 ± 0.030.93 ± 0.040.92 ± 0.040.93 ± 0.100.052
Data are expressed as means ± SEM (n = 6). Means within a row with different superscripts are significantly different (p < 0.05). Zn, zinc; Fe, iron; Cu, copper; control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase.
Table 6. The effects of dietary NSPases and phytase on the duodenal, jejunal, and ileal morphologies of growing–finishing pigs.
Table 6. The effects of dietary NSPases and phytase on the duodenal, jejunal, and ileal morphologies of growing–finishing pigs.
ItemControlPhytaseβ-Mannanaseβ-GlucanaseXylanasep-Values
Duodenum
VH, μm391.4 ±15.61 c441.1 ± 23.85 a435.2 ±23.13 ab407.8 ± 11.33 bc423.2 ± 34.52 ab0.032
CD, μm249.4 ± 12.4 a201.8 ± 12.99 c225.2 ±17.17 b216.4 ± 20.15 bc211.1 ± 16.28 bc0.027
VH:CD1.56 ± 0.12 c2.30 ± 0.17 a1.93 ± 0.13 b1.88 ± 0.11 b2.01 ± 0.19 b0.005
Jejunum
VH, μm453.6 ± 30.96 a414.9 ± 35.54 b356.4 ± 24.16 c391.2 ± 35.44 bc396.8 ± 23.83 b0.004
CD, μm194.7 ± 25.10 c210.0 ± 17.38 bc215.8 ± 20.05 b243.6 ± 34.10 a238.6 ± 21.86 ab0.039
VH:CD2.33 ± 0.20 a1.98 ± 0.21 b1.65 ± 0.18 c1.61 ± 0.25 c1.66 ± 0.19 c0.021
Ileum
VH, μm282.1 ± 30.85 c334.3 ± 31.32 ab302.5 ± 48.12 bc292.0 ± 27.56 bc352.0 ± 28.170.047
CD, μm229.1 ± 21.85239.8 ± 19.15232.0 ± 27.05228.7 ± 16.82248.2 ± 25.530.771
VH:CD1.23 ± 0.181.38 ± 0.161.30 ± 0.181.28 ± 0.151.42 ± 0.170.425
Data are expressed as means ± SEM (n = 6). Means within a row with different superscripts are significantly different (p < 0.05). VH, villus height; CD, crypt depth; VH:CD, VH-to-CD ratio; control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase.
Table 7. The effects of dietary NSPases and phytase on the microbial alpha diversity indices of growing–finishing pigs.
Table 7. The effects of dietary NSPases and phytase on the microbial alpha diversity indices of growing–finishing pigs.
ItemsControlPhytaseβ-Mannanaseβ-GlucanaseXylanasep-Values
OTUs604.3 ± 10.23517.8 ± 35.52567.2 ± 28.51509.8 ± 18.41529.0 ± 39.380.139
Chao719.3 ± 5.56644.2 ± 36.67671.4 ± 28.8635.4 ± 23.03625.7 ± 43.010.219
Shannon4.60 ± 0.10 a3.58 ± 0.23 c4.22 ± 0.09 ab3.69 ± 0.14 bc4.03 ± 0.18 bc0.004
Simpson0.03 ± 0.00 c0.11 ± 0.03 a0.04 ± 0.00 bc0.07 ± 0.01 ab0.05 ± 0.01 ab0.001
ACE700.3 ± 6.31642.6 ± 35.72671.8 ± 30.27623.7 ± 17618.2 ± 43.10.276
Data are expressed as means ± SEM (n = 6). Means within a row with different superscripts are significantly different (p < 0.05). Control, basal diet; phytase, basal diet + 100 g/t of phytase; β-mannanase, basal diet + 40 g/t of β-mannanase; β-glucanase, basal diet + 100 g/t of β-glucanase; xylanase, basal diet + 100 g/t of xylanase.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, F.; Li, J.; Ni, H.; Azad, M.A.K.; Mo, K.; Yin, Y. The Effects of Phytase and Non-Starch Polysaccharide-Hydrolyzing Enzymes on Trace Element Deposition, Intestinal Morphology, and Cecal Microbiota of Growing–Finishing Pigs. Animals 2023, 13, 549. https://doi.org/10.3390/ani13040549

AMA Style

Liu F, Li J, Ni H, Azad MAK, Mo K, Yin Y. The Effects of Phytase and Non-Starch Polysaccharide-Hydrolyzing Enzymes on Trace Element Deposition, Intestinal Morphology, and Cecal Microbiota of Growing–Finishing Pigs. Animals. 2023; 13(4):549. https://doi.org/10.3390/ani13040549

Chicago/Turabian Style

Liu, Fenfen, Jing Li, Hengjia Ni, Md. Abul Kalam Azad, Kaibin Mo, and Yulong Yin. 2023. "The Effects of Phytase and Non-Starch Polysaccharide-Hydrolyzing Enzymes on Trace Element Deposition, Intestinal Morphology, and Cecal Microbiota of Growing–Finishing Pigs" Animals 13, no. 4: 549. https://doi.org/10.3390/ani13040549

APA Style

Liu, F., Li, J., Ni, H., Azad, M. A. K., Mo, K., & Yin, Y. (2023). The Effects of Phytase and Non-Starch Polysaccharide-Hydrolyzing Enzymes on Trace Element Deposition, Intestinal Morphology, and Cecal Microbiota of Growing–Finishing Pigs. Animals, 13(4), 549. https://doi.org/10.3390/ani13040549

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop