Next Article in Journal
Prenatal Diagnosis of Canine and Feline Twins Using Ultrasound: A Retrospective Study
Previous Article in Journal
Dietary Supplementation with R-(+)-Limonene Improves Growth, Metabolism, Stress, and Antioxidant Responses of Silver Catfish Uninfected and Infected with Aeromonas hydrophila
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Partial Substitution of Whey Protein Concentrate with Spray–Dried Porcine Plasma or Soy Protein Isolate in Milk Replacer Differentially Modulates Ileal Morphology, Nutrient Digestion, Immunity and Intestinal Microbiota of Neonatal Piglets

Key Laboratory for Animal Disease-Resistant Nutrition of China Ministry of Education, Institute of Animal Nutrition, Sichuan Agricultural University, Chengdu 611130, China
*
Author to whom correspondence should be addressed.
Animals 2023, 13(21), 3308; https://doi.org/10.3390/ani13213308
Submission received: 11 September 2023 / Revised: 12 October 2023 / Accepted: 18 October 2023 / Published: 24 October 2023
(This article belongs to the Section Pigs)

Simple Summary

Milk replacer is recommended as an effective substitute when sow milk is insufficient or unavailable to meet the requirements of neonates, and the protein sources of milk replacer are vital for the intestinal maturation and health of neonates. In this study, we investigate the effects of SDPP or SPI partially substituting WPC in milk replacer on the growth performance, ileal morphology, nutrient digestion, immunity and intestinal microbiota of neonatal piglets. Our results confirm the efficacy of SDPP in milk replacer for improving the growth and intestinal health of neonatal piglets.

Abstract

Appropriate protein sources are vital for the growth, development and health of neonates. Twenty–four 2–day–old piglets were randomly divided into three groups and fed isoenergetic and isonitrogenous diets. The experimental diets included a milk replacer with 17.70% whey protein concentrate (WPC group), a milk replacer with 6% spray–dried porcine plasma isonitrogenously substituting WPC (SDPP group), and a milk replacer with 5.13% soy protein isolate isonitrogenously substituting WPC (SPI group). Neonatal piglets were fed milk replacer from postnatal day 2 (PND 2) to day 20 (PND 20). The growth performance, intestinal morphology, activities of digestive enzymes, plasma biochemical parameters, immunity–related genes, short–chain fatty acids (SCFA) and intestinal microbiota in the colonic chyme were determined. The results showed that SDPP–fed piglets had higher final BW (p = 0.05), ADG (p = 0.05) and F/G (p = 0.07) compared with WPC– and SPI–fed piglets, and SDPP–fed piglets had a lower diarrhea index (p < 0.01) from PND 2 to PND 8. SDPP–fed piglets had an increased ileal villus height (p = 0.04) and ratio of villus height to crypt depth (VCR) (p = 0.02), and increased activities of sucrase (p < 0.01), lactase (p = 0.02) and trypsin (p = 0.08) in the jejunum, compared with WPC– and SPI–fed piglets. Furthermore, SPI–fed piglets had an increased mRNA expression of IL-6 (p < 0.01) and concentration of plasma urea (p = 0.08). The results from LEfSe analysis showed that SDPP–fed piglets had a higher abundance of beneficial Butyricicoccus compared with WPC– and SPI–fed piglets, in which higher abundances of pathogenic bacteria such as Marinifilaceae, Fusobacterium and Enterococcus were observed. Moreover, SDPP–fed piglets had an increased concentration of butyric acid (p = 0.08) in the colonic chyme compared with WPC– and SPI–fed piglets. These results suggest that neonatal piglets fed milk replacer with SDPP partially substituting WPC had improved growth performance and intestinal morphology and function, associated with higher digestive enzyme activity and fewer pathogenic bacteria.

1. Introduction

Genetic selection for highly prolific sows has been found to largely increase litter size [1]. However, it is challenging for sows to nurse a number of piglets that exceeds the number of functional teats, which results in higher pre-weaning mortality and poor pig uniformity at weaning [2]. Milk replacer is recommended as an effective dietary strategy when sow milk is unavailable or insufficient to satisfy piglets’ nutritional needs [3]. Studies on optimizing milk replacer using functional additives, such as oligosaccharide [4,5], lactoferrin [6] and β-glucan [7], have been reported, but limited attention has been given to protein sources. Protein is a crucial nutrient for neonates, serving as a vital source of essential amino acids and fundamental bioactive substances for early-stage development [8]. Meanwhile, the digestion and absorption of protein are closely associated with nutritional status and intestinal health [9].
As a dairy–based protein, whey protein concentrate (WPC) has been widely used as a major protein source in milk replacer [10,11]. It has been reported that milk replacer with WPC contributes to the intestinal maturation and health of preterm piglets [12]. As an expensive component, however, dairy-based protein has been partially substituted with wheat or soy proteins in milk replacers for calves [13]. And soy protein–based formula has been reported to maintain the normal growth and development of infants and reduce gastrointestinal symptoms in infants who are intolerant to cows’ milk [14,15,16]. Although soy protein isolate (SPI) is considered an ideal plant–based protein in formula milk, there are concerns regarding the potential negative effects of soy–based protein on digestibility and immune and nervous system development due to insufficient processing for anti-nutritive factors [17,18,19]. To our knowledge, however, very limited data are available on the effects of soy–based protein as a substitute for dairy–based protein in milk replacer on the growth and development of piglets. In contrast, functional proteins could also be considered for improving neonatal growth and maturity. Spray–dried porcine plasma (SDPP) is a high–quality animal–based protein, and is widely used to improve the intestinal health, immunity and growth of weaning piglets due to its enrichment in fibrinogen, immunoglobulins and albumin [20,21,22]. However, the feeding effect of SDPP as a protein source to partially substitute WPC in milk replacer for piglets has not been determined.
In this study, therefore, we aimed to investigate the effects of partially substituting the dairy–based protein WPC in milk replacer with the animal–based protein SDPP or the plant–based protein SPI on the growth performance, intestinal morphology, activity of digestive enzymes, immunity–related parameters, intestinal microbiota composition and metabolites in neonatal piglets.

2. Materials and Methods

2.1. Experimental Design, Animals and Growth Performance

Twenty–four Landrace/Yorkshire crossbred piglets (2 days old) with an average initial body weight of 1.55 ± 0.23 kg, including a mix of females and males, were selected for this experiment. After birth, piglets were allowed to suckle from their respective sows for 48 h prior to being transported to a nursery room, and were housed individually in stainless steel metabolic crates (0.6 × 0.9 × 0.6 m). Piglets were randomly divided into three treatment groups receiving experimental diets, including a milk replacer with 17.70% WPC (WPC group, n = 8), a milk replacer with 6% SDPP isonitrogenously substituting WPC (SDPP group, n = 8), and a milk replacer with 5.13% SPI isonitrogenously substituting WPC (SPI group, n = 8). The nursery room temperature was controlled at 28~31 °C. The intake of milk replacer was converted into dry matter intake using a dry matter–to–water ratio of 1:4, and piglets were weighed individually at the start and end of the study to calculate the average daily feed intake (ADFI), average daily gain (ADG) and ratio of ADFI to ADG (F/G). Visual diarrhea scores were assessed three times daily and the diarrhea index was calculated [23].

2.2. Milk Replacer

The milk replacer’s ingredients and nutrient levels are described in Table 1, and it was formulated to mimic the macronutrient composition of sow milk [24,25,26]. The milk replacer was mixed with 40 °C water at a ratio of 1:4 and added to a milk bucket for storage. It was added 7 times a day to ensure that there was surplus milk in the bucket. The milk was transported from the bucket to the nipple on the metabolism cage, and the piglets could freely drink milk through the nipple until sacrifice on PND 21.

2.3. Sample Collection

Prior to slaughter, milk replacer and water were withheld from piglets for 12 h. Once their final body weight was recorded, blood was collected from the anterior vena cava. Plasma samples were obtained by centrifuging blood samples stored in heparin anticoagulated tubes at 3000× g for 15 min at 4 °C. In order to conduct histological analysis, piglets were anesthetized intramuscularly using 0.5 mL of xylazine and midazolam. Following slaughter, the intestines of piglets were isolated and a 2 cm length piece of the ileum was stored in a 4% paraformaldehyde solution. Tissue samples from the jejunum and ileum were collected and washed in cold saline solution (NaCl 9 g/L, 4 °C). Similarly, chyme samples from the colon were collected, frozen in liquid nitrogen and stored at −80 °C for 16S rRNA sequencing to assess the microbial community composition.

2.4. Histomorphology

Pieces of ileum were fixed in 4% paraformaldehyde solution for histomorphometric analysis. Ileum samples were dehydrated and embedded in paraffin. Sections 5 μm thick, cut using a Leica RM2235 microtome (Leica Microsystems Ltd., Shanghai, China), were stained using the periodic acid–Schiff (PAS) method. Image Pro Plus 6.0 software (Media Cybernetics, Rockville, MD, USA) was used to acquire images and to measure the villus height, the depth of crypts and the area of goblet cells in the tissue.

2.5. Digestive Enzyme Activity

Jejunum samples were homogenized using 4 °C pre–cooled 0.9% saline for further analysis. The protein content of the samples was determined using the Coomassie brilliant blue method, and the test kit was purchased from Nanjing Jiancheng (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The activities of sucrase, maltase, lactase and trypsin were determined according to the instructions for the Nanjing Jiancheng kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The optical density values of disaccharidase and trypsin were measured at 505 nm and 253 nm, respectively, using a SpectraMax190 microplate reader (Molecular Devices Corporation, San Jose, CA, USA); then, the activities of the enzymes were calculated according to the change in absorbance.

2.6. Gene Expressions

Extracted ileal RNA with a concentration of 500~1000 ng/μL was used to synthesize cDNA, according to the instructions for the reverse transcription kit (Vazyme) (RNase-free ddH2O, 4× gDNA Wiper Mix, 5× HiScript III qRT SuperMix). Quantitative PCR (2× ChamQ Universal SYBR qPCR Master Mix, Primer, Template DNA/cDNA, ddH2O) was carried out using the QuantStudio5 instrument (Thermo Fisher Scientific, Waltham, MA, USA). Data were normalized using β-actin and the relative expression was calculated using the 2−ΔΔCt method [27]. The primers used in this experiment are listed in Table 2.

2.7. 16S rRNA Amplicon Sequencing

Colonic chyme samples were used for 16S rRNA amplicon (Novogene Technology Co., Ltd., Beijing, China). Genomic DNA was extracted using either the CTAB or SDS method. Specific primers with barcodes, the Phusion® High–Fidelity PCR Master Mix with GC buffer (New England Biolabs) and high–efficiency high–fidelity enzymes were used to perform PCR. The NEBNext® Ultra™ IIDNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) was utilized for library construction. Then, the constructed library was qualified and sequenced using the NovaSeq6000 instrument (Illumina, San Diego, CA, USA). After careful processing and analysis, the effective tags were obtained and denoised using QIIME2 software (2019.1) to generate ASVs (Amplicon Sequence Variants) and feature tables. The species information for each ASV was determined by comparing it to a database. Finally, QIIME2 software was used to conduct alpha and beta diversity analysis.

2.8. SCFA Analysis

Briefly, 0.5 g of colonic chyme sample and 1.2 mL of ultrapure water were added to a centrifuge tube after thawing, allowed to stand for 30 min and centrifuged at 10,000× g for 15 min. After centrifugation, 0.2 mL of 25% (w/v) metaphosphoric acid and 23.3 μL of 210 mmol/L crotonic acid were added to 1 mL of supernatant, mixed well, and left to stand at 4 °C for 30 min, and then, centrifuged at 8000× g for 10 min. After centrifugation, 0.9 mL of chromatographic methanol (1:3 dilution) was added to 0.3 mL of supernatant, and mixed well. Finally, the supernatant was filtered using a 0.22 μm filter membrane into a 1.5 mL EP tube for later use. SCFA concentrations were measured using GC CP3800 gas chromatography (Varian Medical Systems, Palo Alto, CA, USA).

2.9. Statistical Analysis

The Shapiro–Wilk test and UNIVARIATE procedures of SAS 9.4 (SAS Institute, Inc., Cary, NC, USA) were used to analyze variance homogeneity and normality, respectively. Data were analyzed using one–way analysis of variance (ANOVA), and the LSD method was used for multiple comparisons. Data are presented as mean ± pooled standard error (SEM) and considered significant at p < 0.05 and a tendency at p < 0.10.

3. Results

3.1. Growth Performance

SDPP–fed piglets tended to have a higher final BW (p = 0.05) and ADG (p = 0.05), and lower F/G (p = 0.07), compared with WPC– and SPI–fed piglets (Table 3). SDPP–fed piglets had significantly reduced diarrhea indexes from postnatal day 2 (PND 2) to day 8 (PND 8) compared with WPC– and SPI–fed piglets (Figure 1). No significant difference in ADFI was observed across the treatment groups.

3.2. Ileal Morphology

SDPP–fed piglets had a significantly increased villus height in the ileum compared with WPC– and SPI–fed piglets (Figure 2b). SDPP–fed piglets had a significantly increased ratio of villus height to crypt depth (VCR) compared with WPC–fed piglets (Figure 2b). No significant differences in ileal crypt depth and goblet cell density were observed across the treatment groups.

3.3. Activities of Enzymes

Both WPC– and SDPP–fed piglets had significantly increased activities of sucrase and lactase in the jejunum compared with SPI–fed piglets (Figure 3a,c). SDPP–fed piglets tended to have higher trypsin activity compared with WPC– and SPI–fed piglets (p = 0.08, Figure 3d). No significant difference in the activity of maltase was observed across the treatments.

3.4. Relative mRNA Expressions of Barrier-Function- and Inflammation-Related Genes

SPI–fed piglets had significantly increased mRNA expressions of IL–6 and IL–10 in the ileum compared with WPC– and SDPP–fed piglets (Figure 4b). No significant differences in the mRNA expressions of Occludin, ZO–1, Ocaudin–1, TNF–α and IL–1β were observed across the treatments (Figure 4a,b).

3.5. Plasma Biochemical Parameters

SPI–fed piglets tended to have a higher urea concentration compared with WPC– and SDPP–fed piglets (p = 0.08, Table 4). No significant differences in the concentrations of C3, IgG, GLU, TC, LDL–C, HDL–C, NEFA and TG were observed across the treatments.

3.6. Colonic Microbiome

Venn analysis identified 1244, 1104 and 1219 unique OTUs in the WPC, SDPP and SPI groups, respectively (Figure 5a, Table 5). Firmicutes, Bacteroidetes and Proteobacteria were the three most abundant phyla (Figure 6a). SDPP–fed piglets had lower Proteobacteria (7.73%) compared with WPC– (21.08%) and SPI–fed piglets (28.55%).
LEfSe (LDA Effect Size) is used to find biomarkers with statistical differences across groups. The most abundant phylotypes contributing to the differences across the intestinal microbiota of the WPC, SDPP and SPI groups were found to be f__Marinifilaceae, f__Rikenellaceae, g__JG30_KF_CM66, f__Anaerovoracaceae and g__A21b in the WPC group, g__Butyricicoccus in the SDPP group, and g__Fusobacterium, g__Enterococcus, g__Sumerlaea and f__Rubritaleaceae in the SPI group (Figure 7).

3.7. SCFA Concentrations

SDPP–fed piglets tended to have a higher concentration of butyric acid in the colonic chyme compared with WPC– and SPI–fed piglets (p = 0.08, Table 6). No significant differences in concentrations of acetic acid, propionic acid, isobutyric acid, isovaleric acid, valeric acid and total SCFA were observed across the treatments.

4. Discussion

Whey protein concentrate (WPC) is a commonly used dairy–based protein in milk replacer for piglets [28]. However, the efficacy of the partial substitution of WPC with animal–based or plant–based protein on the growth and intestinal function of piglets needs to be determined.
In the present study, the higher final BW and ADG, and the lower F/G, in SDPP–fed piglets indicated the crucial role of SDPP in improving the growth performance of piglets, which is consistent with previous results from studies that include SDPP in weaning diets in which it increased post–weaning growth rate [29,30,31]. Also, calves fed a milk replacer using SDPP substituting 20% of the WPC had significantly increased feed intake and feed conversion ratios [32]. Meanwhile, the diarrhea index from PND 2 to PND 8 was lower in SDPP–fed piglets, which is consistent with a previous study in which the fecal scores of calves tended to be lower when SDPP was included in the milk replacer [32]. The improvements in SDPP on growth rate and diarrhea index could be associated with improved intestinal function. The intestinal mucosa plays a crucial role in nutrient absorption [33]. Our results showed that SDPP–fed piglets had significantly increased ileal villus height and VCR compared with WPC– and SPI–fed piglets, indicating an expansion of the intestinal epithelial surface area [34], and an improvement in epithelial cell renewal [35,36]. Consistently, the weaned piglets fed an SDPP diet had significantly increased ileal villus height relative to those fed a soybean protein concentrate (SPC) diet [37]. Intestinal enzyme activity can be altered in response to diet as early as the second day after birth [38]. Piglets fed colostrum-containing plasma showed increased activities of sucrase and maltase (50% and 200%, respectively) compared with colostrum-fed piglets [39]. In this study, moreover, SDPP–fed piglets had increased activities of sucrase, lactase and trypsin in the jejunum compared with WPC– and SPI–fed piglets, which suggested that SDPP–fed piglets were favorable for protein and carbohydrate digestion.
In contrast, SPI–fed piglets had the lowest growth rate, which may be associated with poor digestive capability, immunity and bacterial structure. Our study found that SPI–fed piglets had higher plasma urea, indicating a potential increase in protein breakdown or lower protein utilization, because urea is the main end product of amino acid and protein metabolism, which is negatively correlated with amino acid utilization and protein retention [40]. Immunity is crucial for the intestinal health of neonates. The dynamic changes in levels of pro–inflammatory factor IL–6 and anti-inflammatory factor IL–10 play an important role in regulating the inflammatory response system. In this study, both IL–6 and IL–10 were over-expressed in the ileum of SPI–fed piglets. This finding seems paradoxical considering the anti–inflammatory effects of IL–10. However, previous research has found that an increased level of IL–10 is a protective mechanism for the body against the release of a large number of pro–inflammatory cytokines [41]. In addition, elevated IL–6 can also stimulate the release of IL–10 in local tissues [42]. Therefore, we speculated that feeding milk replacer including SPI may pose a challenge to the intestinal immunity of neonatal piglets.
The normal intestinal microbiota is essential for intestinal homeostasis [43]. Dietary protein is the preferred substrate for the intestinal microbiota and affects the composition and metabolic activity of microbiota [44]. In this study, LEfSe analysis found that microbiota composition was significantly different across the WPC, SDPP and SPI groups. At the phylum level, Firmicutes, Bacteroidetes and Proteobacteria were the most abundant bacterial phyla in the colonic chyme. SDPP-fed piglets had lower Proteobacteria levels compared with WPC– or SPI–fed piglets. Interestingly, previous research demonstrated that breast–fed infants had lower Proteobacteria levels (3.29%) compared with formula–fed infants (13.85%) [45]. Furthermore, Proteobacteria has been linked to inflammation and intestinal dysbiosis [46,47]. In this study, moreover, the abundance of Butyricicoccus, a high butyrate–producing probiotic [48], was increased in SDPP–fed piglets, which also explains the increased concentration of butyrate in SDPP–fed piglets. As a short–chain fatty acid, butyrate not only provides energy for colonic cells, but also inhibits the expression of pro–inflammatory cytokines [49]. In addition, the abundance of some pathogenic bacteria, such as Marinifilaceae, Fusobacterium and Enterococcus, was increased in the colonic chyme of WPC– and SPI–fed piglets. It has been reported that Marinifilaceae was enriched in the lumen of colitis and infection animal models [50,51]. One member of Fusobacterium, F. nucleatum has been recognized as an opportunistic pathogen that plays an important role in intestinal diseases, which promotes the inflammatory response and induces the release of the pro–inflammatory cytokines IL–6 and IL–8 [52,53,54]. This finding may explain the over-expression of IL–6 in SPI–fed piglets.

5. Conclusions

The use of SDPP to partially substitute WPC in milk replacer improved the growth performance and intestinal function of piglets, associating with increased activities of digestive enzymes, decreased expressions of inflammatory genes, and the lower presence of pathogenic bacteria compared with the WPC and SPI groups. However, further research is needed to investigate the long-term implications of these outcomes.

Author Contributions

Y.Z. (Yuwei Zhang), Q.Z. and L.C. designed the experiments. Y.Z. (Yuwei Zhang), S.L. and X.Q. performed the experiments. Z.F., Y.L., S.X., B.F., Y.Z. (Yong Zhuo), D.W. and L.C. analyzed the experimental data. Y.Z. (Yuwei Zhang) and L.C. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the project of the Sichuan Science and Technology Program (No 2021ZDZX0011), the project of the China Agriculture Research System (CARS-35), and the Central Government Funds of Guiding Local Scientific and Technological Development (grant 2022ZYDF036).

Institutional Review Board Statement

The animal experiments were approved by the Animal Care and Use Committee of the Animal Nutrition Institute of Sichuan Agricultural University (permit number DKYB20131704) and were carried out in accordance with the Ministry of Science and Technology in China’s Guide for the Care and Use of Laboratory Animals.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article.

Acknowledgments

We would like to thank the staff at our laboratory for their ongoing assistance.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Kobek-Kjeldager, C.; Moustsen, C.; Theil, V.A.; Pedersen, P.K.; Lene, J. Effect of litter size, milk replacer and housing on behaviour and welfare related to sibling competition in litters from hyper-prolific sows. Appl. Anim. Behav. Sci. 2020, 230, 105032. [Google Scholar] [CrossRef] [Scilit]
  2. Kobek-Kjeldager, C.; Moustsen, V.A.; Pedersen, L.J.; Theil, P.K. Impact of litter size, supplementary milk replacer and housing on the body composition of piglets from hyper-prolific sows at weaning. Animal 2020, 15, 100007–100008. [Google Scholar] [CrossRef] [Scilit]
  3. Roggero, P.; Liotto, N.; Pozzi, C.; Braga, D.; Troisi, J.; Menis, C.; Giannì, M.L.; Canani, R.B.; Paparo, L.; Nocerino, R.; et al. Analysis of immune, microbiota and metabolome maturation in infants in a clinical trial of Lactobacillus paracasei CBA L74-fermented formula. Nat. Commun. 2020, 11, 2703–2704. [Google Scholar] [CrossRef] [Scilit]
  4. Herfel, T.M.; Jacobi, S.K.; Lin, X.; Walker, D.C.; Jouni, Z.E.; Odle, J. Safety evaluation of polydextrose in infant formula using a suckling piglet model. Food Chem. Toxicol. 2009, 47, 1530–1537. [Google Scholar] [CrossRef] [Scilit]
  5. Li, M.; Bauer, L.L.; Chen, X.; Wang, M.; Kuhlenschmidt, T.B.; Kuhlenschmidt, M.S.; Fahey, G.C., Jr.; Donovan, S.M. Microbial Composition and In Vitro Fermentation Patterns of Human Milk Oligosaccharides and Prebiotics Differ between Formula-Fed and Sow-Reared Piglets. J. Nutr. 2012, 142, 681–689. [Google Scholar] [CrossRef] [Scilit]
  6. Wang, W.; Cheng, Z.; Wang, X.; An, Q.; Huang, K.; Dai, Y.; Meng, Q.; Zhang, Y. Lactoferrin, a Critical Player in Neonate Intestinal Development: RHLF may be a Good Choice in Formula. J. Agric. Food Chem. 2021, 69, 8726–8736. [Google Scholar] [CrossRef] [Scilit]
  7. Li, F.; Jin, X.; Liu, B.; Zhuang, W.; Scalabrin, D. Follow-up formula consumption in 3- to 4-year-olds and respiratory infections: An RCT. Pediatrics 2014, 133, 1533–1540. [Google Scholar] [CrossRef] [Scilit]
  8. Li, Y.; Han, Y.; Zhao, Q.; Tang, C.; Zhang, J.; Qin, Y. Fermented Soy and Fish Protein Dietary Sources Shape Ileal and Colonic Microbiota, Improving Nutrient Digestibility and Host Health in a Piglet Model. Front. Microbiol. 2022, 13, 911500–911501. [Google Scholar] [CrossRef] [Scilit]
  9. Gan, J.; Bornhorst, G.M.; Henrick, B.M.; German, J.B. Protein Digestion of Baby Foods: Study Approaches and Implications for Infant Health. Mol. Nutr. Food Res. 2018, 62, 10–11. [Google Scholar] [CrossRef] [Scilit]
  10. Xu, T.; Chen, J.; Yang, K.; Qiao, W.; Zhao, J.; Chen, L. Quantitative Determination of Whey Protein to Casein Ratio in Infant Formula Milk Powder. Front. Chem. 2022, 10, 872251–872252. [Google Scholar] [CrossRef] [Scilit]
  11. Castenmiller, J.; Hirsch-Ernst, K.; Kearney, J.; Knutsen, H.K.; Maciuk, A.; Mangelsdorf, I.; McArdle, H.J.; Naska, A.; Pelaez, C.; Pentieva, K.; et al. Efficacy of an infant formula manufactured from a specific protein hydrolysate derived from whey protein isolate and concentrate produced by Société des Produits Nestlé S.A. in reducing the risk of developing atopic dermatitis. EFSA J. 2021, 19, e06603–e06604. [Google Scholar] [PubMed]
  12. Li, Y.; Nguyen, D.N.; Obelitz-Ryom, K.; Andersen, A.D.; Thymann, T.; Chatterton, D.E.W.; Purup, S.; Heckmann, A.B.; Bering, S.B.; Sangild, P.T. Bioactive Whey Protein Concentrate and Lactose Stimulate Gut Function in Formula-Fed Preterm Pigs. J. Pediatr. Gastroenterol. Nutr. 2018, 66, 128–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Huang, K.; Tu, Y.; Bingwen, S.; Guishan, X.; Diao, Q. Effects of protein sources for milk replacers on growth performance and serum biochemical indexes of suckling calves. Anim. Nutr. J. 2015, 1, 349–355. [Google Scholar] [CrossRef] [Scilit]
  14. Lasekan, J.B.; Ostrom, K.M.; Jacobs, J.R.; Blatter, M.M.; Ndife, L.I.; Gooch, W.M., 3rd; Cho, S. Growth of newborn, term infants fed soy formulas for 1 year. Clin. Pediatr. 1999, 38, 563–571. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Hoffman, D.; Ekhard Ziegler, E.; Mitmesser, S.H.; Harris, C.L.; Diersen-Schade, D.A. Soy-based infant formula supplemented with DHA and ARA supports growth and increases circulating levels of these fatty acids in infants. Lipids 2008, 43, 29–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Lasekan, J.B.; Baggs, G.E. Efficacy of Soy-Based Formulas in Alleviating Gastrointestinal Symptoms in Infants with Milk-Based Formula Intolerance: A Randomized Clinical Trial. Clin. Pediatr. 2021, 60, 184–192. [Google Scholar] [CrossRef] [Scilit]
  17. Bhatia, J.; Greer, F. Use of Soy Protein-Based in Infant Feeding. Pediatrics 2008, 121, 1062–1068. [Google Scholar] [CrossRef] [Scilit]
  18. Andres, A.; Casey, P.H.; Cleves, M.A.; Badger, T.M. Body Fat and Bone Mineral Content of Infants Fed Breast Milk, Cow’s Milk Formula, or Soy Formula during the First Year of Life. J. Pediatr. 2013, 163, 49–54. [Google Scholar] [CrossRef] [Scilit]
