Effect of N-Carbamylglutamate Supplementation on Growth Performance, Jejunal Morphology, Amino Acid Transporters, and Antioxidant Ability of Weaned Pigs
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. N-Carbamylglutamate
2.2. Animals, Diets, and Experimental Design
2.3. Growth Performance and Sample Collection
2.4. Chemical Analyses
2.5. Serum Biochemical Parameter Analysis
2.6. Jejunal Morphological Analysis
2.7. Antioxidant Ability
2.8. Quantitative Real-Time PCR
2.9. Statistical Analysis
3. Results
3.1. Effects of NCG on Growth Performance in Weaned Pigs
3.2. Effects of NCG on Apparent Nutrient Digestibility in Weaned Pigs
3.3. Effects of NCG on Serum Biochemical Parameters in Weaned Pigs
3.4. Effects of NCG on Jejunal Morphology in Weaned Pigs
3.5. Effects of NCG on Tight Junction Protein in Weaned Pigs
3.6. Effects of NCG on Jejunal Amino Acid Transporters in Weaned Pigs
3.7. Effects of NCG on Antioxidant Ability of Serum and Jejunum in Weaned Pigs
3.8. Effect of NCG on mRNA Expression of Antioxidant-Related Genes in the Jejunum of Weaned Pigs
3.9. Effects of NCG on mRNA Expression of Jejunal Mucosa Cytokines in Weaned Pigs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tang, X.; Xiong, K.; Fang, R.; Li, M. Weaning stress and intestinal health of piglets: A review. Front. Immunol. 2022, 13, 1042778. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.H.; Zhao, K.L.; Chen, X.L.; Xu, J.X. Impact of weaning and an antioxidant blend on intestinal barrier function and antioxidant status in pigs1. J. Anim. Sci. 2012, 90, 2581–2589. [Google Scholar] [CrossRef] [PubMed]
- Ahasan, A.S.M.L.; Invernizzi, G.; Farina, G.; Pilotto, A.; Barbé, F.; Bontempo, V.; Rossi, R.; Bellagamba, F.; Lecchi, C.; Savoini, G.; et al. The effects of superoxide dismutase-rich melon pulp concentrate on inflammation, antioxidant status and growth performance of challenged post-weaning piglets. Animal 2019, 13, 136–143. [Google Scholar] [CrossRef]
- Suzuki, T.; Mochizuki, K.; Goda, T. Localized expression of genes related to carbohydrate and lipid absorption along the crypt–villus axis of rat jejunum. Biochim. Biophys. Acta-Gen. Subj. 2009, 1790, 1624–1635. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Jin, Y.; Peng, A.; Guo, S.; Loor, J.J.; Wang, H. L-Arginine protects ovine intestinal epithelial cells from lipopolysaccharide-induced intestinal barrier injury. Food Agric. Immunol. 2019, 30, 1067–1084. [Google Scholar] [CrossRef]
- Wu, X.; Ruan, Z.; Gao, Y.; Yin, Y.; Zhou, X.; Wang, L.; Geng, M.; Hou, Y.; Wu, G. Dietary supplementation with l-arginine or N-carbamylglutamate enhances intestinal growth and heat shock protein-70 expression in weanling pigs fed a corn- and soybean meal-based diet. Amino Acids 2010, 39, 831–839. [Google Scholar] [CrossRef] [PubMed]
- Yao, K.; Guan, S.; Li, T.; Huang, R.; Wu, G.; Ruan, Z.; Yin, Y. Dietary l-arginine supplementation enhances intestinal development and expression of vascular endothelial growth factor in weanling piglets. Br. J. Nutr. 2011, 105, 703–709. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Yin, Y.; Shu, X.; Li, T.; Li, F.; Tan, B.; Wu, Z.; Wu, G. Oral administration of MSG increases expression of glutamate receptors and transporters in the gastrointestinal tract of young piglets. Amino Acids 2013, 45, 1169–1177. [Google Scholar] [CrossRef] [PubMed]
- Daniotti, M.; la Marca, G.; Fiorini, P.; Filippi, L. New developments in the treatment of hyperammonemia: Emerging use of carglumic acid. Int. J. Gen. Med. 2011, 4, 21–28. [Google Scholar] [CrossRef] [PubMed]
- Chacher, B.; Liu, H.; Wang, D.; Liu, J. Potential role of N-carbamoyl glutamate in biosynthesis of arginine and its significance in production of ruminant animals. J. Anim. Sci. Bio. Techno. 2013, 4, 16. [Google Scholar] [CrossRef]
- Wu, G.; Bazer, F.W.; Davis, T.A.; Jaeger, L.A.; Johnson, G.A.; Kim, S.W.; Knabe, D.A.; Meininger, C.J.; Spencer, T.E.; Yin, Y.-L. Important roles for the arginine family of amino acids in swine nutrition and production. Livest. Sci. 2007, 112, 8–22. [Google Scholar] [CrossRef]
- Wu, G.; Bazer, F.W.; Davis, T.A.; Kim, S.W.; Li, P.; Marc Rhoads, J.; Carey Satterfield, M.; Smith, S.B.; Spencer, T.E.; Yin, Y. Arginine metabolism and nutrition in growth, health and disease. Amino Acids 2009, 37, 153–168. [Google Scholar] [CrossRef] [PubMed]
- Ma, W.; Lu, Y.; Wang, C. Production performance, egg quality, and uterine gene expression for layers as affected by N-Carbamylglutamate supplementation. Front. Vet. Sci. 2023, 10, 1110801. [Google Scholar] [CrossRef]
- Zhang, F.; Wang, J.; Zhang, H.; Wu, S.; Lin, J.; Qi, G. Effect of amniotic injection of N-Carbamylglutamate on meat quality of broilers. Animals 2020, 10, 576. [Google Scholar] [CrossRef] [PubMed]
- National Research Council of the National Academies. Nutrient Requirements of Swine, Eleventh Revised Edition; National Academies Press: Washington, DC, USA, 2012. [Google Scholar]
- Upadhaya, S.-D.; Kim, I.-H. The Impact of weaning stress on gut health and the mechanistic aspects of several feed additives contributing to improved gut health function in weanling piglets—A review. Animals 2021, 11, 2418. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.; Li, H.; Peng, Z.; Ge, Y.; Liu, J.; Wang, T.; Wang, H.; Dong, L. Early weaning affects liver antioxidant function in piglets. Animals 2021, 11, 2679. [Google Scholar] [CrossRef]
- Morris, C.R.; Hamilton-Reeves, J.; Martindale, R.G.; Sarav, M.; Ochoa Gautier, J.B. Acquired amino acid deficiencies: A focus on arginine and glutamine. Nutr. Clin. Pract. 2017, 32, 30S–47S. [Google Scholar] [CrossRef]
- Wu, G.; Knabe, D.A.; Kim, S.W. Arginine nutrition in neonatal pigs. J. Nutr. 2004, 134, 2783S–2790S. [Google Scholar] [CrossRef]
- Wang, J.; Yoo, J.S.; Kim, H.J.; Lee, J.H.; Kim, I.H. Nutrient digestibility, blood profiles and fecal microbiota are influenced by chitooligosaccharide supplementation of growing pigs. Livest. Sci. 2009, 125, 298–303. [Google Scholar] [CrossRef]
- Zhu, J.; Thompson, C.B. Metabolic regulation of cell growth and proliferation. Nat. Rev. Mol. Cell Biol. 2019, 20, 436–450. [Google Scholar] [CrossRef]
- Ma, X.; Qiang, J.; He, J.; Gabriel, N.N.; Xu, P. Changes in the physiological parameters, fatty acid metabolism, and SCD activity and expression in juvenile GIFT tilapia (Oreochromis niloticus) reared at three different temperatures. Fish Physiol. Biochem. 2015, 41, 937–950. [Google Scholar] [CrossRef]
- Pi, G.; Wang, J.; Song, W.; Li, Y.; Yang, H. Effects of isomalto-oligosaccharides and herbal extracts on growth performance, serum biochemical profiles and intestinal bacterial populations in early-weaned piglets. J. Anim. Physiol. Anim. Nutr. 2022, 106, 671–681. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Xiong, K. Intrauterine growth retardation affects intestinal health of suckling piglets via altering intestinal antioxidant capacity, glucose uptake, tight junction, and immune responses. Oxidative Med. Cell. Longev. 2022, 2022, 2644205. [Google Scholar] [CrossRef]
- Jayaraman, B.; Nyachoti, C.M. Husbandry practices and gut health outcomes in weaned piglets: A review. Anim. Nutr. 2017, 3, 205–211. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.C.; Hansen, C.F.; Mullan, B.P.; Pluske, J.R. Nutrition and pathology of weaner pigs: Nutritional strategies to support barrier function in the gastrointestinal tract. Anim. Feed Sci. Technol. 2012, 173, 3–16. [Google Scholar] [CrossRef]
- Ulluwishewa, D.; Anderson, R.C.; McNabb, W.C.; Moughan, P.J.; Wells, J.M.; Roy, N.C. Regulation of tight junction permeability by intestinal bacteria and dietary components1,2. J. Nutr. 2011, 141, 769–776. [Google Scholar] [CrossRef]
- Zhang, H.; Zhao, F.; Peng, A.; Dong, L.; Wang, M.; Yu, L.; Loor, J.J.; Wang, H. Effects of dietary l-Arginine and N-Carbamylglutamate supplementation on intestinal integrity, immune function, and oxidative status in intrauterine-growth-retarded suckling lambs. J. Agric. Food Chem. 2018, 66, 4145–4154. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Tan, B.; Li, G.; Xiao, H.; Huang, B.; Zhang, M.; Yin, Y. Polyamine metabolism in the intestine of piglets is altered by weaning and proline supplementation1. J. Anim. Sci. 2016, 94, 423–428. [Google Scholar] [CrossRef]
- He, F.; Wu, C.; Li, P.; Li, N.; Zhang, D.; Zhu, Q.; Ren, W.; Peng, Y. Functions and signaling pathways of amino acids in intestinal inflammation. Biomed Res. Int. 2018, 2018, 9171905. [Google Scholar] [CrossRef]
- Hoffmann, T.M.; Cwiklinski, E.; Shah, D.S.; Stretton, C.; Hyde, R.; Taylor, P.M.; Hundal, H.S. Effects of sodium and amino acid substrate availability upon the expression and stability of the SNAT2 (SLC38A2) amino acid transporter. Front. Pharmacol. 2018, 9, 63. [Google Scholar] [CrossRef] [PubMed]
