The Prevalence and Genetic Diversity of Porcine Circoviruses (PCVs) during 2017–2023 in Guangdong Province, China
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Viral DNA Extraction and Virus Detection
2.3. Detection of Other Pathogens
2.4. Complete-Genome Sequencing of PCV2 and PCV3
2.5. Alignment and Phylo-Genetic Analysis
3. Results
3.1. Prevalence of PCVs in Guangdong Province, China
3.2. Co-Infection with Other Porcine Viruses
3.3. Genetic Analysis of PCV2
3.4. Genetic Analysis of PCV3
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Harding, J.C.; Baker, C.D.; Tumber, A.; McIntosh, K.A.; Parker, S.E.; Middleton, D.M.; Hill, J.E.; Ellis, J.A.; Krakowka, S. Porcine circovirus-2 DNA concentration distinguishes wasting from nonwasting pigs and is correlated with lesion distribution, severity, and nucleocapsid staining intensity. J. Vet. Diagn. Investig. 2008, 20, 274–282. [Google Scholar] [CrossRef] [PubMed]
- Tischer, I.; Gelderblom, H.; Vettermann, W.; Koch, M.A. A very small porcine virus with circular single-stranded DNA. Nature 1982, 295, 64–66. [Google Scholar] [CrossRef] [PubMed]
- Segalés, J. Porcine circovirus type 2 (PCV2) infections: Clinical signs, pathology and laboratory diagnosis. Virus Res. 2012, 164, 10–19. [Google Scholar] [CrossRef]
- Chae, C. A review of porcine circovirus 2-associated syndromes and diseases. Vet. J. 2005, 169, 326–336. [Google Scholar] [CrossRef]
- Phan, T.G.; Giannitti, F.; Rossow, S.; Marthaler, D.; Knutson, T.P.; Li, L.; Deng, X.; Resende, T.; Vannucci, F.; Delwart, E. Detection of a novel circovirus PCV3 in pigs with cardiac and multi-systemic inflammation. Virol. J. 2016, 13, 184. [Google Scholar] [CrossRef]
- Palinski, R.; Pineyro, P.; Shang, P.; Yuan, F.; Guo, R.; Fang, Y.; Byers, E.; Hause, B.M. A Novel Porcine Circovirus Distantly Related to Known Circoviruses Is Associated with Porcine Dermatitis and Nephropathy Syndrome and Reproductive Failure. J. Virol. 2017, 91, e01879-16. [Google Scholar] [CrossRef]
- Sun, W.; Du, Q.; Han, Z.; Bi, J.; Lan, T.; Wang, W.; Zheng, M. Detection and genetic characterization of porcine circovirus 4 (PCV4) in Guangxi, China. Gene 2021, 773, 145384. [Google Scholar] [CrossRef]
- Tian, R.B.; Zhao, Y.; Cui, J.T.; Zheng, H.H.; Xu, T.; Hou, C.Y.; Wang, Z.Y.; Li, X.S.; Zheng, L.L.; Chen, H.Y. Molecular detection and phylogenetic analysis of Porcine circovirus 4 in Henan and Shanxi Provinces of China. Transbound. Emerg. Dis. 2021, 68, 276–282. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.M.; Zhao, Y.Y.; Liu, X.C.; Han, Y.Y.; Zhang, Y.H.; Hou, C.Y.; Zheng, L.L.; Ma, S.J.; Chen, H.Y. Molecular detection and genetic characteristics of a novel porcine circovirus (porcine circovirus 4) and porcine reproductive and respiratory syndrome virus in Shaanxi and Henan Provinces of China. Comp. Immunol. Microbiol. Infect. Dis. 2023, 98, 102009. [Google Scholar] [CrossRef]
- Xu, T.; You, D.; Wu, F.; Zhu, L.; Sun, X.; Lai, S.; Ai, Y.; Zhou, Y.; Xu, Z. First molecular detection and genetic analysis of porcine circovirus 4 in the Southwest of China during 2021–2022. Front. Microbiol. 2022, 13, 1052533. [Google Scholar] [CrossRef]
- Ha, Z.; Yu, C.; Xie, C.; Wang, G.; Zhang, Y.; Hao, P.; Li, J.; Li, Z.; Li, Y.; Rong, F.; et al. Retrospective surveillance of porcine circovirus 4 in pigs in Inner Mongolia, China, from 2016 to 2018. Arch. Virol. 2021, 166, 1951–1959. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.H.; Hu, W.Q.; Li, J.Y.; Liu, T.N.; Zhou, J.Y.; Opriessnig, T.; Xiao, C.T. Novel circovirus species identified in farmed pigs designated as Porcine circovirus 4, Hunan province, China. Transbound. Emerg. Dis. 2020, 67, 1057–1061. [Google Scholar] [CrossRef] [PubMed]
- Niu, G.; Zhang, X.; Ji, W.; Chen, S.; Li, X.; Yang, L.; Zhang, L.; Ouyang, H.; Li, C.; Ren, L. Porcine circovirus 4 rescued from an infectious clone is replicable and pathogenic in vivo. Transbound. Emerg. Dis. 2022, 69, 1057–1061. [Google Scholar]
- Rose, N.; Opriessnig, T.; Grasland, B.; Jestin, A. Epidemiology and transmission of porcine circovirus type 2 (PCV2). Virus Res. 2012, 164, 78–89. [Google Scholar] [CrossRef]
- Afolabi, K.O.; Iweriebor, B.C.; Okoh, A.I.; Obi, L.C. Global Status of Porcine circovirus Type 2 and Its Associated Diseases in Sub-Saharan Africa. Adv. Virol. 2017, 2017, 6807964. [Google Scholar] [CrossRef] [PubMed]
- Meehan, B.M.; McNeilly, F.; Todd, D.; Kennedy, S.; Jewhurst, V.A.; Ellis, J.A.; Hassard, L.E.; Clark, E.G.; Haines, D.M.; Allan, G.M. Characterization of novel circovirus DNAs associated with wasting syndromes in pigs. J. Gen. Virol. 1998, 79 Pt 9, 2171–2179. [Google Scholar] [CrossRef]
- Mankertz, A.; Mankertz, J.; Wolf, K.; Buhk, H.J. Identification of a protein essential for replication of porcine circovirus. J. Gen. Virol. 1998, 79 Pt 2, 381–384. [Google Scholar] [CrossRef]
- Nawagitgul, P.; Harms, P.A.; Morozov, I.; Thacker, B.J.; Sorden, S.D.; Lekcharoensuk, C.; Paul, P.S. Modified indirect porcine circovirus (PCV) type 2-based and recombinant capsid protein (ORF2)-based enzyme-linked immunosorbent assays for detection of antibodies to PCV. Clin. Diagn. Lab. Immunol. 2002, 9, 33–40. [Google Scholar] [CrossRef] [PubMed]
- Franzo, G.; Segales, J. Porcine circovirus 2 (PCV-2) genotype update and proposal of a new genotyping methodology. PLoS ONE 2018, 13, e0208585. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Noll, L.; Lu, N.; Porter, E.; Stoy, C.; Zheng, W.; Liu, X.; Peddireddi, L.; Niederwerder, M.; Bai, J. Genetic diversity and prevalence of porcine circovirus type 3 (PCV3) and type 2 (PCV2) in the Midwest of the USA during 2016–2018. Transbound. Emerg. Dis. 2020, 67, 1284–1294. [Google Scholar] [CrossRef]
- Karuppannan, A.K.; Opriessnig, T. Porcine Circovirus Type 2 (PCV2) Vaccines in the Context of Current Molecular Epidemiology. Viruses 2017, 9, 99. [Google Scholar] [CrossRef]
- Wen, S.; Sun, W.; Li, Z.; Zhuang, X.; Zhao, G.; Xie, C.; Zheng, M.; Jing, J.; Xiao, P.; Wang, M.; et al. The detection of porcine circovirus 3 in Guangxi, China. Transbound. Emerg. Dis. 2018, 65, 27–31. [Google Scholar] [CrossRef]
- Visuthsak, W.; Woonwong, Y.; Thanantong, N.; Poolperm, P.; Boonsoongnern, A.; Ratanavanichrojn, N.; Jirawattanapong, P.; Soda, N.; Kaminsonsakul, T.; Phuttapatimok, S.; et al. PCV3 in Thailand: Molecular epidemiology and relationship with PCV2. Transbound. Emerg. Dis. 2021, 68, 2980–2989. [Google Scholar] [CrossRef]
- Chung, H.C.; Nguyen, V.G.; Park, Y.H.; Park, B.K. Genotyping of PCV3 based on reassembled viral gene sequences. Vet. Med. Sci. 2021, 7, 474–482. [Google Scholar] [CrossRef]
- Prinz, C.; Stillfried, M.; Neubert, L.K.; Denner, J. Detection of PCV3 in German wild boars. Virol. J. 2019, 16, 25. [Google Scholar] [CrossRef] [PubMed]
- Molossi, F.A.; de Cecco, B.S.; de Almeida, B.A.; Henker, L.C.; Da Silva, M.S.; Mósena, A.C.S.; Canal, C.W.; Brandalise, L.; Simão, G.M.R.; Vanucci, F.; et al. PCV3-associated reproductive failure in pig herds in Brazil. Trop. Anim. Health Prod. 2022, 54, 293. [Google Scholar] [CrossRef]
- Arruda, B.; Piñeyro, P.; Derscheid, R.; Hause, B.; Byers, E.; Dion, K.; Long, D.; Sievers, C.; Tangen, J.; Williams, T.; et al. PCV3-associated disease in the United States swine herd. Emerg. Microbes Infect. 2019, 8, 684–698. [Google Scholar] [CrossRef] [PubMed]
- Fanelli, A.; Pellegrini, F.; Camero, M.; Catella, C.; Buonavoglia, D.; Fusco, G.; Martella, V.; Lanave, G. Genetic Diversity of Porcine Circovirus Types 2 and 3 in Wild Boar in Italy. Animals 2022, 12, 953. [Google Scholar] [CrossRef] [PubMed]
- Klaumann, F.; Franzo, G.; Sohrmann, M.; Correa-Fiz, F.; Drigo, M.; Nunez, J.I.; Sibila, M.; Segales, J. Retrospective detection of Porcine circovirus 3 (PCV-3) in pig serum samples from Spain. Transbound. Emerg. Dis. 2018, 65, 1290–1296. [Google Scholar] [CrossRef] [PubMed]
- Hayashi, S.; Ohshima, Y.; Furuya, Y.; Nagao, A.; Oroku, K.; Tsutsumi, N.; Sasakawa, C.; Sato, T. First detection of porcine circovirus type 3 in Japan. J. Vet. Med. Sci. 2018, 80, 1468–1472. [Google Scholar] [CrossRef] [PubMed]
- Yuzhakov, A.G.; Raev, S.A.; Alekseev, K.P.; Grebennikova, T.V.; Verkhovsky, O.A.; Zaberezhny, A.D.; Aliper, T.I. First detection and full genome sequence of porcine circovirus type 3 in Russia. Virus Genes 2018, 54, 608–611. [Google Scholar] [CrossRef]
- Li, G.; He, W.; Zhu, H.; Bi, Y.; Wang, R.; Xing, G.; Zhang, C.; Zhou, J.; Yuen, K.; Gao, G.F.; et al. Origin, Genetic Diversity, and Evolutionary Dynamics of Novel Porcine Circovirus 3. Adv. Sci. 2018, 5, 1800275. [Google Scholar] [CrossRef] [PubMed]
- Franzo, G.; He, W.; Correa-Fiz, F.; Li, G.; Legnardi, M.; Su, S.; Segales, J. A Shift in Porcine Circovirus 3 (PCV-3) History Paradigm: Phylodynamic Analyses Reveal an Ancient Origin and Prolonged Undetected Circulation in the Worldwide Swine Population. Adv. Sci. 2019, 6, 1901004. [Google Scholar] [CrossRef]
- Ouyang, T.; Zhang, X.; Liu, X.; Ren, L. Co-Infection of Swine with Porcine Circovirus Type 2 and Other Swine Viruses. Viruses 2019, 11, 185. [Google Scholar] [CrossRef] [PubMed]