  19. Wood, D. Milk Replacer Ingredients: What and Why? Vet. Clin. North Am.-Food Anim. Pract. 2022, 38, 133–152. [Google Scholar] [CrossRef] [Scilit]
  20. Rosell-Cardona, C.; Grian-Ferré, C.; Pérez-Bosque, A.; Polo, J.; Pallàs, M.; Amat, C.; Moretó, M.; Miró, L. Dietary Spray-Dried Porcine Plasma Reduces Neuropathological Alzheimer’s Disease Hallmarks in SAMP8 Mice. Nutrients 2021, 13, 2369. [Google Scholar] [CrossRef] [Scilit]
  21. Pérez-Bosque, A.; Miró, L.; Amat, C.; Polo, J.; Moretó, M. The Anti-Inflammatory Effect of Spray-Dried Plasma Is Mediated by a Reduction in Mucosal Lymphocyte Activation and Infiltration in a Mouse Model of Intestinal Inflammation. Nutrients 2016, 8, 657. [Google Scholar] [CrossRef] [Scilit]
  22. Pierce, J.L.; Cromwell, G.L.; Lindemann, M.D.; Russell, L.E.; Weaver, E.M. Effects of spray-dried animal plasma and immunoglobulins on performance of early weaned pigs. J. Anim. Sci. 2005, 83, 2876–2885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Li, Y.; Liu, Y.; Wu, J.; Chen, Q.; Zhou, Q.; Wu, F.; Zhang, R.; Fang, Z.; Lin, Y.; Xu, S.; et al. Comparative effects of enzymatic soybean, fish meal and milk powder in diets on growth performance, immunological parameters, SCFAs production and gut microbiome of weaned piglets. J. Anim. Sci. Biotechnol. 2021, 12, 106. [Google Scholar] [CrossRef] [Scilit]
  24. Nuntapaitoon, M.; Juthamanee, P.; Theil, P.K.; Tummaruk, P. Impact of sow parity on yield and composition of colostrum and milk in Danish Landrace × Yorkshire crossbred sows. Prev. Vet. Med. 2020, 181, 105085–105086. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Inoue, R.; Tsukahara, T. Composition and physiological functions of the porcine colostrum. Anim. Sci. J. 2021, 92, e13618–e13619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Krogh, U.; Bruun, T.S.; Poulsen, J.; Theil, P.K. Impact of fat source and dietary fibers on feed intake, plasma metabolites, litter gain and the yield and composition of milk in sows. Animal 2017, 11, 975–983. [Google Scholar] [CrossRef] [Scilit]
  27. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
  28. Navis, M.; Muncan, V.; Sangild, P.T.; Willumsen, L.M.; Koelink, P.J.; Wildenberg, M.E.; Abrahamse, E.; Thymann, T.; van Elburg, R.M.; Renes, I.B. Beneficial Effect of Mildly Pasteurized Whey Protein on Intestinal Integrity and Innate Defense in Preterm and Near-Term Piglets. Nutrients 2020, 12, 1125. [Google Scholar] [CrossRef] [Scilit]
  29. Zhao, J.; Harper, A.F.; Estienne, M.J.; Webb, K.E., Jr.; McElroy, A.P.; Denbow, D.M. Growth performance and intestinal morphology responses in early weaned pigs to supplementation of antibiotic-free diets with an organic copper complex and spray-dried plasma protein in sanitary and nonsanitary environments. J. Anim. Sci. 2007, 85, 1302–1310. [Google Scholar] [CrossRef] [Scilit]
  30. Torrallardona, D.; Conde, R.; Esteve-Garca, E.; Brufau, J. Use of spray dried animal plasma as an alternative to antimicrobial medication in weanling pigs. Anim. Feed. Sci. Technol. 2002, 99, 119–129. [Google Scholar] [CrossRef] [Scilit]
  31. Tran, H.; Bundy, J.W.; Li, Y.S.; Carney-Hinkle, E.E.; Miller, P.S.; Burkey, T.E. Effects of spray-dried porcine plasma on growth performance, immune response, total antioxidant capacity, and gut morphology of nursery pigs. J. Anim. Sci. 2014, 92, 4494–4504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Quigley, J.D.; Wolfe, T.M. Effects of Spray-Dried Animal Plasma in Calf Milk Replacer on Health and Growth of Dairy Calves. J. Dairy Sci. 2003, 86, 586–592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Houshmand, M.; Azhar, K.; Zulkifli, I.; Bejo, M.H.; Kamyab, A. Effects of non-antibiotic feed additives on performance, immunity and intestinal morphology of broilers fed different levels of protein. South Afr. J. Anim. Sci. 2012, 42, 22–32. [Google Scholar] [CrossRef] [Scilit]
  34. Xu, Z.R.; Hu, C.H.; Xia, M.S.; Zhan, X.A.; Wang, M.Q. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci. 2003, 82, 1030–1036. [Google Scholar] [CrossRef] [Scilit]
  35. Pluske, J.R.; Thompson, M.J.; Atwood, C.S.; Bird, P.H.; Williams, I.H.; Hartmann, P.E. Maintenance of villus height and crypt depth, and enhancement of disaccharide digestion and monosaccharide absorption, in piglets fed on cows’ whole milk after weaning. Br. J. Nutr. 1996, 76, 409–422. [Google Scholar] [CrossRef] [Scilit]
  36. Segawa, S.; Fujiya, M.; Konishi, H.; Ueno, N.; Kobayashi, N.; Shigyo, T.; Kohgo, Y. Probiotic-Derived Polyphosphate Enhances the Epithelial Barrier Function and Maintains Intestinal Homeostasis through Integrin–p38 MAPK Pathway. PLoS ONE 2011, 6, e23278–e23279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Che, L.; Hu, L.; Zhou, Q.; Peng, X.; Liu, Y.; Luo, Y.; Fang, Z.; Lin, Y.; Xu, S.; Feng, B.; et al. Microbial insight into dietary protein source affects intestinal function of pigs with intrauterine growth retardation. Eur. J. Nutr. 2020, 59, 327–344. [Google Scholar] [CrossRef] [Scilit]
  38. Amdi, C.; Pedersen, M.L.M.; Klaaborg, J.; Myhill, L.J.; Engelsmann, M.N.; Williams, A.R.; Thymann, T. Pre-weaning adaptation responses in piglets fed milk replacer with gradually increasing amounts of wheat. Br. J. Nutr. 2021, 126, 375–382. [Google Scholar] [CrossRef] [Scilit]
  39. Jensen, A.R.; Elnif, J.; Burrin, D.G.; Sangild, P.T. Development of Intestinal Immunoglobulin Absorption and Enzyme Activities in Neonatal Pigs Is Diet Dependent. J. Nutr. 2001, 131, 3259–3265. [Google Scholar] [CrossRef] [Scilit]
  40. Krone, J.E.C.; Agyekum, A.K.; Borgh, M.T.; Hamonic, K. Characterization of urea transport mechanisms in the intestinal tract of growing pigs. Am. J. Physiol.-Gastrointest. Liver Physiol. 2019, 317, G839–G844. [Google Scholar] [CrossRef] [Scilit]
  41. Ishii, Y.; Schuessler, R.B.; Gaynor, S.L.; Hames, K. Postoperative atrial fibrillation: The role of the inflammatory response. J. Thorac. Cardiovasc. Surg. 2017, 153, 1357–1365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Yang, J.; Hooper, W.C.; Phillips, D.J.; Talkington, D.F. Regulation of Proinflammatory Cytokines in Human Lung Epithelial Cells Infected with Mycoplasma pneumoniae. Infect. Immun. 2002, 70, 3649–3655. [Google Scholar] [CrossRef] [Scilit]