- Bianchi, M.G.; Bardelli, D.; Chiu, M.; Bussolati, O. Changes in the expression of the glutamate transporter EAAT3/EAAC1 in health and disease. Cell. Mol. Life Sci. 2014, 71, 2001–2015. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Fu, D.; Kong, X.; Wang, W.; Yang, X.; Nyachoti, C.M.; Yin, Y. Dietary supplementation with N-carbamylglutamate increases the expression of intestinal amino acid transporters in weaned Huanjiang mini-pig piglets1. J. Anim. Sci. 2013, 91, 2740–2748. [Google Scholar] [CrossRef] [PubMed]
- Tonelli, C.; Chio, I.I.C.; Tuveson, D.A. Transcriptional regulation by Nrf2. Antioxid. Redox Signal. 2017, 29, 1727–1745. [Google Scholar] [CrossRef] [PubMed]
- Mine, Y.; Young, D.; Yang, C. Antioxidative stress effect of phosphoserine dimers is mediated via activation of the Nrf2 signaling pathway. Mol. Nutr. Food Res. 2015, 59, 303–314. [Google Scholar] [CrossRef] [PubMed]
- Dietrich, C. Antioxidant functions of the aryl hydrocarbon receptor. Stem Cells Int. 2016, 2016, 7943495. [Google Scholar] [CrossRef]
- He, F.; Antonucci, L.; Karin, M. NRF2 as a regulator of cell metabolism and inflammation in cancer. Carcinogenesis 2020, 41, 405–416. [Google Scholar] [CrossRef] [PubMed]
- Liao, W.; Zhao, S.; Yang, Z.; Yang, W.; Huang, L.; Liu, F.; Liu, M.; Ge, J.; Wang, Y.; Jiang, S. Illicium verum and Eucommia ulmoides leaf extracts promote nutrient availability and antioxidant capacity in piglets by upregulating duodenal and jejunal Nrf2/TNF-α. J. Anim. Physiol. Anim. Nutr. 2021, 105, 916–926. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Yao, W.; Li, J.; Shao, Y.; He, Q.; Xia, J.; Huang, F. Dietary garcinol supplementation improves diarrhea and intestinal barrier function associated with its modulation of gut microbiota in weaned piglets. J. Anim. Sci. Bio. Techno. 2020, 11, 12. [Google Scholar] [CrossRef]




| Ingredients | Content | Nutrient Levels | Content |
|---|---|---|---|
| Corn | 60.07 | Digestible energy (MJ/kg) 2 | 14.32 |
| Soybean meal | 15.00 | CP | 17.93 |
| Wheat bran | 4.00 | Ca | 0.65 |
| Extruded full-fat soybean | 9.00 | P | 0.50 |
| Concentrated soybean protein | 3.00 | Lys | 1.28 |
| Whey powder | 3.00 | Met | 0.42 |
| Soybean oil | 1.00 | Thr | 0.84 |
| Sucrose | 1.50 | Trp | 0.25 |
| Limestone | 0.60 | ||
| CaHPO4 | 1.20 | ||
| L-Lysiine HCl | 0.45 | ||
| DL-Methionine | 0.15 | ||
| L-Threonine | 0.15 | ||
| L-Tryptophan | 0.05 | ||
| L-Valine | 0.03 | ||
| NaCl | 0.30 | ||
| Vitamin–mineral premix 1 | 0.50 | ||
| Total | 100.00 |
| Gene 2 | Primer Sequences (5′→3′) | Product Size (bp) | Accession Number |
|---|---|---|---|
| GAPDH | F:GAAGGTCGGAGTGAACGGAT R:CATGGGTAGAATCATACTGGAACA | 149 | AF017079 |
| SOD1 | F:AAGGCCGTGTGTGTGCTGAA R:GATCACCTTCAGCCAGTCCTTT | 118 | NM_001190422.1 |
| SOD2 | F:GGCCTACGTGAACAACCTGA R:TGATTGATGTGGCCTCCACC | 126 | NM_214127.2 |
| CAT | F:ATCCAGCCAGTGACCAGATG R:CCCGGTCAAAGTGAGCCATT | 183 | NM_214301.2 |
| Gpx4 | F:TGATAAGAACGGCTGTGTGGT R:TTGAGCTAGAGGTAGCACGG | 90 | NM_214407.1 |
| Nrf2 | F:TGCTTTATAGCGTGCAAACCT R:TGTCAATCAAATCCATGTCCCTTG | 191 | XM_021075133.1 |
| Keap1 | F:CGTGGAGACAGAAACGTGGA R:CAATCTGCTTCCGACAGGGT | 239 | XM_021076667.1 |
| AhR | F:TTGCTACAGGCTCTAAATGGCTT | 209 | NM_001303026.1 |
| R: GAGTCTGGACACTGTGAAGGG | |||
| CYP1A1 | F:CCTTCACCATCCCTCACAGT | 196 | NM_214412.1 |
| R:ATCACCTTTTCACCCAGTGC | |||
| NQO1 | F:CATGGCGGTCAGAAAAGCAC R:ATGGCATACAGGTCCGACAC | 135 | NM_001159613.1 |
| GCLC | F:CTCCCTTGTGGTACCTCTGC | 255 | XM_021098556.1 |
| R:GTCCTCCACCGTGTTGAACT | |||
| GCLM | F:AGTTCACCGTCCTGCCAAAT | 189 | XM_001926378.4 |
| R:AACAGACATAGCCTGCCACC | |||
| HO-1 | F:TACCGCTCCCGAATGAACAC | 209 | NM_001004027.1 |
| R:GTCACGGGAGTGGAGTCTTG | |||
| Claudin-1 | F:CTCTCCCCACATTCGAGATGATT R:AGCCATTGACGTGATCCAGG | 247 | NM_001244539.1 |
| Occludin | F:TCAGGTGCACCCTCCAGATT R:TATGTCGTTGCTGGGTGCAT | 169 | NM_001163647.2 |
| ZO-1 | F:CCAACCATGTCTTGAAGCAGC R:TGCAGGAGTGTGGTCTTCAC | 215 | XM_021098896.1 |
| TNF-α | F:GCCCTTCCACCAACGTTTTC R:CAAGGGCTCTTGATGGCAGA | 97 | NM_214022.1 |
| IL-1β | F:ACACACCTCTGACTCAAGCC R:GGGGCCATCAGCCTCAAATA | 275 | NM_001302388.2 |
| IL-6 | F:TTCAGTCCAGTCGCCTTCT | 91 | NM_214399.1 |
| R:GTGGCATCACCTTTGGCATCTTCTT | |||
| IL-10 | F:CACTGCTCTATTGCCTGATCTTCC | 136 | NM_214041.1 |
| R:AAACTCTTCACTGGGCCGAAG | |||
| SNAT2 | F:TGATTCTTGCCGACCACGTT | 128 | XM_003126626.6 |
| R:GGCTGCGGCCTTTAAGTTCT | |||
| EAAC1 | F:TTGGTCTACGTGCTGTCGTATATT | 263 | NM_001164649.1 |
| R:CGTCTCTGGCTCACTAGAAGG | |||
| SLC3A1 | F:TACCCACCCGGTCAGACTAC | 188 | NM_001123042.1 |
| R:TATGCCGTTGAGCTCTCTCG | |||
| SLC3A2 | F:GACCCCGCTTTCGGTTCTAA | 294 | XM_003353809.4 |
| R:AATCAAGAGCCTATCCTCGCTG |
| Items | Treatment 1 | SEM | p-Value 2 | |
|---|---|---|---|---|
| CON | NCG | |||
| Initial BW, kg | 5.69 | 5.71 | 0.17 | 0.87 |
| Final BW, kg | 13.14 | 13.91 | 0.49 | 0.13 |
| 0–14 d | ||||
| ADFI, g | 360.18 | 394.60 | 30.63 | 0.12 |
| ADG, g | 210.32 b | 235.32 a | 11.38 | 0.03 |
| F:G ratio | 1.71 | 1.68 | 0.06 | 0.66 |
| 15–28 d | ||||
| ADFI, g | 550.38 | 583.64 | 30.77 | 0.29 |
| ADG, g | 322.22 | 349.84 | 17.43 | 0.12 |
| F:G ratio | 1.77 | 1.67 | 0.11 | 0.41 |
| 0–28 d | ||||
| AWG/kg | 7.46 b | 8.19 a | 0.35 | 0.04 |
| ADFI, g | 455.28 | 489.12 | 20.50 | 0.11 |
| ADG, g | 266.27 b | 292.58 a | 12.61 | 0.04 |
| F:G ratio | 1.74 | 1.68 | 0.08 | 0.42 |
| Items | Treatment 1 | SEM | p-Value 2 | |
|---|---|---|---|---|
| CON | NCG | |||
| 0–14 d | ||||
| DM, % | 84.78 | 85.58 | 1.22 | 0.52 |
| CP, % | 77.07 | 80.04 | 1.60 | 0.07 |
| EE, % | 71.46 | 71.73 | 4.44 | 0.95 |
| NDF, % | 50.27 | 53.85 | 2.79 | 0.21 |
| ADF, % | 24.40 | 29.15 | 2.85 | 0.10 |
| Ca, % | 49.23 | 50.06 | 1.99 | 0.68 |
| P, % | 30.18 | 31.00 | 1.61 | 0.61 |
| 15–28 d | ||||
| DM, % | 86.35 b | 89.52 a | 0.64 | 0.01 |
| CP, % | 84.49 b | 87.23 a | 0.37 | 0.01 |
| EE, % | 74.15 | 74.52 | 3.89 | 0.92 |
| NDF, % | 51.94 | 55.16 | 2.56 | 0.22 |
| ADF, % | 28.74 | 31.37 | 4.24 | 0.54 |
| Ca, % | 51.24 | 53.10 | 1.50 | 0.22 |
| P, % | 31.75 | 31.53 | 1.07 | 0.84 |
| Items | Treatment 1 | SEM | p-Value 2 | |
|---|---|---|---|---|
| CON | NCG | |||
| GLU, mmol/L | 7.24 b | 8.11 a | 0.27 | 0.01 |
| TP, g/L | 55.40 | 56.13 | 1.34 | 0.61 |
| ALB, g/L | 38.93 | 39.63 | 0.85 | 0.46 |
| GLB, g/L | 16.47 | 16.50 | 1.86 | 0.99 |
| A:G, % | 2.42 | 2.41 | 0.29 | 0.96 |
| HDL, mmol/L | 0.90 b | 1.15 a | 0.06 | 0.01 |
| LDL, mmol/L | 1.40 | 1.27 | 0.18 | 0.50 |
| TC, mmol/L | 2.21 | 2.26 | 0.33 | 0.89 |
| TGs, mmol/L | 0.92 | 0.71 | 0.09 | 0.13 |
| SUN, mmol/L | 3.90 a | 3.00 b | 0.28 | 0.03 |
| Items | Treatment 1 | SEM | p-Value 2 | |
|---|---|---|---|---|
| CON | NCG | |||
| VH, µm | 313.83 b | 412.42 a | 16.30 | 0.01 |
| CD, µm | 282.62 | 273.40 | 9.04 | 0.33 |
| VH/CD ratio | 1.11 b | 1.51 a | 0.06 | 0.01 |
| IWT, µm | 141.32 b | 184.45 a | 9.70 | 0.01 |
| Items | Treatment 1 | SEM | p-Value 2 | |
|---|---|---|---|---|
| CON | NCG | |||
| Serum | ||||
| T-AOC, μmol/g | 159.78 | 172.97 | 9.75 | 0.29 |
| SOD, U/mg prot | 287.47 | 292.07 | 3.51 | 0.26 |
| GSH-Px, U/mg | 253.19 b | 305.06 a | 14.15 | 0.02 |
| MDA, nmol/mg prot | 5.00 a | 4.26 b | 0.19 | 0.02 |
| Jejunum | ||||
| T-AOC, μmol/g | 267.93 b | 339.98 a | 18.95 | 0.02 |
| SOD, U/mg prot | 354.39 b | 392.17 a | 6.32 | 0.01 |
| GSH-Px, U/mg | 9.77 | 10.57 | 0.91 | 0.43 |
| MDA, nmol/mg prot | 0.44 a | 0.29 b | 0.03 | 0.01 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, N.; Mao, P.; Xiong, X.; Ma, Z.; Xie, Z.; Gao, M.; Wu, Q.; Ma, W. Effect of N-Carbamylglutamate Supplementation on Growth Performance, Jejunal Morphology, Amino Acid Transporters, and Antioxidant Ability of Weaned Pigs. Animals 2023, 13, 3183. https://doi.org/10.3390/ani13203183
Hu N, Mao P, Xiong X, Ma Z, Xie Z, Gao M, Wu Q, Ma W. Effect of N-Carbamylglutamate Supplementation on Growth Performance, Jejunal Morphology, Amino Acid Transporters, and Antioxidant Ability of Weaned Pigs. Animals. 2023; 13(20):3183. https://doi.org/10.3390/ani13203183
Chicago/Turabian StyleHu, Naizhi, Pei Mao, Xiaoya Xiong, Zhuangzhuang Ma, Zhijiang Xie, Mengmeng Gao, Qiujue Wu, and Wenfeng Ma. 2023. "Effect of N-Carbamylglutamate Supplementation on Growth Performance, Jejunal Morphology, Amino Acid Transporters, and Antioxidant Ability of Weaned Pigs" Animals 13, no. 20: 3183. https://doi.org/10.3390/ani13203183
APA StyleHu, N., Mao, P., Xiong, X., Ma, Z., Xie, Z., Gao, M., Wu, Q., & Ma, W. (2023). Effect of N-Carbamylglutamate Supplementation on Growth Performance, Jejunal Morphology, Amino Acid Transporters, and Antioxidant Ability of Weaned Pigs. Animals, 13(20), 3183. https://doi.org/10.3390/ani13203183