- Eclercy, J.; Larcher, T.; Andraud, M.; Renson, P.; Bernard, C.; Bigault, L.; Ledevin, M.; Paboeuf, F.; Grasland, B.; Rose, N.; et al. PCV2 co-infection does not impact PRRSV MLV1 safety but enhances virulence of a PRRSV MLV1-like strain in infected SPF pigs. Vet. Microbiol. 2020, 244, 108656. [Google Scholar] [CrossRef] [PubMed]
- Guo, Z.; Ruan, H.; Qiao, S.; Deng, R.; Zhang, G. Co-infection status of porcine circoviruses (PCV2 and PCV3) and porcine epidemic diarrhea virus (PEDV) in pigs with watery diarrhea in Henan province, central China. Microb. Pathog. 2020, 142, 104047. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Shi, B.J.; Huang, X.G.; Peng, M.Y.; Zhang, X.M.; He, D.N.; Pang, R.; Zhou, B.; Chen, P.Y. A multiplex RT-PCR assay for rapid and differential diagnosis of four porcine diarrhea associated viruses in field samples from pig farms in East China from 2010 to 2012. J. Virol. Methods 2013, 194, 107–112. [Google Scholar] [CrossRef] [PubMed]
- Jung, K.; Kim, J.; Ha, Y.; Choi, C.; Chae, C. The effects of transplacental porcine circovirus type 2 infection on porcine epidemic diarrhoea virus-induced enteritis in preweaning piglets. Vet. J. 2006, 171, 445–450. [Google Scholar] [CrossRef]
- Opriessnig, T.; Halbur, P.G. Concurrent infections are important for expression of porcine circovirus associated disease. Virus Res. 2012, 164, 20–32. [Google Scholar] [CrossRef]
- Wang, Q.; Zhou, H.; Hao, Q.; Li, M.; Liu, J.; Fan, H. Coinfection with porcine circovirus type 2 and Streptococcus suis serotype 2 enhances pathogenicity by dysregulation of the immune responses in piglets. Vet. Microbiol. 2020, 243, 108653. [Google Scholar] [CrossRef]
- Xu, T.; Zhang, Y.; Tian, R.; Hou, C.; Li, X.; Zheng, L.; Wang, L.; Chen, H. Prevalence and genetic analysis of porcine circovirus type 2 (PCV2) and type 3 (PCV3) between 2018 and 2020 in central China. Infect. Genet. Evol. 2021, 94, 105016. [Google Scholar] [PubMed]
- Ku, X.; Zhang, C.; Li, P.; Yu, X.; Sun, Q.; Xu, F.; Qian, P.; He, Q. Epidemiological and genetic characteristics of porcine circovirus 3 in 15 provinces and municipalities of China between 2016 and 2020. Virol. J. 2022, 19, 187. [Google Scholar] [CrossRef]
- Qi, S.; Su, M.; Guo, D.; Li, C.; Wei, S.; Feng, L.; Sun, D. Molecular detection and phylogenetic analysis of porcine circovirus type 3 in 21 Provinces of China during 2015–2017. Transbound. Emerg. Dis. 2019, 66, 1004–1015. [Google Scholar] [CrossRef]
- Huang, Y.; Chen, X.; Long, Y.; Yang, L.; Song, W.; Liu, J.; Li, Q.; Liang, G.; Yu, D.; Huang, C.; et al. Epidemiological Analysis From 2018 to 2020 in China and Prevention Strategy of Porcine Circovirus Type 2. Front. Vet. Sci. 2021, 8, 753297. [Google Scholar] [CrossRef] [PubMed]
- Yao, J.; Qin, Y.; Zeng, Y.; Ouyang, K.; Chen, Y.; Huang, W.; Wei, Z. Genetic analysis of porcine circovirus type 2 (PCV2) strains between 2002 and 2016 reveals PCV2 mutant predominating in porcine population in Guangxi, China. BMC Vet. Res. 2019, 15, 118. [Google Scholar] [CrossRef] [PubMed]
- Lv, Q.; Wang, T.; Deng, J.; Chen, Y.; Yan, Q.; Wang, D.; Zhu, Y. Genomic analysis of porcine circovirus type 2 from southern China. Vet. Med. Sci. 2020, 6, 875–889. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.; Qiu, S.; Chen, R.; Zhang, T.; Liang, L.; Wang, M.; Baloch, A.R.; Wang, L.; Zhang, Q.; Yu, S. Molecular detection and phylogenetic analysis of porcine circovirus type 3 in Tibetan pigs on the Qinghai-Tibet Plateau of China. Virol. J. 2022, 19, 64. [Google Scholar] [CrossRef]
- Kwon, T.; Yoo, S.J.; Park, C.; Lyoo, Y.S. Prevalence of novel porcine circovirus 3 in Korean pig populations. Vet. Microbiol. 2017, 207, 178–180. [Google Scholar] [CrossRef]
- Ge, M.; Ren, J.; Xie, Y.; Zhao, D.; Fan, F.; Song, X.; Li, M.; Xiao, C. Prevalence and Genetic Analysis of Porcine Circovirus 3 in China From 2019 to 2020. Front. Vet. Sci. 2021, 8, 773912. [Google Scholar] [CrossRef] [PubMed]
- Xia, D.; Huang, L.; Xie, Y.; Zhang, X.; Wei, Y.; Liu, D.; Zhu, H.; Bian, H.; Feng, L.; Liu, C. The prevalence and genetic diversity of porcine circovirus types 2 and 3 in Northeast China from 2015 to 2018. Arch. Virol. 2019, 164, 2435–2449. [Google Scholar] [CrossRef]
- Trible, B.R.; Kerrigan, M.; Crossland, N.; Potter, M.; Faaberg, K.; Hesse, R.; Rowland, R.R. Antibody recognition of porcine circovirus type 2 capsid protein epitopes after vaccination, infection, and disease. Clin. Vaccine Immunol. 2011, 18, 749–757. [Google Scholar] [CrossRef] [PubMed]
- Alarcon, P.; Rushton, J.; Nathues, H.; Wieland, B. Economic efficiency analysis of different strategies to control post-weaning multi-systemic wasting syndrome and porcine circovirus type 2 subclinical infection in 3-weekly batch system farms. Prev. Vet. Med. 2013, 110, 103–118. [Google Scholar] [CrossRef]
- Alarcon, P.; Rushton, J.; Wieland, B. Cost of post-weaning multi-systemic wasting syndrome and porcine circovirus type-2 subclinical infection in England—An economic disease model. Prev. Vet. Med. 2013, 110, 88–102. [Google Scholar] [CrossRef] [PubMed]
- Saporiti, V.; Huerta, E.; Correa Fiz, F.; Grosse Liesner, B.; Duran, O.; Segalés, J.; Sibila, M. Detection and genotyping of Porcine circovirus 2 (PCV-2) and detection of Porcine circovirus 3 (PCV-3) in sera from fattening pigs of different European countries. Transbound. Emerg. Dis. 2020, 67, 2521–2531. [Google Scholar] [CrossRef]
- Hu, X.; Chen, Z.; Li, Y.; Ding, Z.; Zeng, Q.; Wan, T.; Wu, H. Detection of Porcine Circovirus 1/2/3 and Genetic Analysis of Porcine Circovirus 2 in Wild Boar from Jiangxi Province of China. Animals 2022, 12, 2021. [Google Scholar] [CrossRef]
- Yang, Y.; Xu, T.; Wen, J.; Yang, L.; Lai, S.; Sun, X.; Xu, Z.; Zhu, L. Prevalence and phylogenetic analysis of porcine circovirus type 2 (PCV2) and type 3 (PCV3) in the Southwest of China during 2020-2022. Front. Vet. Sci. 2022, 9, 1042792. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Li, X.; Zhang, L.; Zheng, J.; Yang, L.; Niu, G.; Zhang, H.; Ren, Y.; Qian, J.; Sun, C.; et al. Phylogenetic and Structural Analysis of Porcine Circovirus Type 2 from 2016 to 2021 in Jilin Province, China. Microorganisms 2023, 11, 983. [Google Scholar] [CrossRef]
- Zheng, G.; Lu, Q.; Wang, F.; Xing, G.; Feng, H.; Jin, Q.; Guo, Z.; Teng, M.; Hao, H.; Li, D.; et al. Phylogenetic analysis of porcine circovirus type 2 (PCV2) between 2015 and 2018 in Henan Province, China. BMC Vet. Res. 2020, 16, 6. [Google Scholar] [CrossRef] [PubMed]
- Lv, N.; Zhu, L.; Li, W.; Li, Z.; Qian, Q.; Zhang, T.; Liu, L.; Hong, J.; Zheng, X.; Wang, Y.; et al. Molecular epidemiology and genetic variation analyses of porcine circovirus type 2 isolated from Yunnan Province in China from 2016–2019. BMC Vet. Res. 2020, 16, 96. [Google Scholar]
- Yue, W.; Li, Y.; Zhang, X.; He, J.; Ma, H. Prevalence of Porcine Circoviruses in Slaughterhouses in Central Shanxi Province, China. Front. Vet. Sci. 2022, 9, 820914. [Google Scholar]
- Zhao, D.; Wang, X.; Gao, Q.; Huan, C.; Wang, W.; Gao, S.; Liu, X. Retrospective survey and phylogenetic analysis of porcine circovirus type 3 in Jiangsu province, China, 2008 to 2017. Arch. Virol. 2018, 163, 2531–2538. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.; Huang, Y.; Guo, Y.; Wang, L.; Zhang, Y.; Zhou, L.; Ge, X.; Han, J.; Guo, X.; Yang, H. Prevalence and Evolution Analysis of Porcine Circovirus 3 in China from 2018 to 2022. Animals 2022, 12, 1588. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Xiao, Y.; Li, X.; Li, S.; Xie, N.; Yan, X.; Li, X.; Zhu, J. Development and application of a quadruplex real-time PCR assay for differential detection of porcine circoviruses (PCV1 to PCV4) in Jiangsu province of China from 2016 to 2020. Transbound. Emerg. Dis. 2021, 68, 1615–1624. [Google Scholar] [CrossRef]
- Xu, T.; Hou, C.; Zhang, Y.; Li, H.; Chen, X.; Pan, J.; Chen, H. Simultaneous detection and genetic characterization of porcine circovirus 2 and 4 in Henan province of China. Gene 2022, 808, 145991. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Wang, L.; Li, H.; Zhang, H.; Zheng, L.; Chen, X.; Chen, H. Detection and genetic analysis of porcine circovirus-like virus in pigs with diarrhea between 2016 and 2021 in Henan and Shanxi provinces of China. Arch. Virol. 2023, 168, 76. [Google Scholar] [CrossRef]
- Hou, C.Y.; Zhang, L.H.; Zhang, Y.H.; Cui, J.T.; Zhao, L.; Zheng, L.L.; Chen, H.Y. Phylogenetic analysis of porcine circovirus 4 in Henan Province of China: A retrospective study from 2011 to 2021. Transbound. Emerg. Dis. 2022, 69, 1890–1901. [Google Scholar] [CrossRef] [PubMed]
- Zou, J.; Liu, H.; Chen, J.; Zhang, J.; Li, X.; Long, Y.; Jiang, Y.; Li, W.; Zhou, B. Development of a TaqMan-Probe-Based Multiplex Real-Time PCR for the Simultaneous Detection of Porcine Circovirus 2, 3, and 4 in East China from 2020 to 2022. Vet. Sci. 2022, 10, 29. [Google Scholar] [CrossRef] [PubMed]
- Xu, P.L.; Zhao, Y.; Zheng, H.H.; Tian, R.B.; Han, H.Y.; Chen, H.Y.; Zheng, L.L. Analysis of genetic variation of porcine circovirus type 2 within pig populations in central China. Arch. Virol. 2019, 164, 1445–1451. [Google Scholar] [CrossRef] [PubMed]
- Thangthamniyom, N.; Sangthong, P.; Poolperm, P.; Thanantong, N.; Boonsoongnern, A.; Hansoongnern, P.; Semkum, P.; Petcharat, N.; Lekcharoensuk, P. Genetic diversity of porcine circovirus type 2 (PCV2) in Thailand during 2009–2015. Vet. Microbiol. 2017, 208, 239–246. [Google Scholar] [CrossRef]
- Hou, Z.; Waang, H.; Feng, Y.; Song, M.; Li, Q.; Li, J. Genetic variation and phylogenetic analysis of Porcine circovirus type 2 in China from 2016 to 2018. Acta Virol. 2019, 63, 459–468. [Google Scholar] [CrossRef]
- Yang, S.; Yin, S.; Shang, Y.; Liu, B.; Yuan, L.; Zafar, K.M.; Liu, X.; Cai, J. Phylogenetic and genetic variation analyses of porcine circovirus type 2 isolated from China. Transbound. Emerg. Dis. 2018, 65, e383–e392. [Google Scholar] [CrossRef]
- Segales, J. Best practice and future challenges for vaccination against porcine circovirus type 2. Expert Rev. Vaccines 2015, 14, 473–487. [Google Scholar] [CrossRef] [PubMed]
- Beach, N.M.; Meng, X.J. Efficacy and future prospects of commercially available and experimental vaccines against porcine circovirus type 2 (PCV2). Virus Res. 2012, 164, 33–42. [Google Scholar] [CrossRef] [PubMed]
- Franzo, G.; Segalés, J. Porcine Circovirus 2 Genotypes, Immunity and Vaccines: Multiple Genotypes but One Single Serotype. Pathogens 2020, 9, 1049. [Google Scholar] [CrossRef] [PubMed]
- Wozniak, A.; Milek, D.; Baska, P.; Stadejek, T. Does porcine circovirus type 3 (PCV3) interfere with porcine circovirus type 2 (PCV2) vaccine efficacy? Transbound. Emerg. Dis. 2019, 66, 1454–1461. [Google Scholar] [CrossRef] [PubMed]





| Primers | Sequence 5′–3′ | Product Size (bp) | Purpose | References | 
|---|---|---|---|---|
| PEDV S-F | GGTGTTAAGTTTACGTCCCT | 468 | PEDV detection | |
| PEDV S-R | AAGTGGGACATAGCCAATAC | |||
| PRRSV ORF7-F | CCAGCCAGTCAATCARCTGTG | 292 | PRRSV detection | |
| PRRSV ORF7-R | GCGAATCAGGCGCACWGTATG | |||
| CSFV-F | GCAGAAGCCCACCTCGAGAT | 245 | CSFV detection | |
| CSFV-R | TACACCGGTTCCTCCACTCC | |||
| PRV gE-F | ACGAGCCCCGCTTCCACGCG | 316 | PRV detection | |
| PRV gE-R | CACCGGTCGCCGAGCAGCGG | |||
| PCV2-DF | CACGGATATTGTAGTCCTGG | 500 | PCV2 detection | |
| PCV2-DR | CCGCACCTTCGGATATACTGTC | |||
| PCV3-DF | GATCCACGGAGGTCTGTAGG | 357 | PCV3 detection | [50] | 
| PCV3-DR | CACGTACCCTTGCAAGTGTG | |||
| PCV4-DF | GTTTTTCCCTTCCCCCACATAG | 391 | PCV4 detection | [8] | 
| PCV4-DR | ACAGATGCCAATCAGATCTAGGTAC | |||
| PCV2 C-F | GGGCTGGCTGAACTTTTGAAAGTGAGC | 1767 | Amplify full-length PCV2 genomes | |
| PCV2 C-R | CCAGCCCGCGGAAATTTCTGACAAACG | |||
| PCV3 C1-F | CGGAGGGAAAGCCCGAAAC | 1561 | Amplify full-length PCV3 genomes | [49] | 
| PCV3 C1-R | CGCCTAAACGAATGGGAAACT | |||
| PCV3 C2-F | CCGCATAAGGGTCGTCTTG | 1011 | [6,48] | |
| PCV3 C2-R | TCTTCTCCGCAACTTCAG | |||
| PCV3-F | TTACTTAGAGAACGGACTTGTAACG | 651 | PCV3 Cap gene amplification | [42] | 
| PCV3-R | AAATGAGACACAGAGCTATATTCAG | 
| Cities | Number of Positive Farms (% Out of Total Number of Farms) | Number of Positive Samples (% Out of Total Number of Samples) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| n | PCV2 (%) | PCV3 (%) | PCV4 (%) | Co-Infection (%) | n | PCV2 (%) | PCV3 (%) | PCV4 (%) | Co-Infection (%) | |
| Shaoguan | 3 | 3 (100.00) | 0 (0.00) | 0 | 0 (0.00) | 19 | 17 (89.47) | 0 (0.00) | 0 | 0 (0.00) | 
| Foshan | 36 | 27 (75.00) | 4 (11.11) | 0 | 4 (11.11) | 64 | 43 (67.19) | 9 (14.06) | 0 | 9 (14.06) | 
| Guanzhou | 7 | 5 (71.43) | 2 (28.57) | 0 | 2 (28.57) | 12 | 8 (66.67) | 2 (16.67) | 0 | 2 (16.67) | 
| Maoming | 5 | 4 (80.00) | 0 (0.00) | 0 | 0 (0.00) | 13 | 7 (53.85) | 0 (0.00) | 0 | 0 (0.00) | 
| Jiangmen | 11 | 7 (63.64) | 2 (18.18) | 0 | 2 (18.18) | 30 | 12 (40.00) | 2 (6.67) | 0 | 2 (6.67) | 
| Yangjiang | 6 | 1 (16.67) | 0 (0.00) | 0 | 0 (0.00) | 21 | 5 (23.81) | 0 (0.00) | 0 | 0 (0.00) | 
| Dongguan | 5 | 3 (60.00) | 1 (20.00) | 0 | 1 (20.00) | 9 | 6 (66.67) | 1 (11.11) | 0 | 1 (11.11) | 
| Qingyuan | 6 | 4 (66.67) | 1 (16.67) | 0 | 1 (16.67) | 21 | 9 (42.86) | 3 (14.29) | 0 | 3 (14.29) | 
| Zhongshan | 4 | 2 (50.00) | 0 (0.00) | 0 | 0 (0.00) | 4 | 2 (50.00) | 0 (0.00) | 0 | 0 (0.00) | 
| Total | 83 | 56 (67.47) | 10 (12.05) | 0 | 10 (12.05) | 193 | 109 (56.48) | 17 (8.81) | 0 | 17 (8.81) | 
| Co-Infection Status | Co-Infection Status in 109 PCV2-Positive Samples | |||
|---|---|---|---|---|
| Virus | Positive Number | Percentage | Total Percentage | |
| Dual infections | PCV3 | 10 | 9.17% | 38.53% | 
| PEDV | 15 | 13.76% | ||
| PRRSV | 8 | 7.34% | ||
| PRV | 9 | 8.26% | ||
| Triple infections | PCV3 + PEDV | 1 | 0.92% | 14.68% | 
| PRRSV + CSFV | 1 | 0.92% | ||
| PEDV + PRRSV | 5 | 4.59% | ||
| PEDV + PRV | 4 | 3.67% | ||
| PCV3 + PRRSV | 4 | 3.67% | ||
| PCV3 + PRV | 1 | 0.92% | ||
| Quadruple infections | PCV3 + PEDV + PRRSV | 1 | 0.92% | 1.84% | 
| PEDV + PRRSV + PRV | 1 | 0.92% | ||
| Total | PCV3 | 17 | 15.60% | 55.05% a | 
| PEDV | 26 | 23.85% | ||
| PRRSV | 20 | 18.35% | ||
| CSFV | 1 | 0.92% | ||
| PRV | 10 | 9.17% | ||
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lv, W.; Cao, L.; Yang, L.; Wang, N.; Li, Z.; Huang, S.; Wen, F.; Guo, J. The Prevalence and Genetic Diversity of Porcine Circoviruses (PCVs) during 2017–2023 in Guangdong Province, China. Animals 2023, 13, 3640. https://doi.org/10.3390/ani13233640
Lv W, Cao L, Yang L, Wang N, Li Z, Huang S, Wen F, Guo J. The Prevalence and Genetic Diversity of Porcine Circoviruses (PCVs) during 2017–2023 in Guangdong Province, China. Animals. 2023; 13(23):3640. https://doi.org/10.3390/ani13233640
Chicago/Turabian StyleLv, Wenke, Lihua Cao, Lulu Yang, Nina Wang, Zhili Li, Shujian Huang, Feng Wen, and Jinyue Guo. 2023. "The Prevalence and Genetic Diversity of Porcine Circoviruses (PCVs) during 2017–2023 in Guangdong Province, China" Animals 13, no. 23: 3640. https://doi.org/10.3390/ani13233640
APA StyleLv, W., Cao, L., Yang, L., Wang, N., Li, Z., Huang, S., Wen, F., & Guo, J. (2023). The Prevalence and Genetic Diversity of Porcine Circoviruses (PCVs) during 2017–2023 in Guangdong Province, China. Animals, 13(23), 3640. https://doi.org/10.3390/ani13233640
 
        


 
       