  43. Takakuwa, A.; Nakamura, K.; Kikuchi, M.; Sugimoto, R. Butyric Acid and Leucine Induce α-Defensin Secretion from Small Intestinal Paneth Cells. Nutrients 2019, 11, 2817. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Heinritz, S.N.; Weiss, E.; Eklund, M.; Aumiller, T.; Louis, S.; Rings, A.; Messner, S.; Camarinha-Silva, A.; Seifert, J.; Bischoff, S.C.; et al. Intestinal Microbiota and Microbial Metabolites Are Changed in a Pig Model Fed a High-Fat/Low-Fiber or a Low-Fat/High-Fiber Diet. PLoS ONE 2016, 11, e0154329–e0154330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Lee, S.A.; Lim, J.Y.; Kim, B.S.; Cho, S.J.; Kim, N.Y.; Kim, O.B.; Kim, Y. Comparison of the gut microbiota profile in breast-fed and formula-fed Korean infants using pyrosequencing. Nutr. Res. Pract. 2015, 9, 242–248. [Google Scholar] [CrossRef] [Scilit]
  46. Sim, W.H.; Wagner, J.; Cameron, D.J.; Catto-Smith, A.G.; Bishop, R.F.; Kirkwood, C.D. Novel Burkholderiales 23S rRNA genes identified in ileal biopsy samples from children: Preliminary evidence that a subtype is associated with perianal Crohn’s disease. J. Clin. Microbiol. 2010, 48, 1939–1942. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Mukhopadhya, I.; Hansen, R.; El-Omar, E.M.; Hold, G.L. IBD-what role do Proteobacteria play? Nat. Rev. Gastroenterol. Hepatol. 2012, 9, 219–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Wang, Y.C.; Ku, W.C.; Liu, C.Y.; Cheng, Y.C. Supplementation of Probiotic Butyricicoccus pullicaecorum Mediates Anticancer Effect on Bladder Urothelial Cells by Regulating Butyrate-Responsive Molecular Signatures. Diagnostics 2021, 11, 2270. [Google Scholar] [CrossRef] [Scilit]
  49. Devriese, S.; Eeckhaut, V.; Geirnaert, A.; Bossche, L.V.D. Reduced Mucosa-associated Butyricicoccus Activity in Patients with Ulcerative Colitis Correlates with Aberrant Claudin-1 Expression. J. Crohn’s Colitis 2017, 11, 229–236. [Google Scholar] [CrossRef] [Scilit]
  50. Yu, Y.; Yang, W.; Yu, T.; Zhao, X.; Zhou, Z.; Yu, Y.; Xiong, L.; Yang, H.; Bilotta, A.J.; Yao, S.; et al. Glucose promotes regulatory T cell differentiation to maintain intestinal homeostasis. iScience 2022, 25, 105004–105005. [Google Scholar] [CrossRef] [Scilit]
  51. Xu, F.; Cheng, R.; Miao, S.; Zhu, Y.; Sun, Z.; Qiu, L.; Yang, J.; Zhou, L. Prior Toxoplasma Gondii Infection Ameliorates Liver Fibrosis Induced by Schistosoma Japonicum through Inhibiting Th2 Response and Improving Balance of Intestinal Flora in Mice. Int. J. Mol. Sci. 2020, 21, 2711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Ahn, S.H.; Cheon, S.; Park, C.; Lee, J.H.; Lee, S.W.; Lee, S.A. Correction: Transcriptome profiling analysis of senescent gingival fibroblasts in response to Fusobacterium nucleatum infection. PLoS ONE 2018, 13, e0191209–e0191210. [Google Scholar] [CrossRef] [Scilit]
  53. Bhattacharyya, S.; Ghosh, S.K.; Shokeen, B.; Eapan, B.; Lux, R.; Kiselar, J.; Nithianantham, S.; Young, A.; Pandiyan, P.; McCormick, T.S.; et al. FAD-I, a Fusobacterium nucleatum Cell Wall-Associated Diacylated Lipoprotein that Mediates Human Beta Defensin 2 Induction through Toll-Like Receptor-1/2 (TLR-1/2) and TLR-2/6. Infect. Immun. 2016, 84, 1446–1456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Swidsinski, A.; Dörffel, Y.; Baucke, V.L.; Theissig, F.; Rückert, J.C.; Ismail, M.; Rau, W.A.; Gaschler, D.; Weizenegger, M.; Kühn, S.; et al. Acute appendicitis is characterised by local invasion with Fusobacterium nucleatum/necrophorum. Gut 2011, 60, 34–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Effect of protein sources of milk replacer on diarrhea index of piglets. PND, postnatal day. Values are presented as mean ± standard error (n = 8). ab Means marked with the same letter do not significantly differ (p > 0.05).
Figure 1. Effect of protein sources of milk replacer on diarrhea index of piglets. PND, postnatal day. Values are presented as mean ± standard error (n = 8). ab Means marked with the same letter do not significantly differ (p > 0.05).
Animals 13 03308 g001
Figure 2. Effect of protein sources of milk replacer on ileal morphology of piglets. Values are presented as mean ± standard error (n = 8). (a) Representative images of ileum villus height and crypt depth in WPC–, SDPP– and SPI–fed piglets. The sections were stained using the periodic acid–Schiff (PAS) staining method. (b) Ileum statistical analysis for goblet cell density, villus height, crypt depth and VCR. ab Means marked with the same letter do not significantly differ (p > 0.05).
Figure 2. Effect of protein sources of milk replacer on ileal morphology of piglets. Values are presented as mean ± standard error (n = 8). (a) Representative images of ileum villus height and crypt depth in WPC–, SDPP– and SPI–fed piglets. The sections were stained using the periodic acid–Schiff (PAS) staining method. (b) Ileum statistical analysis for goblet cell density, villus height, crypt depth and VCR. ab Means marked with the same letter do not significantly differ (p > 0.05).
Animals 13 03308 g002
Figure 3. Effect of protein sources of milk replacer on activities of trypsin and disaccharidase across the jejunum. (a) Sucrase; (b) maltase; (c) lactase; (d) trypsin. Values are presented as mean ± standard error. ab Means marked with the same letter do not significantly differ (p > 0.05).
Figure 3. Effect of protein sources of milk replacer on activities of trypsin and disaccharidase across the jejunum. (a) Sucrase; (b) maltase; (c) lactase; (d) trypsin. Values are presented as mean ± standard error. ab Means marked with the same letter do not significantly differ (p > 0.05).
Animals 13 03308 g003
Figure 4. The relative mRNA expressions of barrier–function– and inflammation–related genes in the ileum. (a) Relative mRNA expression of barrier genes; (b) relative mRNA expression of inflammatory genes. Values are presented as mean ± standard error (n = 8). ab Means marked with the same letter do not significantly differ (p > 0.05).
Figure 4. The relative mRNA expressions of barrier–function– and inflammation–related genes in the ileum. (a) Relative mRNA expression of barrier genes; (b) relative mRNA expression of inflammatory genes. Values are presented as mean ± standard error (n = 8). ab Means marked with the same letter do not significantly differ (p > 0.05).
Animals 13 03308 g004
Figure 5. Comparison of colon microbiomes. (a) Venn diagram; (b) weighted UniFrac principal co–ordinate analysis (PCoA).
Figure 5. Comparison of colon microbiomes. (a) Venn diagram; (b) weighted UniFrac principal co–ordinate analysis (PCoA).
Animals 13 03308 g005
Figure 6. Relative abundance of colon microbiome at phylum (a) and genus (b) level in WPC–, SDPP– and SPI–fed piglets.
Figure 6. Relative abundance of colon microbiome at phylum (a) and genus (b) level in WPC–, SDPP– and SPI–fed piglets.
Animals 13 03308 g006aAnimals 13 03308 g006b
Figure 7. Biomarkers with statistically significant differences across groups were found via LEfSe analysis, illustrated in an evolutionary branch diagram.
Figure 7. Biomarkers with statistically significant differences across groups were found via LEfSe analysis, illustrated in an evolutionary branch diagram.
Animals 13 03308 g007
Table 1. Ingredients and nutrient levels for neonatal piglets fed milk replacers from PND 2 to PND 20.
Table 1. Ingredients and nutrient levels for neonatal piglets fed milk replacers from PND 2 to PND 20.
WPCSDPPSPI
Ingredients%%%
Whey powder12.1711.1812.95
Whole milk powder10.0010.0010.00
Skim milk powder24.0024.0024.00
Whey protein concentrate, 73% CP 117.7011.9211.05
Plasma protein powder, 72% CP 2-6.00-
Soy protein isolate, 83% CP 3--5.13
Oil powder25.0025.7025.00
Sucrose5.005.005.00
L-lysine hydrochloride-0.100.36
DL-methionine0.340.370.50
L-threonine--0.15
L-tryptophan-0.020.05
Calcium hydrogen phosphate1.941.481.84
Calcium formate0.200.580.32
Choline chloride, AR0.080.080.08
Vitamin premix 40.030.030.03
Mineral premix 50.020.020.02
Antioxidants0.020.020.02
Citric acid3.503.503.50
Total100.00100.00100.00
Nutrient levels, calculated
Digestible energy, Mcal/kg4.264.264.26
Crude protein, %25.0225.0325.03
Ether extract, %16.1316.4216.07
Lactose, %28.0227.0328.19
Calcium, %1.001.001.00
Total phosphorus, %0.710.710.71
Total lysine, %2.562.562.56
Total methionine, %0.950.911.03
Total methionine + cystine, %1.421.421.42
Total threonine, %1.571.581.57
Total tryptophan, %0.460.460.46
1 WPC, DE: 4.17 Mcal/kg, CP: 73% (Fonterra Co–operative Group, Ltd., Auckland, New Zealand). 2 SDPP, DE: 3.74 Mcal/kg, CP: 72% (American Protein Corporation., Ankeny, IA, USA). 3 SPI, DE: 4.15 Mcal/kg, CP: 83% (Mountain Pine Biological Products Co., Ltd., Linyi City, China). 4 Provided per kg of diet: VA 15,000 IU; VD3 5000 IU; VE 40 IU; VK3 5.00 mg; VB1 5.00 mg; VB2 12.50 mg; VB6 6.00 mg; VB12 0.06 mg; D–biotin 0.25 mg; D–pantothenic acid 25.00 mg; folic acid 2.50 mg; nicotinamide 50.00 mg. 5 Provided per kg of diet: Zn 100 mg; Cu 6 mg; Fe 100 mg; Mn 4 mg; I 0.14 mg; Se 0.3 mg.
Table 2. Primer sequences of the target and reference genes.
Table 2. Primer sequences of the target and reference genes.
GenesPrimer Sequence (5′–3′)Product (bp)GenBank Accession
IL–6F: TGCAGTCACAGAACGAGTGG116NM_214399.1
R: CAGGTGCCCCAGCTACATTAT
IL–10F: AATCTGCTCCAAGGTTCCCG224NM_214041.1
R: TGAACACCATAGGGCACACC
IL–1βF: TCTGCCCTGTACCCCAACTG64NM_214055.1
R: CCAGGAAGACGGGCTTTTG
TNF–aF: CCACGTTGTAGCCAATGTCA395NM_214022.1
R: CAGCAAAGTCCAGATAGTCG
OccludinF: CAGCAGCAGTGGTAACTTGG110NM_001163647.2
R: CCGTCGTGTAGTCTGTCTCG
ZO–1F: CCGCCTCCTGAGTTTGATAG189XM_013993251.1
R: CAGCTTTAGGCACTGTGCTG
Claudin–1F: ACTGGCTGGGCTGCTGCTTCTCT101NM_001244539.1
R: GGATAGGGCCTTGGTGTTGGGTAA
β–actinF: GGCGCCCAGCACGAT66XM_021086047.1
R: CCGATCCACACGGAGTACTTG
IL-6, interleukin 6; IL-10, interleukin 10; IL-1β, interleukin-1β; TNF-α, tumor necrosis factor-α; ZO-1, tight junction protein 1.
Table 3. Effect of protein sources of milk replacer on growth performance of piglets (n = 8).
Table 3. Effect of protein sources of milk replacer on growth performance of piglets (n = 8).
Diets SEMp-Value
WPCSDPPSPI
Initial BW (kg)1.541.561.560.080.98
Final BW (kg)3.394.373.040.370.05
ADG (g/d)103 1578320.860.05
ADFI (g/d)13016814013.040.12
F/G1.721.162.270.360.07
WPC, milk replacer with 17.70% whey protein concentrate (WPC); SDPP, milk replacer with 6% spray-dried porcine plasma (SDPP) isonitrogenously substituting WPC; SPI, milk replacer with 5.13% soy protein isolate (SPI) isonitrogenously substituting WPC. ADG, average daily gain; ADFI, average daily feed intake; F/G, ratio of ADFI to ADG.
Table 4. Effect of protein sources of milk replacer on plasma biochemical parameters of piglets (n = 8).
Table 4. Effect of protein sources of milk replacer on plasma biochemical parameters of piglets (n = 8).
Diets SEMp-Value
WPCSDPPSPI
C3, mg/L0.090.090.090.010.81
IgG, g/L1.861.831.880.060.81
Urea, mmol/L15.7113.2124.643.610.08
GLU, mmol/L2.802.442.890.830.93
TC, mmol/L3.183.403.620.290.56
LDL–C, mmol/L1.361.491.710.180.37
HDL–C, mmol/L0.810.740.670.060.25
NEFA, µmol/L386.12320.08341.0276.630.82
TG, mmol/L0.760.880.910.160.72
WPC, milk replacer with 17.70% whey protein concentrate (WPC); SDPP, milk replacer with 6% spray–dried porcine plasma (SDPP) isonitrogenously substituting WPC; SPI, milk replacer with 5.13% soy protein isolate (SPI) isonitrogenously substituting WPC. C3, complement 3; IgG, immunoglobulin G; GLU, glucose; TC, total cholesterol; LDL–C, low–density lipoprotein cholesterol; HDL–C, high–density lipoprotein cholesterol; TG, triglyceride.
Table 5. Effect of protein sources of milk replacer on α–diversity index of piglets (n = 8).
Table 5. Effect of protein sources of milk replacer on α–diversity index of piglets (n = 8).
Diets SEMp-Value
WPCSDPPSPI
Shannon5.294.985.170.180.52
Simpson0.900.890.890.020.46
Dominance0.100.110.110.020.46
Pielou_e0.590.560.570.020.62
Chao1534.32492.19541.9829.130.44
Table 6. Effect of protein sources of milk replacer on SCFA concentrations in colonic chyme of piglets (n = 8).
Table 6. Effect of protein sources of milk replacer on SCFA concentrations in colonic chyme of piglets (n = 8).
Diets SEMp-Value
WPCSDPPSPI
Acetic acid, μmoL/g31.4829.7531.332.120.81
Propionic acid, μmoL/g11.6112.1711.290.500.47
Isobutyric acid, μmoL/g1.060.991.070.070.69
Butyric acid, μmoL/g3.334.322.860.450.08
Isovaleric acid, μmoL/g2.212.052.230.190.77
Valeric acid, μmoL/g0.490.470.510.070.92
Total SCFAs, μmoL/g50.1749.7649.112.270.94
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Y.; Zhou, Q.; Liu, S.; Quan, X.; Fang, Z.; Lin, Y.; Xu, S.; Feng, B.; Zhuo, Y.; Wu, D.; et al. Partial Substitution of Whey Protein Concentrate with Spray–Dried Porcine Plasma or Soy Protein Isolate in Milk Replacer Differentially Modulates Ileal Morphology, Nutrient Digestion, Immunity and Intestinal Microbiota of Neonatal Piglets. Animals 2023, 13, 3308. https://doi.org/10.3390/ani13213308

AMA Style

Zhang Y, Zhou Q, Liu S, Quan X, Fang Z, Lin Y, Xu S, Feng B, Zhuo Y, Wu D, et al. Partial Substitution of Whey Protein Concentrate with Spray–Dried Porcine Plasma or Soy Protein Isolate in Milk Replacer Differentially Modulates Ileal Morphology, Nutrient Digestion, Immunity and Intestinal Microbiota of Neonatal Piglets. Animals. 2023; 13(21):3308. https://doi.org/10.3390/ani13213308

Chicago/Turabian Style

Zhang, Yuwei, Qiang Zhou, Shiya Liu, Xiang Quan, Zhengfeng Fang, Yan Lin, Shengyu Xu, Bin Feng, Yong Zhuo, De Wu, and et al. 2023. "Partial Substitution of Whey Protein Concentrate with Spray–Dried Porcine Plasma or Soy Protein Isolate in Milk Replacer Differentially Modulates Ileal Morphology, Nutrient Digestion, Immunity and Intestinal Microbiota of Neonatal Piglets" Animals 13, no. 21: 3308. https://doi.org/10.3390/ani13213308

APA Style

Zhang, Y., Zhou, Q., Liu, S., Quan, X., Fang, Z., Lin, Y., Xu, S., Feng, B., Zhuo, Y., Wu, D., & Che, L. (2023). Partial Substitution of Whey Protein Concentrate with Spray–Dried Porcine Plasma or Soy Protein Isolate in Milk Replacer Differentially Modulates Ileal Morphology, Nutrient Digestion, Immunity and Intestinal Microbiota of Neonatal Piglets. Animals, 13(21), 3308. https://doi.org/10.3390/ani13213308

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop