Next Article in Journal
Sensitivity of High Conservation Value Birds to Para-Aminopropiophenone (PAPP) Determined by Sub-Lethal Dose–Response Assay
Next Article in Special Issue
Reproductive Performance of Triplet-Bearing Ewes on Commercial Farms and Research Priorities Identified by Sheep Producers to Improve the Survival of Triplet-Bearing Ewes and Their Lambs
Previous Article in Journal
The Effects of Aflatoxin B1 Intake in Assaf Dairy Ewes on Aflatoxin M1 Excretion, Milk Yield, Haematology and Biochemical Profile
Previous Article in Special Issue
Protein Supplementation during Mid-Gestation Alters the Amino Acid Patterns, Hepatic Metabolism, and Maternal Skeletal Muscle Turnover of Pregnant Zebu Beef Cows
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Late Gestation Supplements Differing in Fatty Acid Amount and Profile to Beef Cows on Cow Performance, Steer Progeny Growth Performance through Weaning, and Relative mRNA Expression of Genes Associated with Muscle and Adipose Tissue Development

Department of Animal Sciences, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA
*
Author to whom correspondence should be addressed.
Animals 2023, 13(3), 437; https://doi.org/10.3390/ani13030437
Submission received: 30 November 2022 / Revised: 18 January 2023 / Accepted: 20 January 2023 / Published: 27 January 2023

Simple Summary

Nutrition during late gestation has the potential to alter future progeny performance. Fatty acids are important for the regulation of protein and lipid metabolism. We investigated the effects of different fatty acid supplements during late gestation on cow performance, steer progeny growth performance, and gene expression through the weaning and backgrounding phases. The results indicate that late gestation fatty acid supplementation modifies plasma fatty acid concentration and alters muscle and adipose gene expression. However, the fatty acid supplements evaluated did not impact cow performance or steer growth performance through weaning and backgrounding.

Abstract

Strategic supplementation during late gestation has the potential to alter progeny performance. Mature fall-calving Simmental × Angus cows were used to evaluate the effects of late gestation supplementation of fatty acids to beef cows on cow performance, steer progeny growth performance during pre-weaning and backgrounding periods, and relative mRNA expression of genes associated with myogenesis and adipogenesis. Cows (n = 190; 4 pasture groups of cows/treatment) grazed endophyte-infected tall fescue and were supplemented during late gestation with calcium salts of either saturated fatty acid/monounsaturated fatty acid (SFA/MUFA), polyunsaturated fatty acid (PUFA), or an isocaloric and isonitrogenous control (CON). There were no differences (p ≥ 0.11) in cow body weight (BW) or body condition scores from pre-supplementation to weaning or steer BW at birth, weaning, or at the end of the backgrounding period. Concentrations of C18:2n-6 in plasma were greater (p = 0.01) in SFA/MUFA and PUFA cows compared to CON cows during supplementation. For mRNA expression in the longissimus muscle of steer progeny from birth to weaning: PAX7 decreased to a greater (p < 0.01) extent for SFA/MUFA and PUFA steers; AGPAT1 and CPT1 increased to a greater (p ≤ 0.02) extent for CON steers. The expression of MYH7 mRNA during the pre-weaning period was greater (p = 0.01) in PUFA. In conclusion, late gestation fatty acid supplementation modified plasma relative concentrations of fatty acids for dams and progeny and modified mRNA expression of genes related to myogenesis and adipogenesis but had limited effects on progeny growth performance during pre-weaning and backgrounding periods.

1. Introduction

Fetal programming is the response to a specific challenge to the organism during a critical development period that leads to persistent effects [1]. Because the majority of muscle fibers are formed during the fetal stage, when skeletal muscle has a lower priority in nutrient partitioning, muscle development is more vulnerable to nutrient deficiency [2]. Nutritional deficiency during late gestation reduces the density of satellite cells, which could also negatively affect postnatal muscle growth [3]. The sequential adipogenesis in different depots provides an opportunity to specifically enhance intramuscular adipocyte formation during the late gestation, neonatal, and early weaning stages [4]. Nutritional manipulations, such as maternal supplementation of nutrients or bioactive compounds, during these time windows are expected to be able to modify intramuscular adipogenesis [4,5]. Marbling is correlated with the number and size of intramuscular adipocytes [5]. Upregulated adipogenesis in intramuscular fat during the fetal stage leads to an increased number of intramuscular adipocytes, which could accumulate lipids and form marbling during postnatal growth [5]. Therefore, proper fetal programming is significant for achieving the maximum growth and production potential of animals.
Fatty acids are important ligands for the regulation of protein and lipid metabolism. The function of peroxisome proliferator-activated receptor gamma (PPARG), which is the key gene for adipogenic differentiation [4], is stimulated by n-6 fatty acids, such as C18:2 [6,7]. Conversely, n-3 fatty acids, such as C20:5n-3 (EPA) and C22:6n-3 (DHA), can decrease the transcription of lipogenic genes and increase the transcription of lipolytic genes by activating PPARA. However, the effects of EPA and DHA on fetal muscle development have been inconsistent. Studies that used the C2C12 myotube model indicated that EPA and DHA promote muscle protein synthesis and improve insulin resistance in muscles [8,9]. It was also reported that overdosed EPA and DHA inhibited C2C12 myoblasts’ proliferation and differentiation, as well as downregulated muscle-related gene expression [10,11]. Previous studies [12,13] have indicated that supplementing polyunsaturated fatty acids to dams during late gestation did not impact offspring pre-weaning growth or health performance, but improved BW gain during the finishing phase. Conversely, Shao et al. [14] reported decreased steer weaning BW when fall-calving dams grazing endophyte-infected tall fescues were supplemented with a similar ratio of polyunsaturated fatty acid supplements as in Marques et al. [13]. Not only the quantities but also the balance between n-6 and n-3 fatty acids is important for animal health and growth performance [15]. However, the amount and ratio of n-6 to n-3 that would improve beef production, as well as the mechanisms, are still yet to be determined. Since unanticipated poorer pre-weaning performance was observed in calves born from dams supplemented with polyunsaturated fatty acids in a previous study [14], the current study increased the inclusion of n-6 enriched Ca salts of fatty acids in the polyunsaturated fatty acid treatment, as well as added a no-added-fat control supplement to compare non-fat supplementation to fatty acid supplementation. The objective of the current study was to investigate the effects of fatty acid supplementation and fatty acid profile differences during late gestation in beef cows on cow performance, steer progeny growth performance during pre-weaning and backgrounding periods, and relative mRNA expression of genes relative to myogenesis and adipogenesis at birth and weaning.

2. Materials and Methods

Experimental animals were managed according to the guidelines recommended in the Guide for the Care and Use of Agriculture Animals in Agriculture Research and Teaching (Federation of Animal Science Societies, 2010). All experimental procedures followed were approved by the University of Illinois Institutional Animal Care and Use Committee (IACUC Protocol #17292).

2.1. Experimental Design, Animals, and Diets

One hundred and ninety fall-calving Angus × Simmental cows (initial BW = 612 ± 69 kg, BCS = 6 ± 1) from Dixon Springs Agricultural Center, Simpson, IL, USA were utilized for the current study. Prior to supplementation (d -82), cows were stratified by BW, BCS, and age and then randomly assigned to 12 grazing groups with 15–16 cows/pasture. Cow grazing groups were randomly assigned to 1 of the 3 treatments for the last 82 ± 5 d of gestation: 0.16 kg DM/cow/d soybean hulls mixed with 0.91 kg DM/cow/d whole-shelled corn (CON), 0.77 kg DM/cow/d soybean hulls mixed with 0.155 kg DM/cow/d EnerGII (SFA/MUFA, rich in palmitic and oleic acids), or 0.77 kg DM/cow/d soybean hulls mixed with 0.12 kg DM/cow/d Prequel and 0.04 g DM/cow/d Strata (PUFA, rich in linoleic acid, eicosapentaenoic acid, and docosahexaenoic acid). EnerGII, Prequel, and Strata (Virtus Nutrition, LLC, Corcoran, CA, USA) are calcium salts of fatty acids. Cows were grazing on predominantly endophyte-infected tall fescue pastures with an average stocking rate of 1.6 cows per hectare during the supplementation period and rotated as needed. Forage availability during the supplementation period was visually evaluated by trained personnel. Supplement composition and nutrient intake information are presented in Table 1. The fatty acid intake in Table 1 was calculated according to the amount fed to the group and the number of cows in each group. The three supplements were designed to be isocaloric and isonitrogenous. The nutritional and fatty acid profiles of late gestation dietary ingredients are presented in Table 2. Supplementation started on 6/28/2019. Cows were supplemented every Monday, Wednesday, and Friday in 4 portable bunks (4.88 × 0.76 m, accessible from both sides) for each grazing group. The average bunk space was 1.4 to 1.5 m per cow. Typically, supplements were ingested by cows within 10–15 min. Weather data were collected from the Water and Atmospheric Resources Monitoring Program (Illinois Climate Network & Illinois State Water Survey; Champaign, IL, USA).
Cows were weighed and body condition scored (1–9 scale) at the initiation of the supplementation (d -83 and -82), middle of supplementation (d -42), within one week post-calving (4 ± 2 d post-calving), at weigh-suckle-weigh (WSW; d 68); at AI (d 85), AI-pregnancy check (d 120), and at weaning (d 174) to monitor cow performance. Once weekly, cows that had calved and their calves were pulled out from the treatment groups and comingled to a common pasture, and were managed the same. Cows that aborted, had a stillborn calf, or had a heifer calf were removed from the trial immediately after being detected. In order to decrease variation in growth performance and mRNA expression, only cows with steer calves (97 pairs) were utilized for post-calving investigation. After comingling to the common pasture, cow/calf pairs were provided with 2.27 kg/cow/d of dried distiller grains with solubles (DDGS; 88% DM, 30% CP, 7% either extract, 39% NDF, 11% ADF) and soybean hulls (84% DM, 11% CP, 0.8% either extract, 64% NDF, 45% ADF) in a ratio of 50:50. Cattle were also provided with ad libitum hay (80% DM, 7% CP, 71% NDF, and 39% ADF) from d 20 postpartum to weaning as forage availability declined in the fall. Cows were synchronized using the 7-day Co-Synch + controlled internal drug-release (CIDR; Pfizer Animal Health, New York, NY, USA) procedure [16] and artificially inseminated (85 ± 5 d post-calving) with sexed heifer semen from a single sire. Ten days after AI, cows were exposed to two clean-up bulls that had passed the breeding soundness examination for 62 d. Pregnancy diagnoses were performed on d 120 and d 189 by a trained technician with ultrasonography (Aloka 500 instrument, Wallingford, CT, USA).
Cows were vaccinated at the initiation of supplementation (d -83) and the middle of the supplementation (d -42). On d -83, 2 mL Leptoferm-5 (Zoetis, Florham Park, NJ, USA), 1 mL Anaplasmosis vaccine (University Products L.L.C., Baton Rouge, LA), and 2 mL Auto. M. Bovis. (Pinkeye vaccine customized by Newport Laboratories, Worthington, MN, USA) was administered to the experimental cows. In addition, 2 Patriot Insecticide Cattle Ear Tags (Bayer, Shawnee Mission, KS, USA) and Ivermectin (Norbrook, Newry, UK) were applied. On d -42, 5 mL Bovishield Gold FP5 VL5 HB (Zoetis), 5 mL Covexin 8 (Merck Animal Health, Rahway, NJ, USA), 7 mL MU-SE (Zoetis), and 2 mL ScourGuard 4KC (Zoetis) and Cylence (Bayer) were administered.
From calving season to weaning, there were 6 pairs removed. One pair from CON and two pairs from PUFA were removed at weigh-suckle-weigh due to the loss of calf by predators. Two pairs from CON were removed at weigh-suckle-weigh because of cow mastitis and poor calf conditions. One pair from PUFA was removed after AI because the cow had lymphoma.
Calf birth BW was recorded, and bull calves were castrated within 24 h after calving. The vaccination program for calves during the pre-weaning period was similar to the program reported by Shao et al. [14]. The only difference was the dates of the vaccines being at birth, d 68, and d 173. Steers were weighed and weaned at 174 ± 5 d of age. Thereafter, the ninety-one steer calves were fed a backgrounding diet (Table 3) in concrete bunks for 42 d. Pre-weaning and backgrounding performance were evaluated based on BW and ADG.

2.2. Sampling

Blood samples were collected from cows at pre- (d -82) and mid-supplementation (d -40), and from cow/steer pairs within one week after calving (4 ± 2 d post-calving). Blood samples (10 mL) were collected from the jugular vein of cows and calves by using polypropylene tubes (BD Vacutainer) containing sodium heparin for plasma, and placed on ice. After centrifugation for 20 min at 2000× g and 4 °C, plasma was stored at −80 °C until later analysis.
Milk production was determined before breeding (67 ± 5 d postpartum) on a subset of cows via WSW, as described by Beal et al. [17]. Cow BW at calving, cow age, and day postpartum were similar across subset groups (4–8 pairs/group). Milk samples were collected by hand stripping on a random subset of cows (4 cows/group) for milk composition and fatty acid profile analysis. Milk samples for composition analysis were placed in a cooler with ice packs underneath the samples and shipped to Dairy Lab Service Inc. (Dubuque, IA, USA). Milk samples for fatty acid profile analysis were placed in a cooler with dry ice underneath the samples and shipped to Cumberland Valley Analytical Service Inc. (Waynesboro, PA, USA).
Feed samples for each ingredient, including pasture forage and supplements, were collected every 2 weeks during supplementation and lactation periods for proximate and fatty acid profile analysis. All feed samples were stored in −20 °C until further processing.
Longissimus muscle and subcutaneous adipose tissue biopsy samples for relative mRNA expression analysis were collected from every steer calf at birth (4 ± 2 d of age) and from a subset of steers (n = 48; 4 steers from each grazing group) at 3 wk prior to weaning (d 154). The subset of steers was selected for pre-weaning biopsy based on their BW on d 120 being representative of the group average. Biopsy procedures were previously described by Shao et al. [14].

2.3. Analytical Procedures

Thawing and pooling procedures for plasma samples were conducted using the methods described previously by Shao et al. [14]. Relative concentrations of fatty acids in pooled plasma samples were analyzed by the Metabolomics Center at the Roy J. Carver Biotechnology Center (Urbana, IL, USA), as reported by Shao et al. [14]. Briefly, samples were extracted twice with 500 µL of hexane at room temperature and analyzed with a gas chromatography-mass spectrometry system (Agilent Inc., Palo Alto, CA, USA) consisting of an Agilent 7890B gas chromatograph and an Agilent 5977A MSD. Target peaks were evaluated using AMDIS v2.71 and Mass Hunter Qualitative Analysis B.08.00 (Agilent Inc., Palo Alto, CA, USA) software.
The composition analysis of the milk samples was conducted by Dairy Lab Service Inc. (Dubuque, IA, USA). Milk fatty acid profile analysis was conducted by Cumberland Valley Analytical Service Inc. (CVAS; Waynesboro, PA, USA). The procedure of milk fatty acid profile analysis was previously described by Shao et al. [14].
Pasture samples from each group during the supplementation period were composited into one sample, while supplement samples for each ingredient were composited for the gestation and post-calving periods. Composited samples that were going to be analyzed for fatty acid profile were freeze dried, while the remaining samples were oven dried under 55 °C for at least 3 days prior to proximate analysis. All dried samples were ground through a 1 mm screen using a Wiley mill (Arthur, H. Thomas, Philadelphia, PA, USA). Ground samples were analyzed for DM (105 °C oven), crude protein (Leco TruMac, LECO Corporation, St. Joseph, MI, USA), crude fat using an Ankom XT10 Fat Extractor (Ankom Technology, Macedon, NY), NDF, and ADF using an Ankom 200 Fiber Analyzer (Ankom Technology, Macedon, NY, USA). Feed sample fatty acid profile analysis was conducted by CVAS using the method of Sukhija and Palmquist [18] and modified as reported by Shao et al. [14].
The extraction of RNA from biopsy samples, complementary DNA synthesis, and quantitative PCR (qPCR) for relative mRNA expression were conducted, as described by Shao et al. [14]. The primers used for qPCR are listed in Table 4. The data were processed and calculated using QuantStudio Real-Time PCR Software (version 1.3, Thermo Fisher Scientific, Waltham, MA, USA). The target genes were chosen based on their involvement in myogenesis and adipogenesis during growth and development. The final data were normalized using the geometric mean of internal control genes: GAPDH, ACTB, and RPLP0 for muscle samples, ACTB, BRPS2, and SLC35BC for adipose tissue samples. The amplification efficiency of the internal control genes and target genes ranged from 92.5% to 104.6%.

2.4. Statistical Analysis

The cow grazing group was considered the experimental unit for all response variables. Outliers were checked by using the Proc Reg procedure of SAS (version 9.4; SAS Institute Inc., Cary, NC, USA), removing data with a studentized t greater than 3 prior to analysis. The MIXED procedure of SAS was used for all response variables except pregnancy rates. A random statement of cow grazing group nested within treatment was included in all analyses when individual animal observational data were used. The model for cow BW and BCS included treatment as the fixed effect and cow age as a covariate. The model for cow milk production and composition included treatment as the fixed effect, and cow milk expected progeny difference (EPD), age, and day postpartum as covariates. The model for relative concentrations of calf plasma fatty acid and cow milk fatty acid profile included treatment as a fixed effect, while day postpartum was included as a covariate for plasma fatty acid. The model for steer growth performance included treatment as a fixed effect and the corresponding EPD as a covariate. Relative mRNA abundance data that were not normally distributed (determined by plotting residuals) were transformed with a logarithmic function (LOG) or a Box-Cox family of power transformations to improve the normality of residuals. The model for relative mRNA expression included treatment, time, and interaction between treatment and time as fixed effects, while sire was included as a random effect. When the treatment effect was detected, all pairwise comparisons were conducted using the PDIFF of SAS at the treatment level. Repeated measure analysis of SAS was used for the analysis of cow plasma fatty acids. Relative concentrations of fatty acids at the initiation of supplementation were tested as a covariate for the analysis of relative concentrations of cow plasma fatty acids, and removed because of non-significance. The model included treatment, time, and the interaction between treatment and time as fixed effects. A simple structure was used as the covariance structure based on the Akaike information criterion. The GLIMMIX procedure of SAS was used for the analysis of pregnancy rates, with treatment as a fixed effect and age as a covariate in the model. Significance was declared at p ≤ 0.05, and tendencies were declared from 0.05 < p ≤ 0.10.

3. Results and Discussion

3.1. Cow Parameters

Total supplementation length, supplementation length during gestation, and supplementation length postpartum were not different (p ≥ 0.43) among treatments. Relative concentrations of cow plasma fatty acids are presented in Table 5. There tended to be treatment × time interactions (p ≤ 0.09) for relative plasma concentrations of C16:0 and C16:1c9 of cows during the supplementation period. Relative concentrations of C16:0 and C16:1c9 of cows from the CON and PUFA groups tended to increase to a greater extent from mid-supplementation to calving compared to those of SFA/MFUA cows. In spring-calving beef cows, late gestation soybean oil supplementation increased C16:0 and decreased C16:1c9 in plasma at calving compared to saturated fat [33]. Under the same spring-calving system, late gestation supplementation with n-3 and n-6 polyunsaturated fatty acids led to decreased plasma C16:0 at calving compared to saturated and monounsaturated fatty acid supplementation [13]. No effects of treatment or treatment × time interaction on concentration of C16:0 or C16:1c9 were reported [14] when cows were supplemented with 80 g DM/cow/d Strata and 80 g DM/cow/d Prequel during late gestation compared with the treatment had the same amount of EnerGII in SFA/MUFA of the current study. Because C16:0 is a common end product of fatty acid synthesis [34] and SFA/MUFA cows had the greatest dietary intake of C16:0, the results might indicate greater fatty acid synthesis in CON and PUFA cows compared to SFA/MUFA at calving. Coleman et al. [35] reported that EPA/DHA supplemented ewes had a greater mRNA concentration of fatty acid synthase (FASN) in subcutaneous adipose tissue, which might support the assumption of greater fatty acid synthesis in PUFA cows in the current study. In addition, a negative energy balance during mid-supplementation to calving, which was indicated by decreased BCS (Table 6), might have led to the mobilization of previously reserved fatty acids. If cows were mobilizing stored fatty acids, the cow plasma fatty acid profile would not have been reflective of dietary fatty acid intake at the same time.
The relative concentrations of C18:2n-6 (Linoleic acid; LA) of SFA/MUFA and PUFA cows were greater (p = 0.01) during the supplementation period compared to CON cows but were not different from each other. Consistent with the current study, it was reported that there was no difference in the concentration of C18:2n-6 when ruminant dams were supplemented with polyunsaturated fatty acids during late gestation compared with saturated and monounsaturated fatty acids [14,35]. At mid-supplementation and calving, DHA was detectable in all PUFA groups but only in one group from CON and one group from SFA/MUFA at calving. Consistent with the current study, polyunsaturated fatty acid supplementation increased the plasma DHA concentration compared to saturated and monounsaturated supplementation [13,14].
Cow BW or BCS from experiment initiation through weaning was not different (p ≥ 0.13; Table 6) among treatments. Gestation length of the cows from the different treatments was not different (p = 0.63; Table 7). Consistent with the current study, previous studies that also supplemented isocaloric fat supplements [13,14,36] reported that maternal fatty acid supplementation during late gestation did not affect cow BW or BCS. In the current study, the BCS of the cows from all treatments decreased from mid-supplementation to calving, which might indicate a negative energy balance during the last 42 d of gestation. Compared to 131 mm of accumulated precipitation for June, July, August, and September in Shao et al. [14], the accumulated precipitation during the late gestation period in the current study was 59 mm, which might negatively impact forage quality. In addition, September is when endophyte-infected tall fescue has a peak concentration of ergot alkaloid [37], which might have led to fescue toxicity for the pregnant cows, causing decreased BCS in the current study.
Milk production and milk composition at WSW did not differ (p ≥ 0.12; Table 7) among treatments. Consistent with the current study, it was also reported that late gestation supplementation with polyunsaturated fatty acids had no effects on the milk yield or composition of cows [14] or ewes [35]. For the milk fatty acid profile, there was a treatment effect (p = 0.05; Table 8) on the concentrations of C15:0 and total n-3 fatty acids; PUFA cows had greater concentrations than CON cows, while SFA/MUFA cows were intermediate and not different from the other treatments. Concentration of DHA was lower than the detectable level in CON cows’ milk but ranged from 0.01–0.03 g/100 g fatty acid in 4 cows from SFA/MUFA groups and from 0.01–0.04 g/100 g fatty acid in 7 cows from PUFA groups. Coleman et al. [35] reported that EPA + DHA supplementation during late gestation tended to increase ewe milk C15:0 at 30 d postpartum compared to supplementation with palmitic and oleic acids. Pentadecanoic acid (C15:0) originates from rumen microbial fermentation [38]. The greater concentration of milk produced by PUFA cows might indicate greater microbial fermentation at the time of WSW. Since all fatty acids with 18 or more carbons in ruminant milk are derived from either absorption or reserves [39], a greater concentration of total n-3 fatty acids in PUFA cows indicates greater n-3 fatty acid reserves, for example, DHA and C18:3n-3, from the supplementation period compared to CON cows.
Although pregnancy rates for AI and overall were not different (p ≥ 0.88; Table 8) among treatments, the authors acknowledge that the current study is not powered for reproductive performance. Importantly, sexed semen was used for AI and may explain the relatively low AI pregnancy rates compared to the previous year [14]. Essential fatty acids could have an impact on the balance of reproductive hormones [40,41]. Therefore, improvements in reproductive performance were commonly reported when fat supplementation was maintained or took place postpartum [42,43,44]. However, results on the effects of late gestation fat supplementation on cow reproductive performance are inconsistent. Improved reproductive performance was reported when forage availability was limited for heifers supplemented with late gestation fat [36]. Supplementing isocaloric fat during late gestation was also reported to have no effects on reproductive performance [14,45], but neither study was likely adequately powered for reproductive parameters. Future studies with an adequate number of animals to investigate the effects of late gestation fatty acid supplementation on cow reproductive performance are needed.

3.2. Calf Performance

The plasma fatty acid profile in offspring reflects maternal supplementation during gestation [46] and colostrum/milk consumption [47]. There was a treatment effect (p ≤ 0.05; Table 9) detected for steer plasma concentrations of C17:0, C20:0, C20:3n-6, and C20:5n-3 at birth: PUFA steers had greater concentrations than SFA/MUFA, while CON steers were intermediate and not different from the other treatments. The concentration of C20:4n-6 from PUFA steers were greater (p = 0.02) than CON and SFA/MUFA at birth. The concentration of C18:2n-6 in PUFA steer plasma was greater (p = 0.04) than CON, with SFA/MUFA steers being intermediate and not different from other treatments. Since the ratio of Prequel and Strata (n-6 to n-3) in the PUFA treatment was increased in the current study compared to Shao et al. [14], different changes in steer calf plasma fatty acid concentrations were observed. The current study showed that offspring plasma fatty acid concentrations were influenced more significantly by maternal supplementation compared to dams’ plasma fatty acid concentrations. Since plasma samples were collected from steer calves after milk consumption in the current study, we could not determine whether changes in fatty acids were due to placenta transfer or milk fatty acid consumption in the first few days of their lives.
The growth performance of the steer progeny during the pre-weaning and backgrounding periods is presented in Table 10. Body weights of the steer progeny at birth, weaning, or the end of the backgrounding phase were not different (p ≥ 0.19) among treatments, which led to no difference (p = 0.21) in pre-weaning or backgrounding phase ADG. The weaning age of the steers was not different (p = 0.63). Shao et al. [14] reported a greater weaning BW of the steers from dams supplemented with saturated and monounsaturated fatty acids compared with polyunsaturated fatty acids. In the current study, the inclusion of Prequel increased with greater n-6 fatty acid inclusion in PUFA. No differences in pre-weaning growth performance are consistent with fatty acid supplementation studies conducted under spring-calving systems [13,33]. In addition, supplementation of EPA + DHA to ewes during late gestation did not affect lamb performance or metabolism through weaning [48]. Bellows et al. [36] reported that fat supplementation to first-calf heifers during the last 65 d of gestation resulted in a greater fall in calf birth BW compared to isocaloric non-fat supplementation. However, fat supplementation did not affect birth BW compared to non-fat supplementation in the current study. Therefore, neither fat supplementation nor different fatty acid profiles had effects on the pre-weaning growth performance of the steer progeny.

3.3. Relative mRNA Expression

The relative mRNA expression of myogenic and adipogenic genes in the longissimus muscle of the steers at birth and weaning are presented in Table 11. There were treatment × time interactions (p ≤ 0.01) observed for the expression of Paired box protein 7 (PAX7). The mRNA expression of PAX7 decreased to a greater extent from birth to weaning for SFA/MUFA and PUFA steers compared to CON. It was reported [49] that Myogenic factor 5 (MYF5) is important for the activation of other myogenic regulatory factors, such as Myogenic differentiation 1 (MYOD1) and Myogenin (MYOG). The transcription of MYF5 is dependent on the levels of PAX7 [50,51]. Satellite cell activation is important for postpartum muscle growth, and PAX7 is essential for the expansion and differentiation of muscle satellite cells during neonatal and adult muscle growth [52]. Greater mRNA expression of PAX7 in steers born from fatty acid-supplemented dams indicates that maternal fatty acid supplementation during late gestation might lead to greater satellite cell activation. However, other myogenic genes MYF5, MYOG, or MYOD1 were not affected by maternal supplementation, which was consistent with steer growth performance during the pre-weaning period not differing among treatments. There was a treatment effect (p = 0.01) on the mRNA expression of MYH7, where the expression during the pre-weaning period was greater in PUFA steers compared to CON and SFA/MUFA. In a previous study [14], where greater n-3 inclusion was used for polyunsaturated fatty acid supplementation treatment, mRNA expression of Longissimus muscle MYH7 in steers from dams supplemented with polyunsaturated fatty acids increased to a greater extent from birth to weaning. In muscle, MYH7 is associated with myosin heavy chain I, which is a slow isoform [53]. The results might indicate that muscle fiber type development was sensitive to the maternal dietary fatty acid profile during late gestation.
There was a treatment × time interaction for the mRNA expression of AGPAT1 and CPT1 (p ≤ 0.02) during the pre-weaning period; expression of CON steers increased to a greater extent from birth to weaning compared to SFA/MUFA and PUFA. The mRNA expression of CEBPB tended (p = 0.08) to increase to a greater extent from birth to weaning for CON and SFA/MUFA steers compared to PUFA. Treatment tended (p = 0.10) to affect the mRNA expression of PPARG, with fatty acid supplementation (SFA/MUFA and PUFA) having greater PPARG mRNA expression compared to non-fat supplementation CON during the pre-weaning period. Acyl-glycerol phosphate acyltransferase 1 (AGPAT1) is one of the critical fatty acid esterification genes and showed a strong positive correlation with intramuscular fat content [43]. Carnitine palmitoyltransferase I is part of the mitochondrial transportation of long-chain fatty acids and is a key enzyme in the regulation of the oxidation of long-chain fatty acids [54]. The essential regulatory genes of adipogenesis include zinc finger protein 423 (ZFP423), CEBPA, CEBPB, and PPARG [11]. It is well recognized that PPARG is essential and indispensable for adipogenesis [55], and its functioning is regulated by CEBPs [56]. Consistent with the current study, Brandão et al. [33] reported that the mRNA expression of PPARG at birth was greater in the longissimus muscles of offspring from dams supplemented with Ca salts of soybean oil. The data in the current study indicate that fatty acid supplementation during late gestation might lead to greater adipogenesis and modified lipid metabolism in the longissimus muscle of the steer progeny during the pre-weaning period, especially in the neonatal stage. Further research is needed to investigate whether the increased mRNA expression of adipogenic genes in fatty acid supplementation leads to greater marbling deposition during the finishing phase.
The relative mRNA expression of adipogenic genes in the subcutaneous adipose tissue of the steers at birth and weaning are presented in Table 12. The mRNA expression of ZFP423 tended (p = 0.07) to increase to a greater extent from birth to weaning for CON steers compared to SFA/MUFA and PUFA. The mRNA expression of CEBPB tended (p = 0.07) to decrease to a greater extent from birth to weaning for PUFA steers compared to CON and SFA/MUFA. Subcutaneous adipose tissue negatively impacts feed efficiency and carcass values [57]. Zinc finger protein 423 is important for the adipogenic commitment of progenitor cells [58]. The trend for a greater increase of mRNA expression of ZFP423 in CON from birth to weaning could lead to greater 12th rib fat back thickness in later stages of growth and production. Previous work [14] reported a treatment × time interaction for the expression of CEBPB during the pre-weaning period, as the mRNA expression of CEBPB was greater in CON at birth and then decreased to the same level as the polyunsaturated fatty acid supplementation at weaning. There are limited studies investigating the mRNA expression of adipogenic genes in subcutaneous adipose tissue for maternal fatty acid supplementation. The reason why there are different expression results for CEBPB between the previous [14] and the current study could be due to the different fatty acid profiles in the treatments. Greater n-6 fatty acids, such as C18:2n-6, from the PUFA treatment in the current study might lead to greater pro-adipogenic fetal programming effects. However, more research on maternal fat supplementation affecting subcutaneous adipose gene expression is needed to validate the current findings and investigate further effects on finishing phase growth performance.

4. Conclusions

Late gestation supplementation of fatty acids or different fatty acid profiles to fall-calving beef cows grazing endophyte-infected tall fescue modified plasma fatty acid profile of cow and steer progeny at birth. However, supplementation did not affect cow BW or BCS. Cow rebreeding pregnancy rates were also not different between treatments; however, this experiment was not powered for reproductive parameters. Myogenic and adipogenic gene mRNA expression in the longissimus muscle and subcutaneous adipose tissue was modified by maternal fatty acid supplementation and fatty acid profile. However, the modification of mRNA expression did not translate into improved steer growth performance during the pre-weaning or backgrounding periods. This experiment was conducted with fall-calving cows grazing on an endophyte-infected tall fescue. Future work exploring other forage systems, calving seasons, and management practices is needed to fully understand the potential of fatty acid supplementation during gestation.

Author Contributions

Conceptualization, T.S. and D.W.S.; Formal analysis, T.S., J.C.M. and D.W.S.; Investigation, T.S. and D.W.S.; Methodology, T.S., J.C.M. and D.W.S.; Project administration, D.W.S.; Resources, D.W.S.; Supervision, D.W.S.; Writing—original draft, T.S.; Writing—review & editing, J.C.M. and D.W.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Experimental animals were managed according to the guidelines recommended in the Guide for the Care and Use of Agriculture Animals in Agriculture Research and Teaching (Federation of Animal Science Societies, 2010). All experimental procedures followed were approved by the University of Illinois Institutional Animal Care and Use Committee (IACUC Protocol #17292).

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

The authors would like to thank Virtus Nutrition LLC for providing the products of calcium salts of fatty acids (EnerGII, Strata, and Prequel) and covering the cost of the fatty acid profile analysis for feed and milk samples. We thank Kevin Murphy for providing suggestions on experimental design. We thank the staff at the University of Illinois Dixon Springs Agricultural Center, Simpson, IL, for care of the experimental animals and aiding in the collection of data. We also thank lab technician James Hartman, graduate students, and undergraduate student Hattie Duncan for help on data collection and laboratory analysis.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Nathanielsz, P.W.; Poston, L.; Taylor, P.D. In Utero Exposure to Maternal Obesity and Diabetes: Animal Models That Identify and Characterize Implications for Future Health. Clin. Perinatol. 2007, 34, 515–526. [Google Scholar] [CrossRef] [Scilit]
  2. Zhu, M.J.; Ford, S.P.; Means, W.J.; Hess, B.W.; Nathanielsz, P.W.; Du, M. Maternal Nutrient Restriction Affects Properties of Skeletal Muscle in Offspring. J. Physiol. 2006, 575, 241–250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Woo, M.; Isganaitis, E.; Cerletti, M.; Fitzpatrick, C.; Wagers, A.J.; Jimenez-Chillaron, J.; Patti, M.E. Early Life Nutrition Modulates Muscle Stem Cell Number: Implications for Muscle Mass and Repair. Stem. Cells Dev. 2011, 20, 1763–1769. [Google Scholar] [CrossRef] [Scilit]
  4. Du, M.; Wang, B.; Fu, X.; Yang, Q.; Zhu, M.J. Fetal Programming in Meat Production. Meat Sci. 2015, 109, 40–47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Du, M.; Huang, Y.; Das, A.K.; Yang, Q.; Duarte, M.S.; Dodson, M.V.; Zhu, M.J. Meat Science and Muscle Biology Symposium: Manipulating Mesenchymal Progenitor Cell Differentiation to Optimize Performance and Carcass Value of Beef Cattle. J. Anim. Sci. 2013, 91, 1419–1427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Xu, H.E.; Lambert, M.H.; Montana, V.G.; Parks, D.J.; Blanchard, S.G.; Brown, P.J.; Sternbach, D.D.; Rgen, J.; Lehmann, M.; Wisely, G.B.; et al. Molecular Recognition of Fatty Acids by Peroxisome Proliferator–Activated Receptors. Mol. Cell 1999, 3, 397–403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Thoennes, S.R.; Tate, P.L.; Price, T.M.; Kilgore, M.W. Differential Transcriptional Activation of Peroxisome Proliferator-Activated Receptor Gamma by Omega-3 and Omega-6 Fatty Acids in MCF-7 Cells. Mol. Cell. Endocrinol. 2000, 160, 67–73. [Google Scholar] [CrossRef] [Scilit]
  8. Kamolrat, T.; Gray, S.R. The Effect of Eicosapentaenoic and Docosahexaenoic Acid on Protein Synthesis and Breakdown in Murine C2C12 Myotubes. Biochem. Biophys. Res. Commun. 2013, 432, 593–598. [Google Scholar] [CrossRef] [Scilit]
  9. Capel, F.; Acquaviva, C.; Pitois, E.; Laillet, B.; Rigaudière, J.P.; Jouve, C.; Pouyet, C.; Gladine, C.; Comte, B.; Vianey Saban, C.; et al. DHA at Nutritional Doses Restores Insulin Sensitivity in Skeletal Muscle by Preventing Lipotoxicity and Inflammation. J. Nutr. Biochem. 2015, 26, 949–959. [Google Scholar] [CrossRef] [Scilit]
  10. Zhang, J.; Xu, X.; Liu, Y.; Zhang, L.; Odle, J.; Lin, X.; Zhu, H.; Wang, X.; Liu, Y. EPA and DHA Inhibit Myogenesis and Downregulate the Expression of Muscle-Related Genes in C2C12 Myoblasts. Genes 2019, 10, 64. [Google Scholar] [CrossRef] [Scilit]
  11. Hsueh, T.Y.; Baum, J.I.; Huang, Y. Effect of Eicosapentaenoic Acid and Docosahexaenoic Acid on Myogenesis and Mitochondrial Biosynthesis during Murine Skeletal Muscle Cell Differentiation. Front. Nutr. 2018, 5, 15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Martin, C.C.; Coleman, D.N.; Garcia, L.G.; Furnus, C.C.; Relling, A.E. Prepartum Fatty Acid Supplementation in Sheep. III. Effect of Eicosapentaenoic Acid and Docosahexaenoic Acid during Finishing on Performance, Hypothalamus Gene Expression, and Muscle Fatty Acids Composition in Lambs. J. Anim. Sci. 2018, 96, 5300–5310. [Google Scholar] [CrossRef] [Scilit]
  13. Marques, R.S.; Cooke, R.F.; Rodrigues, M.C.; Brandão, A.P.; Schubach, K.M.; Lippolis, K.D.; Moriel, P.; Perry, G.A.; Lock, A.; Bohnert, D.W. Effects of Supplementing Calcium Salts of Polyunsaturated Fatty Acids to Late-Gestating Beef Cows on Performance and Physiological Responses of the Offspring. J. Anim. Sci. 2017, 95, 5347–5357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Shao, T.; Ireland, F.A.; Mccann, J.C.; Shike, D.W. Effects of Supplements Differing in Fatty Acid Profile to Late Gestational Beef Cows on Cow Performance, Calf Growth Performance, and MRNA Expression of Genes Associated with Myogenesis and Adipogenesis. J. Anim. Sci. Biotechnol. 2021, 12, 67. [Google Scholar] [CrossRef] [Scilit]
  15. Papadopoulos, G.A.; Maes, D.G.; Van Weyenberg, S.; van Kempen, T.A.T.G.; Buyse, J.; Janssens, G.P.J. Peripartal Feeding Strategy with Different N-6:N-3 Ratios in Sows: Effects on Sows’ Performance, Inflammatory and Periparturient Metabolic Parameters. Br. J. Nutr. 2009, 101, 348–357. [Google Scholar] [CrossRef] [Scilit]
  16. Larson, J.E.; Lamb, G.C.; Stevenson, J.S.; Johnson, S.K.; Day, M.L.; Geary, T.W.; Kesler, D.J.; DeJarnette, J.M.; Schrick, F.N.; DiCostanzo, A.; et al. Synchronization of Estrus in Suckled Beef Cows for Detected Estrus and Artificial Insemination and Timed Artificial Insemination Using Gonadotropin-Releasing Hormone, Prostaglandin F2α, and Progesterone1. J. Anim. Sci. 2006, 84, 332–342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Beal, W.E.; Notter, D.R.; Akers, R.M. Techniques for Estimation of Milk Yield in Beef Cows and Relationships of Milk Yield to Calf Weight Gain and Postpartum Reproduction. J. Anim. Sci. 1990, 68, 937–943. [Google Scholar] [CrossRef] [Scilit]
  18. Sukhija, P.S.; Palmquist, D.L. Rapid Method for Determination of Total Fatty Acid Content and Composition of Feedstuffs and Feces. J. Agric. Food Chem. 1988, 36, 1202–1206. [Google Scholar] [CrossRef] [Scilit]
  19. Kadegowda, A.K.G.; Bionaz, M.; Thering, B.; Piperova, L.S.; Erdman, R.A.; Loor, J.J. Identification of Internal Control Genes for Quantitative Polymerase Chain Reaction in Mammary Tissue of Lactating Cows Receiving Lipid Supplements. J. Dairy Sci. 2009, 92, 2007–2019. [Google Scholar] [CrossRef] [Scilit]
  20. Goselink, R.M.A.; van Baal, J.; Widjaja, H.C.A.; Dekker, R.A.; Zom, R.L.G.; de Veth, M.J.; van Vuuren, A.M. Effect of Rumen-Protected Choline Supplementation on Liver and Adipose Gene Expression during the Transition Period in Dairy Cattle. J. Dairy Sci. 2013, 96, 1102–1116. [Google Scholar] [CrossRef] [Scilit]
  21. Wang, Y.H.; Byrne, K.A.; Reverter, A.; Harper, G.S.; Taniguchi, M.; McWilliam, S.M.; Mannen, H.; Oyama, K.; Lehnert, S.A. Transcriptional Profiling of Skeletal Muscle Tissue from Two Breeds of Cattle. Mamm. Genome 2005, 16, 201–210. [Google Scholar] [CrossRef] [Scilit]
  22. Rocco, S.M.; McNamara, J.P. Regulation of Bovine Adipose Tissue Metabolism during Lactation. 7. Metabolism and Gene Expression as a Function of Genetic Merit and Dietary Energy Intake. J. Dairy Sci. 2013, 96, 3108–3119. [Google Scholar] [CrossRef] [Scilit]
  23. Mukesh, M.; Bionaz, M.; Graugnard, D.E.; Drackley, J.K.; Loor, J.J. Adipose Tissue Depots of Holstein Cows Are Immune Responsive: Inflammatory Gene Expression in Vitro. Domest. Anim. Endocrinol. 2010, 38, 168–178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Su, X.; Wang, Y.; Li, A.; Zan, L.; Wang, H. Neudesin Neurotrophic Factor Promotes Bovine Preadipocyte Differentiation and Inhibits Myoblast Myogenesis. Animals 2019, 9, 1109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Duarte, M.S.; Paulino, P.V.R.; Das, A.K.; Wei, S.; Serão, N.V.L.; Fu, X.; Harris, S.M.; Dodson, M.V.; Du, M. Enhancement of Adipogenesis and Fibrogenesis in Skeletal Muscle of Wagyu Compared with Angus Cattle. J. Anim. Sci. 2013, 91, 2938–2946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Ji, P.; Osorio, J.S.; Drackley, J.K.; Loor, J.J. Overfeeding a Moderate Energy Diet Prepartum Does Not Impair Bovine Subcutaneous Adipose Tissue Insulin Signal Transduction and Induces Marked Changes in Peripartal Gene Network Expression. J. Dairy Sci. 2012, 95, 4333–4351. [Google Scholar] [CrossRef] [Scilit]
  27. Segers, J.R.; Loor, J.J.; Moisá, S.J.; Gonzalez, D.; Shike, D.W. Effects of Protein and Fat Concentration in Coproduct-Based Growing Calf Diets on Adipogenic and Lipogenic Gene Expression, Blood Metabolites, and Carcass Composition. J. Anim. Sci. 2017, 95, 2767–2781. [Google Scholar] [CrossRef]
  28. Thering, B.J.; Bionaz, M.; Loor, J.J. Long-Chain Fatty Acid Effects on Peroxisome Proliferator-Activated Receptor-α-Regulated Genes in Madin-Darby Bovine Kidney Cells: Optimization of Culture Conditions Using Palmitate. J. Dairy Sci. 2009, 92, 2027–2037. [Google Scholar] [CrossRef] [Scilit]
  29. Jeong, J.; Kwon, E.G.; Im, S.K.; Seo, K.S.; Baik, M. Expression of Fat Deposition and Fat Removal Genes Is Associated with Intramuscular Fat Content in Longissimus Dorsi Muscle of Korean Cattle Steers. J. Anim. Sci. 2012, 90, 2044–2053. [Google Scholar] [CrossRef] [Scilit]
  30. Bionaz, M.; Loor, J.J. Gene Networks Driving Bovine Milk Fat Synthesis during the Lactation Cycle. BMC Genom. 2008, 9, 366. [Google Scholar] [CrossRef] [Scilit]
  31. Taniguchi, M.; Guan, L.L.; Zhang, B.; Dodson, M.V.; Okine, E.; Moore, S.S. Adipogenesis of Bovine Perimuscular Preadipocytes. Biochem. Biophys. Res. Commun. 2008, 366, 54–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Khan, M.J.; Jacometo, C.B.; Graugnard, D.E.; Corrêa, M.N.; Schmitt, E.; Cardoso, F.; Loor, J.J. Overfeeding Dairy Cattle during Late-Pregnancy Alters Hepatic Pparα-Regulated Pathways Including Hepatokines: Impact on Metabolism and Peripheral Insulin Sensitivity. Gene Regul. Syst. Biol. 2014, 2014, 97–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Brandão, A.P.; Cooke, R.F.; Schubach, K.M.; Rett, B.; Souza, O.A.; Schachtschneider, C.L.; Perry, G.A.; Arispe, S.A.; Jump, D.B.; Pohler, K.G.; et al. Supplementing Ca Salts of Soybean Oil to Late-Gestating Beef Cows: Impacts on Performance and Physiological Responses of the Offspring. J. Anim. Sci. 2020, 98, skaa247. [Google Scholar] [CrossRef] [Scilit]
  34. Nakamura, M.T.; Nara, T.Y. Structure, Function, and Dietary Regulation of Δ6, Δ5, and Δ9 Desaturases. Annu. Rev. Nutr. 2004, 24, 345–376. [Google Scholar] [CrossRef] [Scilit]
  35. Coleman, D.N.; Murphy, K.D.; Relling, A.E. Prepartum Fatty Acid Supplementation in Sheep. II. Supplementation of Eicosapentaenoic Acid and Docosahexaenoic Acid during Late Gestation Alters the Fatty Acid Profile of Plasma, Colostrum, Milk and Adipose Tissue, and Increases Lipogenic Gene Expression. J. Anim. Sci. 2018, 96, 1181–1204. [Google Scholar] [CrossRef] [Scilit]
  36. Bellows, R.A.; Grings, E.E.; Simms, D.D.; Geary, T.W.; Bergman, J.W. Effects of Feeding Supplemental Fat during Gestation to First-Calf Beef Heifers. Prof. Anim. Sci. 2001, 17, 81–89. [Google Scholar] [CrossRef] [Scilit]
  37. Stokes, R.S.; Volk, M.J.; Ireland, F.A.; Gunn, P.J.; Shike, D.W. Effect of Repeated Trace Mineral Injections on Beef Heifer Development and Reproductive Performance. J. Anim. Sci. 2018, 96, 3943–3954. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Ratnayake, W.N. Concerns about the Use of 15:0, 17:0, and Trans-16:1n–7 as Biomarkers of Dairy Fat Intake in Recent Observational Studies That Suggest Beneficial Effects of Dairy Food on Incidence of Diabetes and Stroke. Am. J. Clin. Nutr. 2015, 101, 1102–1103. [Google Scholar] [CrossRef] [Scilit]
  39. Chilliard, Y.; Ferlay, A.; Mansbridge, R.M.; Doreau, M. Ruminant Milk Fat Plasticity: Nutritional Control of Saturated, Polyunsaturated, Trans and Conjugated Fatty Acids. Ann. Zootech. 2000, 49, 181–205. [Google Scholar] [CrossRef] [Scilit]
  40. Burns, P.D.; Bonnette, T.R.; Engle, T.E.; Whittier, J.C. Effects of Fishmeal Supplementation on Fertility and Plasma Ω-3 Fatty Acid Profiles in Primiparous, Lactating Beef Cows. Prof. Anim. Sci. 2002, 18, 373–379. [Google Scholar] [CrossRef] [Scilit]
  41. Mattos, R.; Staples, C.R.; Thatcher, W.W. Effects of Dietary Fatty Acids on Reproduction in Ruminants. Rev. Reprod. 2000, 5, 38–45. [Google Scholar] [CrossRef] [PubMed]
  42. Espinoza, J.L.; Ramirez-Godinez, J.A.; Jimenez, J.A.; Flores, A. Effects of Calcium Soaps of Fatty Acids on Postpartum Reproductive Activity in Beef Cows and Growth of Calves. J. Anim. Sci. 1995, 73, 2888. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Thomas, M.G.; Bao, B.; Williams, G.L. Dietary Fats Varying in Their Fatty Acid Composition Differentially Influence Follicular Growth in Cows Fed Isoenergetic Diets. J. Anim. Sci. 1997, 75, 2512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. De Fries, C.A.; Neuendorff, D.A.; Randel, R.D. Fat Supplementation Influences Postpartum Reproductive Performance in Brahman Cows. J. Anim. Sci. 1998, 76, 864–870. [Google Scholar] [CrossRef] [Scilit]
  45. Ricks, R.E.; Cook, E.K.; Long, N.M. Effects of Supplementing Ruminal-Bypass Unsaturated Fatty Acids during Late Gestation on Beef Cow and Calf Serum and Colostrum Fatty Acids, Transfer of Passive Immunity, and Cow and Calf Performance. Appl. Anim. Sci. 2020, 36, 271–284. [Google Scholar] [CrossRef] [Scilit]
  46. Garcia, M.; Greco, L.F.; Favoreto, M.G.; Marsola, R.S.; Martins, L.T.; Bisinotto, R.S.; Shin, J.H.; Lock, A.L.; Block, E.; Thatcher, W.W.; et al. Effect of Supplementing Fat to Pregnant Nonlactating Cows on Colostral Fatty Acid Profile and Passive Immunity of the Newborn Calf. J. Dairy Sci. 2014, 97, 392–405. [Google Scholar] [CrossRef] [Scilit]
  47. Or-Rashid, M.M.; Fisher, R.; Karrow, N.; AlZahal, O.; McBride, B.W. Fatty Acid Profile of Colostrum and Milk of Ewes Supplemented with Fish Meal and the Subsequent Plasma Fatty Acid Status of Their Lambs. J. Anim. Sci. 2010, 88, 2092–2102. [Google Scholar] [CrossRef] [Scilit]
  48. Coleman, D.N.; Rivera-Acevedo, K.C.; Relling, A.E. Prepartum Fatty Acid Supplementation in Sheep I. Eicosapentaenoic and Docosahexaenoic Acid Supplementation Do Not Modify Ewe and Lamb Metabolic Status and Performance through Weaning. J. Anim. Sci. 2018, 96, 364–374. [Google Scholar] [CrossRef] [Scilit]
  49. Asfour, H.A.; Allouh, M.Z.; Said, R.S. Myogenic Regulatory Factors: The Orchestrators of Myogenesis after 30 Years of Discovery. Exp. Biol. Med. 2018, 243, 118–128. [Google Scholar] [CrossRef] [Scilit]
  50. McKinnell, I.W.; Ishibashi, J.; Le Grand, F.; Punch, V.G.J.; Addicks, G.C.; Greenblatt, J.F.; Dilworth, F.J.; Rudnicki, M.A. Pax7 Activates Myogenic Genes by Recruitment of a Histone Methyltransferase Complex. Nat. Cell Biol. 2008, 10, 77–84. [Google Scholar] [CrossRef] [Scilit]
  51. Soleimani, V.D.; Punch, V.G.; Kawabe, Y.; Jones, A.E.; Palidwor, G.A.; Porter, C.J.; Cross, J.W.; Carvajal, J.J.; Kockx, C.E.M.; van IJcken, W.F.J.; et al. Transcriptional Dominance of PAX7 in Adult Myogenesis Is Due to High-Affinity Recognition of Homeodomain Motifs. Dev. Cell 2012, 22, 1208–1220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Von Maltzahn, J.; Jones, A.E.; Parks, R.J.; Rudnicki, M.A. Pax7 Is Critical for the Normal Function of Satellite Cells in Adult Skeletal Muscle. Proc. Natl. Acad. Sci. USA 2013, 110, 16474–16479. [Google Scholar] [CrossRef] [Scilit]
  53. Clark, D.L.; Boler, D.D.; Kutzler, L.W.; Jones, K.A.; McKeith, F.K.; Killefer, J.; Carr, T.R.; Dilger, A.C. Muscle Gene Expression Associated with Increased Marbling in Beef Cattle. Anim. Biotechnol. 2011, 22, 51–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Dervishi, E.; Serrano, C.; Joy, M.; Serrano, M.; Rodellar, C.; Calvo, J.H. The Effect of Feeding System in the Expression of Genes Related with Fat Metabolism in Semitendinous Muscle in Sheep. Meat Sci. 2011, 89, 91–97. [Google Scholar] [CrossRef] [Scilit]
  55. Rosen, E.D.; MacDougald, O.A. Adipocyte Differentiation from the inside Out. Nat. Rev. Mol. Cell. Biol. 2006, 7, 885–896. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Fajas, L.; Debril, M.B.; Auwerx, J. Peroxisome Proliferator-Activated Receptor-γ: From Adipogenesis to Carcinogenesis. J. Mol. Endocrinol. 2001, 27, 1–9. [Google Scholar] [CrossRef] [Scilit]
  57. Soret, B.; Mendizabal, J.A.; Arana, A.; Alfonso, L. Expression of Genes Involved in Adipogenesis and Lipid Metabolism in Subcutaneous Adipose Tissue and Longissimus Muscle in Low-Marbled Pirenaica Beef Cattle. Animal 2016, 10, 2018–2026. [Google Scholar] [CrossRef] [Scilit]
  58. Gupta, R.K.; Arany, Z.; Seale, P.; Mepani, R.J.; Ye, L.; Conroe, H.M.; Roby, Y.A.; Kulaga, H.; Reed, R.R.; Spiegelman, B.M. Transcriptional Control of Preadipocyte Determination by Zfp423. Nature 2010, 464, 619–623. [Google Scholar] [CrossRef] [Scilit]
Table 1. Supplement composition and nutrient intake from treatment supplements containing soybean hulls mixed with whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) 1.
Table 1. Supplement composition and nutrient intake from treatment supplements containing soybean hulls mixed with whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) 1.
Item (Dry Matter Basis)CONSFA/MUFAPUFA
Ingredients, kg/cow/d
Soybean hull0.160.770.77
Whole-shelled corn0.91--
EnerGII-0.155-
Prequel--0.12
Strata--0.04
Macronutrient intake, kg/cow/d
Dry matter1.070.930.93
Crude protein0.080.080.08
Total fat0.050.160.15
Total digestible nutrients 20.900.900.89
Fatty acid intake, g/d
C16:04.055.621.7
C16:1c90.10.33.4
C18:00.65.85.6
C18:1c97.142.924.9
C18:2n-613.413.745.8
C18:3n-30.61.52.5
C20:5n-3--2.8
C22:6n-3--1.9
1 CON = 0.16 kg DM soybean hulls/cow/d mixed with 0.91 kg DM whole-shelled corn/cow/d. SFA/MUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.155 kg DM EnerGII (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d; PUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.04 kg DM Strata + 0.12 kg DM Prequel (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d. 2 Calculated with book values for soybean hulls and whole-shelled corn, and product label values for EnerGII, Prequel, and Strata.
Table 2. Nutritional and fatty acid profiles of ingredients fed to cows for the last 82 ± 5 d of gestation 1.
Table 2. Nutritional and fatty acid profiles of ingredients fed to cows for the last 82 ± 5 d of gestation 1.
Item (% of Dry Matter)ForageSoybean HullWhole-Shelled CornEnerGIIPrequelStrata
Dry matter, %30.286.987.296.595.696.3
Crude protein, %14.310.07.2---
Neutral detergent fiber, %52.565.57.4---
Acid detergent fiber, %28.248.32.6---
Total fat, %2.93.03.683.978.278.2
Total fatty acid, %1.11.72.671.168.259.7
Fatty acid profile, % of total fatty acid
C16:021.818.614.648.315.328.5
C16:1c92.30.80.20.20.611.6
C18:02.56.51.94.54.25.8
C18:1c95.817.227.936.926.92.8
C18:2n-621.640.652.17.748.24.7
C18:3n-337.49.61.40.21.21.2
C20:5n-30000011.6
C22:6n-3000007.8
1 EnerGII, Prequel, and Strata were from Virtus Nutrition LLC, Corcoran, CA, USA.
Table 3. Nutrient composition of the backgrounding diet for steers.
Table 3. Nutrient composition of the backgrounding diet for steers.
ItemCommon Diet
Ingredients, % DM basis
Whole-shelled corn50.5
Corn distillers grains34.9
Co-product balancer 14.4
Hay10.2
Analyzed nutrient content, % DM
DM86.3
CP14.8
NDF35.8
ADF12.1
Crude fat4.2
1 Co-product balancer contained 25% crude protein, 1.5% crude fat, 8.0% crude fiber, 14.0% Ca, 0.1% P, 0.5% Mg, 0.1% K, 3.5% salt, 300 mg/kg Cu, 3.0 mg/kg Se, 1500 mg/kg Zn, 52.9 KIU/kg vitamin A, 5.3 KIU/kg vitamin D3, 55 IU/kg vitamin E.
Table 4. GenBank accession number, sequence, and amplicon size of primers used for mRNA expression by qPCR.
Table 4. GenBank accession number, sequence, and amplicon size of primers used for mRNA expression by qPCR.
Accession NumberGene 1DirectionPrimer Sequences (5′ to 3′)Amplicon Length (bp)
NM_001034034.2GAPDH [19]F78AAGGTCGGAGTGAACGGATTC98
R175AAGGGGTCATTGATGGCGAC
NM_173979.3ACTB [20]F862GCCCTGAGGCTCTCTTCCA100
R961CGGATGTCGACGTCACACTT
NM_001012682.1RPLP0 [21]F657CAACCCTGAAGTGCTTGACAT227
R883AGGCAGATGGATCAGCCA
NM_001033613BRPS2 [22]F320GGAGCATCCCTGAAGGATGA101
R420TCCCCGATAGCAACAAACG
BC103464SLC35B2 [23]F894ACATTGCTTTCGACAGCTTCAC95
R988GAAGAGATTGACCCCAAACATCA
NM_174116.1MYF5 [24]F892CCTCTAGTTCCAGGCTCATCTA90
R981ACCTCCTTCCTCCTGTGTAATA
NM_001111325MYOG [24]F222GGCGTGTAAGGTGTGTAAG85
R306CTTCTTGAGTCTGCGCTTCT
NM_001040478.2MYOD1 [14]F827AACTGTTCCGACGGCATGAT105
R931CCGGGGTTCGTTGGGC
XM_015460690.2PAX7 [14]F435AGATCGAGGAGTACAAGAGGGA112
R545ATCGAACTCACTGAGGGCACG
NM_174727.1MYH7 [14]F2160TTCCGGCAGAGGTATCGAAT128
R2287TGGCCGAACTTATACTGGTTGTG
NM_001046113MEF2C [24]F703CCTGATGCAGACGATTCAGTAG123
R825AAAGTTGGGAGGTGGAACAG
NM_001101893.1ZFP423 [25]F240GGATTCCTCCGTGACAGCA120
R359TCGTCCTCATTCCTCTCCTCT
NM_181024.2PPARG [26]F135CCAAATATCGGTGGGAGTCG101
R235ACAGCGAAGGGCTCACTCTC
NM_176784.2CEBPA [14]F385TTCAACGACGAGTTCCTGGC107
R491CCCGGGTAGTCAAAGTCGTT
NM_176788.1CEBPB [25]F333CGGGCAGCACCACGACTTCC106
R438CCCCAGTCGGCCCAGACTCA
NM_174314.2FABP4 [27]F401TGGTGCTGGAATGTGTCATGA101
R501TGGAGTTCGATGCAAACGTC
NM_177945PPARGC1A [28]F2001GTACCAGCACGAAAGGCTCAA120
R2120ATCACACGGCGCTCTTCAA
NM_177518AGPAT1 [29]F563TGCCATCAGTGTCATGTCTG86
R648GGTTTCTCGTGCCCTCAG
CR552737FASN [30]F6383ACCTCGTGAAGGCTGTGACTCA92
R6474TGAGTCGAGGCCAAGGTCTGGAA
NM_001113302.1SREBP1 [31]F2858TACCTGCAGCTTCTCCATCA145
R3002CACCAATGGGTACAGCCTCT
NM_173959.4SCD [32]F809TCCTGTTGTTGTGCTTCATCC101
R909GGCATAACGGAATAAGGTGGC
NM_174224.2ACACA [14]F182TGTGAAGTATCCTTCTGGAGGT99
R280CTTCCAAAAAGAACTCAGAGACC
1MYH7 Myosin heavy chain 7, PAX7 Paired box protein 7, MYF5 Myogenic factor 5, MYOD1 Myogenic differentiation 1, MYOG Myogenin, MEF2C Myocyte enhancer factor 2C, CEBPA CCAAT enhancer binding protein alpha, CEBPB CCAAT enhancer binding protein beta, ZFP423 Zinc finger protein 423, FABP4 Fatty acid binding protein 4, PPARG Peroxisome proliferator activated receptor gamma, GPAT1 Glycerol-3-phosphate acyltransferase 1, PPARGC1A PPARG coactivator 1 alpha, SCD Stearoyl-CoA desaturase, AGPAT1 Acyl-glycerol phosphate acyltransferase 1, FASN Fatty acid synthase, SREBP1 Sterol regulatory element binding transcription factor 1, ACACA Acetyl-CoA carboxylase alpha.
Table 5. Effects of supplementation for the last 82 ± 5 d of gestation of soybean hulls mixed with either whole-shelled corn (CRN), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA2) on the relative concentrations of selected plasma fatty acids in cows 1.
Table 5. Effects of supplementation for the last 82 ± 5 d of gestation of soybean hulls mixed with either whole-shelled corn (CRN), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA2) on the relative concentrations of selected plasma fatty acids in cows 1.
ItemMid-Sup 2At-Calving 3SEMp-Value 4
CON 5SFA/
MUFA 6
PUFA 7CONSFA/MUFAPUFATrtTimeTrt x Time
Groups, n444444
C15:044514431273740.76<0.010.17
C16:0100813531078137312741589121.80.470.030.09
C16:1c917.816.47.146.431.845.94.730.29<0.010.09
C17:06878774942585.20.22<0.010.26
C18:0142017871468130312191465124.90.520.050.11
C18:1c9481669446975774696120.60.380.020.31
C18:2n-6975170514997799771379150.30.010.020.14
C18:3n-327731619615916918345.70.530.040.35
C20:03.23.83.92.43.04.00.570.160.320.69
C20:3n-611412810367566512.10.75<0.010.30
C20:4n-613217614113813116920.30.570.830.23
C20:5n-33441493133467.10.150.470.92
1 Data are presented as relative concentration per 100 ul plasma to internal standard C23:0; the concentration of the corresponding fatty acid prior to supplementation was included as covariate if significant. 2 Mid-supplementation was d -42 of the experiment. 3 At-calving plasma samples were collected from dams 4 ± 2.2 d post-calving. 4 Trt = treatment effect; Trt × Time = interaction between treatment and time. 5 CON = 0.16 kg DM soybean hulls/cow/d mixed with 0.91 kg DM whole-shelled corn/cow/d. 6 SFA/MUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.155 kg DM EnerGII (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d. 7 PUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.04 kg DM Strata + 0.12 kg DM Prequel (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d.
Table 6. Effects of supplementation for the last 82 ± 5 d of gestation of soybean hulls mixed with either whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) on cow body weight and body condition score 1.
Table 6. Effects of supplementation for the last 82 ± 5 d of gestation of soybean hulls mixed with either whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) on cow body weight and body condition score 1.
Item 1CON 2SFA/MUFA 3PUFA 4SEMp-Value
Cow BW, kg
Initial (d -82)61161360813.70.93
Mid supplementation (d -42)66266566114.40.96
Calving (4 ± 2 d post-calving)62863762314.80.60
WSW (d 68)62263662615.90.66
AI (d 85)62964963816.50.47
AI-conception check (d 120)56759060115.90.13
Weaning (d 174)56357856916.10.64
Cow BCS
Initial6.16.16.00.190.98
Mid supplementation6.26.66.20.240.19
Calving5.45.45.30.180.55
WSW5.35.65.20.150.11
AI5.15.24.90.220.45
AI-conception check5.05.05.00.040.29
Weaning5.05.15.00.070.64
1 BW = body weight; WSW = weigh-suckle-weigh; AI = artificial insemination; BCS = body condition score. 2 CON = 0.16 kg DM soybean hulls/cow/d mixed with 0.91 kg DM whole-shelled corn/cow/d. 3 SFA/MUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.155 kg DM EnerGII (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d. 4 PUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.04 kg DM Strata + 0.12 kg DM Prequel (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d.
Table 7. Effects of supplementation for the last 82 ± 5 d of gestation of soybean hulls mixed with either whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) on milk production and cow reproductive performance.
Table 7. Effects of supplementation for the last 82 ± 5 d of gestation of soybean hulls mixed with either whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) on milk production and cow reproductive performance.
Item 1CON 2SFA/MUFA 3PUFA 4SEMp-Value
Gestation length, d2792792781.30.63
Milk production1 (kg/d)9.38.18.71.780.80
Composition
Fat, %3.22.53.10.470.28
Protein, %2.72.83.00.120.12
Lactose, %4.94.84.60.180.28
Other solids, %6.05.95.70.160.29
Total solids, %11.911.211.80.420.24
MUN, mg/dL5.04.15.10.750.31
AI pregnancy, %31.634.429.0-0.96
Overall pregnancy, %99.398.598.9-0.88
1 Milk production was determined via weigh-suckle-weigh technique at 68 ± 5 d postpartum on a subset of 77 pairs (4–8 pairs/group); Milk composition conducted on a subset of cows (4 cows/group; 47 cows in total) at 68 ± 5 d postpartum; MUN = milk urea nitrogen; AI = artificial insemination. 2 CON = 0.16 kg DM soybean hulls/cow/d mixed with 0.91 kg DM whole-shelled corn/cow/d. 3 SFA/MUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.155 kg DM EnerGII (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d. 4 PUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.04 kg DM Strata + 0.12 kg DM Prequel (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d
Table 8. Effects of supplementation for the last 82 ± 5 d of gestation of soybean hulls mixed with either whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) on milk fatty acid profile 1.
Table 8. Effects of supplementation for the last 82 ± 5 d of gestation of soybean hulls mixed with either whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) on milk fatty acid profile 1.
Item (g/100 g Fatty Acid)CON 2SFA/MUFA 3PUFA 4SEMp-Value
Groups, n444
C4:04.14.14.10.150.99
C6:01.81.81.80.060.51
C8:0 51.01.11.0-0.31
C10:02.22.42.20.130.41
C12:02.52.72.50.160.45
C14:08.99.49.10.440.54
C15:01.1 b1.2 ab1.3 a0.050.05
C16:0 2726260.80.76
C16:1 c92.11.92.00.080.07
C17:00.90.91.00.030.08
C18:010.110.410.60.670.76
C18:1 t6, 80.220.240.240.0150.47
C18:1 t90.190.190.180.0110.78
C18:1 t112.22.32.30.140.77
C18:1 t120.190.190.190.0120.86
C18:1 c92423230.90.34
C18:1 c110.580.520.570.0330.30
C18:1 c120.070.070.070.0050.90
C18:1 t160.160.170.170.0100.43
C18:2 c9, c121.92.02.00.100.37
C20:0 50.180.190.20-0.30
C20:1 c11 50.050.040.05-0.28
C18:3 c9, c12, c150.540.580.640.0370.07
CLA c9, t111.081.081.050.0630.80
C22:00.070.080.090.0080.06
C20:3 n6 50.070.080.08-0.29
C20:4 n6 50.140.140.14-0.98
C20:5 n30.050.050.050.0040.23
C22:5 n30.110.120.130.0100.41
Total n-30.70 b0.75 ab0.83 a0.0080.05
Total n-62.12.22.30.120.39
1 Milk fatty acid profile analysis was conducted on a subset of cows (4 cows/group; 47 cows in total) at 68 ± 5 d postpartum. 2 CON = 0.16 kg DM soybean hulls/cow/d mixed with 0.91 kg DM whole-shelled corn/cow/d. 3 SFA/MUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.155 kg DM EnerGII (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d. 4 PUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.04 kg DM Strata + 0.12 kg DM Prequel (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d. 5 Data were transformed for statistical analysis because of non-normal distribution; Means are presented after back-transformation. Means within a row with different superscript letters differ (p < 0.05).
Table 9. Effects of supplementation of soybean hulls mixed with either whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) for the last 82 ± 5 d of gestation on the relative concentrations of selected plasma fatty acids in steers at birth 1.
Table 9. Effects of supplementation of soybean hulls mixed with either whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) for the last 82 ± 5 d of gestation on the relative concentrations of selected plasma fatty acids in steers at birth 1.
Item 1CON 2SFA/MUFA 3PUFA 4SEMp-Value
Groups, n444
C15:02022263.10.38
C16:010801168120647.60.21
C16:1c93424346.10.43
C17:033 ab28 b47 a4.50.04
C18:0932976107146.20.16
C18:1c990178978355.90.30
C18:2n-6624 b746 ab990 a86.10.04
C18:3n-31036011319.50.19
C20:03.6 ab1.9 b5.9 a0.740.02
C20:3n-628 ab19 b51 a7.60.05
C20:4n-6103 b70 b171 a20.30.02
C20:5n-327 ab15 b44 a5.40.02
1 Data are presented as relative concentration per 100 µL plasma to internal standard C23:0; at birth plasma samples were collected from steers 4 ± 2.2 d of age. 2 CON = 0.16 kg DM soybean hulls/cow/d mixed with 0.91 kg DM whole-shelled corn/cow/d. 3 SFA/MUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.155 kg DM EnerGII (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d. 4 PUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.04 kg DM Strata + 0.12 kg DM Prequel (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d. Means within a row with different superscript letters differ (p < 0.05).
Table 10. Effects of supplementation for the last 82 ± 5 d of gestation of soybean hulls mixed with either whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) on steer progeny growth performance during pre-weaning and backgrounding periods.
Table 10. Effects of supplementation for the last 82 ± 5 d of gestation of soybean hulls mixed with either whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) on steer progeny growth performance during pre-weaning and backgrounding periods.
Item 1CON 2SFA/MUFA 3PUFA 4SEMp-Value
Birth BW, kg33.734.132.70.740.19
Weaning BW, kg1831861904.50.34
Pre-weaning ADG, kg/d0.850.870.900.0270.21
Weaning age, d1741731751.40.63
Backgrounding BW, kg2442442486.20.76
Backgrounding5 ADG, kg/d1.431.401.430.0570.85
1 BW = body weight; ADG = average daily gain. 2 CON = 0.16 kg DM soybean hulls/cow/d mixed with 0.91 kg DM whole-shelled corn/cow/d. 3 SFA/MUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.155 kg DM EnerGII (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d. 4 PUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.04 kg DM Strata + 0.12 kg DM Prequel (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d. 5 Backgrounding phase was 42 days.
Table 11. Relative mRNA expression of genes regulating myogenesis and adipogenesis in the longissimus muscle of the steers (4 steers per group) born from dams supplemented for the last 82 ± 5 d of gestation with soybean hulls mixed with either whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) 1.
Table 11. Relative mRNA expression of genes regulating myogenesis and adipogenesis in the longissimus muscle of the steers (4 steers per group) born from dams supplemented for the last 82 ± 5 d of gestation with soybean hulls mixed with either whole-shelled corn (CON), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA) 1.
Gene 6BirthWeaningp-Value 5
CON 2SFA/MUFA 3PUFA 4CONSFA/MUFAPUFATrtTimeTrt × Time
MYOD11.0331.0801.1910.9970.7700.8910.560.020.36
MYOG0.9121.0200.9820.8970.9400.9750.690.680.93
PAX70.992 b1.232 a1.230 a0.910 b0.745 c0.753 c0.98<0.01<0.01
MYF50.9921.0711.0590.8340.7840.8330.89<0.010.61
MYH70.6140.5970.8461.2251.1931.4670.01<0.010.44
AGPAT10.786 c0.904 b0.989 ab1.036 a0.915 ab0.893 b0.550.08<0.01
CPT10.739 c0.795 bc1.040 a0.924 ab0.814 bc0.895 abc0.150.530.02
PPARG0.1120.1250.1380.2130.2460.2310.10<0.010.36
ZFP4230.6410.7320.8101.0721.1931.2110.12<0.010.68
CEBPA0.0760.0740.0930.4110.5100.4540.47<0.010.28
CEBPB0.0570.0580.0810.2970.3500.3420.12<0.010.08
1 Means are back-transformed if transformation was conducted. 2 CON = 0.16 kg DM soybean hulls/cow/d mixed with 0.91 kg DM whole-shelled corn/cow/d. 3 SFA/MUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.155 kg DM EnerGII (Virtus Nutrition LLC, Corcoran, CA)/cow/d. 4 PUFA2 = 0.77 kg DM soybean hulls/cow/d mixed with 0.04 kg DM Strata + 0.12 kg DM Prequel (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d. 5 Trt = treatment effect; Trt × Time = interaction between treatment and time. 6 MYOD1 Myogenic differentiation 1; MYOG Myogenin; PAX7 Paired box protein 7; MYF5 Myogenic factor 5; MYH7 Myosin heavy chain 7; AGPAT1 Acyl-glycerol phosphate acyltransferase 1; CPT1 Carnitine palmitoyltransferase 1; PPARG Peroxisome proliferator activated receptor gamma; ZFP423 Zinc finger protein 423; CEBPA CCAAT enhancer binding protein alpha; CEBPB CCAAT enhancer binding protein beta. Means within a row with different superscript letters differ (p < 0.05).
Table 12. Relative mRNA expression of genes regulating adipogenesis in subcutaneous adipose tissue of the steers (4 steers per group) born from dams supplemented soybean hulls mixed with either whole-shelled corn (CRN), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA2) for the last 82 ± 5 d of gestation 1.
Table 12. Relative mRNA expression of genes regulating adipogenesis in subcutaneous adipose tissue of the steers (4 steers per group) born from dams supplemented soybean hulls mixed with either whole-shelled corn (CRN), Ca salts of saturated/monounsaturated fatty acids (SFA/MUFA), or Ca salts of polyunsaturated fatty acids (PUFA2) for the last 82 ± 5 d of gestation 1.
Gene 6BirthWeaningp-Value 5
CON 2SFA/MUFA 3PUFA 4CONSFA/
MUFA
PUFATrtTimeTrt × Time
ZFP4231.0551.1141.1341.3241.2051.0730.480.090.07
ACACA1.4701.5371.3090.1570.2500.1690.75<0.010.86
CEBPA0.6240.6920.8750.6650.6150.6220.640.160.21
CEBPB0.4690.4770.6190.5270.4660.4890.160.410.07
PPARG1.0390.9641.1320.8480.7940.7570.87<0.010.58
SCD0.6340.5720.4620.0820.0970.0790.72<0.010.78
FASN0.9910.5910.6720.1170.1030.1310.69<0.010.69
FABP40.9740.8741.2201.0440.9420.9050.610.530.16
1 Means are back-transformed if transformation was conducted. 2 CRN = 0.16 kg DM soybean hulls/cow/d mixed with 0.91 kg DM whole-shelled corn/cow/d. 3 SFA/MUFA = 0.77 kg DM soybean hulls/cow/d mixed with 0.155 kg DM EnerGII (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d; 4 PUFA2 = 0.77 kg DM soybean hulls/cow/d mixed with 0.04 kg DM Strata + 0.12 kg DM Prequel (Virtus Nutrition LLC, Corcoran, CA, USA)/cow/d. 5 Trt = treatment effect; Trt × Time = interaction between treatment and time. 6 ZFP423 Zinc finger protein 423; ACACA Acetyl-CoA carboxylase alpha; CEBPA CCAAT enhancer binding protein alpha; CEBPB CCAAT enhancer binding protein beta; PPARG Peroxisome proliferator activated receptor gamma; SCD Stearoyl-CoA desaturase; FASN Fatty acid synthase; FABP4 Fatty acid binding protein 4.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shao, T.; McCann, J.C.; Shike, D.W. Effects of Late Gestation Supplements Differing in Fatty Acid Amount and Profile to Beef Cows on Cow Performance, Steer Progeny Growth Performance through Weaning, and Relative mRNA Expression of Genes Associated with Muscle and Adipose Tissue Development. Animals 2023, 13, 437. https://doi.org/10.3390/ani13030437

AMA Style

Shao T, McCann JC, Shike DW. Effects of Late Gestation Supplements Differing in Fatty Acid Amount and Profile to Beef Cows on Cow Performance, Steer Progeny Growth Performance through Weaning, and Relative mRNA Expression of Genes Associated with Muscle and Adipose Tissue Development. Animals. 2023; 13(3):437. https://doi.org/10.3390/ani13030437

Chicago/Turabian Style

Shao, Taoqi, Joshua C. McCann, and Daniel W. Shike. 2023. "Effects of Late Gestation Supplements Differing in Fatty Acid Amount and Profile to Beef Cows on Cow Performance, Steer Progeny Growth Performance through Weaning, and Relative mRNA Expression of Genes Associated with Muscle and Adipose Tissue Development" Animals 13, no. 3: 437. https://doi.org/10.3390/ani13030437

APA Style

Shao, T., McCann, J. C., & Shike, D. W. (2023). Effects of Late Gestation Supplements Differing in Fatty Acid Amount and Profile to Beef Cows on Cow Performance, Steer Progeny Growth Performance through Weaning, and Relative mRNA Expression of Genes Associated with Muscle and Adipose Tissue Development. Animals, 13(3), 437. https://doi.org/10.3390/ani13030437

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop