Dietary Neutral Detergent Fiber Levels Impacting Dairy Cows’ Feeding Behavior, Rumen Fermentation, and Production Performance during the Period of Peak-Lactation
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials
2.1.1. Experimental Animals
2.1.2. Experimental Feed
2.2. Experimental Design and Experimental Diet
2.2.1. Feeding and Management
2.2.2. Experimental Design
2.3. Sample Collection and Analyses
2.3.1. Recording the Feed Intake and Feeding Behavior
2.3.2. Collection, Preservation, and Pretreatment of Rumen Fluid
2.3.3. Collection and Preservation of Feed and Milk
2.4. Data Analysis
3. Results
3.1. Effects of Dietary NDF Levels on Feeding Behavior of Dairy Cows during the Period of Peak-Lactation
3.1.1. Effects of Dietary NDF Levels on DM, NDF, and peNDF8.0 Intake in Dairy Cows during Peak Lactation
3.1.2. Effects of Dietary NDF Levels on Eating and Ruminating Activities of Dairy Cows during Peak Lactation
3.2. Impact of Dietary NDF Levels on Rumen Fermentation Parameters in Dairy Cows during Peak Lactation
3.2.1. Dietary NDF Levels Impact on Ruminal pH, NH3-N, MCP, VFA, and Lactate in Dairy Cows during Peak Lactation
3.2.2. Impact of Dietary NDF Levels on the Proportion of Rumen Cellulolytic Bacteria among Total Bacteria in Dairy Cows during Peak Lactation
3.3. Effects of Dietary NDF Levels on Dairy Cows Production Performance during the Period of Peak-Lactation
4. Discussion
4.1. Effects of Dietary NDF Levels on Dairy Cows Feeding Behavior during the Period of Peak Lactation
4.2. Effects of Dietary NDF Levels on Rumen Fermentation Parameters of Dairy Cows during Peak Lactation Period
4.2.1. Rumen Average pH-Value, NH3-N and MCP
4.2.2. VFA and Lactate
4.2.3. Rumen Cellulolytic Bacteria
4.3. Effects of Dietary NDF Levels on the Production Performance of Dairy Cows during the Peak Lactation Period
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Su, Y.; Zhao, G.; Wei, Z.; Yan, C.; Liu, S. Mutation of cellulose synthase gene improves the nutritive value of rice straw. Asian-Australas. J. Anim. Sci. 2012, 25, 800–805. [Google Scholar] [CrossRef]
- Sullivan, M.; Grigsby, K.; Bradford, B. Effects of wet corn gluten feed on ruminal pH and productivity of lactating dairy cattle fed diets with sufficient physically effective fiber. J. Dairy Sci. 2012, 95, 5213–5220. [Google Scholar] [CrossRef] [PubMed]
- Agrawal, A.R.; Karim, S.A.; Kumar, R.; Sahoo, A.; John, P.J. Sheep and goat production: Basic differences, impact on climate and molecular tools for rumen microbiome study. Int. J. Curr. Microbiol. Appl. Sci. 2014, 3, 684–706. [Google Scholar]
- Maltz, E.; Barbosa, L.; Bueno, P.; Scagion, L.; Kaniyamattam, K.; Greco, L.; De Vries, A.; Santos, J. Effect of feeding according to energy balance on performance, nutrient excretion, and feeding behavior of early lactation dairy cows. J. Dairy Sci. 2013, 96, 5249–5266. [Google Scholar] [CrossRef] [PubMed]
- Lechartier, C.; Peyraud, J.L. The effects of forage proportion and rapidly degradable dry matter from concentrate on ruminal digestion in dairy cows fed corn silage–based diets with fixed neutral detergent fiber and starch contents. J. Dairy Sci. 2010, 93, 666–681. [Google Scholar] [CrossRef]
- Grummer, R.R.; Mashek, D.G.; Hayirli, A. Dry matter intake and energy balance in the transition period. Food Anim. Pract. 2004, 20, 447–470. [Google Scholar] [CrossRef]
- Arelovich, H.; Abney, C.; Vizcarra, J.; Galyean, M. Effects of dietary neutral detergent fiber on intakes of dry matter and net energy by dairy and beef cattle: Analysis of published data. Prof. Anim. Sci. 2008, 24, 375–383. [Google Scholar] [CrossRef]
- Allen, M.S. Effects of diet on short-term regulation of feed intake by lactating dairy cattle. J. Dairy Sci. 2000, 83, 1598–1624. [Google Scholar] [CrossRef]
- National Research Council. Nutrient Requirements of Dairy Cattle, 7th ed.; National Academy Press: Washington, DC, USA, 2001. [Google Scholar]
- Ranaraja, U.; Cho, K.H.; Na Park, M.; Choi, T.J.; Kim, S.D.; Lee, J.; Kim, H.S.; Do, C.H. Impact of environmental factors on milk β-hydroxybutyric acid and acetone levels in Holstein cattle associated with production traits. Korean J. Agric. Sci. 2016, 43, 394–400. [Google Scholar] [CrossRef]
- The National Academies of Sciences, Engineering, and Medicine. Nutrient Requirements of Dairy Cattle, 8th ed.; The National Academies Press: Washington, DC, USA, 2021. [Google Scholar]
- Broderick, G.A.; Kang, J.H. Automated simultaneous determination of ammonia and total amino acids in ruminal fluid and in vitro media. J. Dairy Sci. 1980, 63, 64–75. [Google Scholar] [CrossRef]
- Erwin, E.S.; Marco, G.J.; Emery, E.M. Volatile fatty acid analyses of blood and rumen fluid by gas chromatography. J. Dairy Sci. 1961, 44, 1768–1771. [Google Scholar] [CrossRef]
- Makkar, H.; Sharma, O.; Dawra, R.; Negi, S. Simple determination of microbial protein in rumen liquor. J. Dairy Sci. 1982, 65, 2170–2177. [Google Scholar] [CrossRef]
- Sun, X.G.; Wang, Y.; Xie, T.; Yang, Z.T.; Wang, J.D.; Zheng, Y.H.; Guo, C.; Zhang, Y.; Wang, Q.Q.; Wang, Z.H.; et al. Effects of high-forage diets containing raw flaxseeds or soybean on in vitro ruminal fermentation, gas emission, and microbial profile. Microorganisms 2021, 9, 2304. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis; Association of Official Analytical Chemists: Washington, DC, USA, 1990. [Google Scholar]
- Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef]
- Bal, M.; Shaver, R.; Jirovec, A.; Shinners, K.; Coors, J. Crop Processing and Chop Length of Corn Silage: Effects on Intake, Digestion, and Milk Production by Dairy Cows. J. Dairy Sci. 2000, 83, 1264–1273. [Google Scholar] [CrossRef]
- Ekinci, C.; Broderick, G.A. Effect of processing high moisture ear corn on ruminal fermentation and milk yield. J. Dairy Sci. 1997, 80, 3298–3307. [Google Scholar] [CrossRef]
- Ranathunga, S.D.; Kalscheur, K.F.; Hippen, A.R.; Schingoethe, D.J. Replacement of starch from corn with nonforage fiber from distillers grains and soyhulls in diets of lactating dairy cows. J. Dairy Sci. 2010, 93, 1086–1097. [Google Scholar] [CrossRef]
- Schulze, A.K.S.; Weisbjerg, M.R.; Nørgaard, P. Effects of feeding level and NDF content of grass-clover silages on chewing activity, fecal particle size, and NDF digestibility in dairy heifers. Animal 2014, 8, 1945–1954. [Google Scholar] [CrossRef] [PubMed]
- Mertens, D.R. Creating a system for meeting the fiber requirements of dairy cows. J. Dairy Sci. 1997, 80, 1463–1481. [Google Scholar] [CrossRef] [PubMed]
- Zebeli, Q.; Aschenbach, J.; Tafaj, M.; Boguhn, B.N.; Ametaj, B.; Drochner, W. Invited review: Role of physically effective fiber and estimation of dietary fiber adequacy in high-producing dairy cattle. J. Dairy Sci. 2012, 95, 1041–1056. [Google Scholar] [CrossRef] [PubMed]
- Voelker, J.A.; Burato, G.M.; Allen, M.S. Effects of pretrial milk yield on responses of chewing intake, digestion and production to dietary forage concentration. J. Dairy Sci. 2002, 85, 2650–2661. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.Z.; Beauchemin, K.A. Effects of physically effective fiber on chewing activity and ruminal pH of dairy cows fed diets based on barley silage. J. Dairy Sci. 2006, 89, 217–228. [Google Scholar] [CrossRef]
- Beauchemin, K.A.; Yang, W.Z. Effects of physically effective fiber on intake, chewing activity, and ruminal acidosis for dairy cows fed diets based on corn silage. J. Dairy Sci. 2005, 88, 2117–2129. [Google Scholar] [CrossRef]
- Sudweeks, E.M.; Ely, L.O.; Mertens, D.R. Assessing minimum amount and form of roughages in ruminant diets: Roughage value index system. J. Anim. Sci. 1981, 53, 1406–1411. [Google Scholar] [CrossRef]
- Belanche, A.; Doreau, M.; Edwards, J.E.; Moorby, J.M.; Pinloche, E.; Newbold, C.J. Shifts in the rumen microbiota due to the type of carbohydrate and level of protein ingested by dairy cattle are associated with changes in rumen fermentation. J. Nutr. 2012, 142, 1684–1692. [Google Scholar] [CrossRef] [PubMed]
- Jiang, F.; Lin, X.; Yan, Z.; Hu, Z.; Liu, G.; Sun, Y.; Liu, X.; Wang, Z. Effect of dietary roughage level on chewing activity, ruminal pH, and saliva secretion in lactating Holstein cows. J. Dairy Sci. 2017, 100, 2660–2671. [Google Scholar] [CrossRef]
- Beauchemin, K.A. Effects of dietary neutral detergent fiber concentration and alfalfa hay quality on chewing, rumen function, and milk production of dairy cows. J. Dairy Sci. 1991, 74, 3140–3151. [Google Scholar] [CrossRef]
- Allison, M.N.; Smith, R.H. Biosynthesis of amino acids by ruminal microorganisms. J. Anim. Sci. 1967, 29, 797–807. [Google Scholar] [CrossRef]
- Hristov, A.N.; Ropp, J.K.; Hunt, C.W. Effect of barley and its amylopectin content on ruminal fermentation and bacterial utilization of ammonia-N in vitro. Anim. Feed Sci. Technol. 2002, 99, 25–36. [Google Scholar] [CrossRef]
- Firkins, J.L. Effects of feeding non-forage fiber sources on site of fiber digestion. J. Dairy Sci. 1997, 80, 1426–1437. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Lin, X.; Su, P.; Liu, G.; Ai, J.; Wang, Z. Synchronization of dietary energy and nitrogen release on rumen fermentation, performance, and nitrogen balance in lactating Holstein cows. Chin. J. Anim. Nutr. 2011, 23, 1505–1512. [Google Scholar]
- Abdukarim, Y.H.; Kedir, S. Factors affecting rumen microbial protein synthesis: A review. Vet. Med. Open J. 2019, 4, 27–35. [Google Scholar]
- Detmann, E.; Valadares Filho, S. On the estimation of non-fibrous carbohydrates in feeds and diets. Arq. Bras. Med. Vet. Zootec. 2010, 62, 980–984. [Google Scholar] [CrossRef]
- Demeyer, D.I. Rumen microbes and digestion of plant cell walls. Agric. Environ. 1981, 6, 295–337. [Google Scholar] [CrossRef]
- Nocek, J.E.; Tamminga, S. Site of digestion of starch in the gastrointestinal tract of dairy cows and its effect on milk yield and composition. J. Dairy Sci. 1991, 74, 3598–3629. [Google Scholar] [CrossRef] [PubMed]
- Tjardes, K.E.; Buskirk, D.D.; Allen, M.S.; Ames, N.K.; Bourquin, L.D.; Rust, S.R. Neutral detergent fiber concentration of corn silage and rumen inert bulk influences dry matter intake and ruminal digesta kinetics of growing steers. J. Anim. Sci. 2002, 80, 833–840. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.-C.; Zhou, X.-L.; Zhao, P.-T.; Gao, M.; Han, H.-Q.; Hu, H.-. L Effects of Increasing non-fiber carbohydrate to neutral detergent fiber ratio on rumen fermentation and microbiota in goats. J. Integr. Agric. 2013, 12, 319–326. [Google Scholar] [CrossRef]
- Keunen, J.; Plaizier, J.; Kyriazakis, L.; Duffield, T.; Widowski, T.; Lindinger, M.; McBride, B. Effects of a Subacute Ruminal Acidosis Model on the Diet Selection of Dairy Cows. J. Dairy Sci. 2002, 85, 3304–3313. [Google Scholar] [CrossRef]
- Beauchemin, K.A.; Yang, W.Z.; Rode, L.M. Effects of Particle Size of Alfalfa-Based Dairy Cow Diets on Chewing Activity, Ruminal Fermentation, and milk production. J. Dairy Sci. 2003, 86, 630–643. [Google Scholar] [CrossRef] [PubMed]
- Cherdthong, M.W.; Cherdthong, A. Use of real-time PCR technique in studying rumen cellulolytic bacteria population as affected by level of roughage in swamp buffalo. Curr. Microbiol. 2009, 58, 294–299. [Google Scholar]
- Weimer, P.; Waghorn, G.; Odt, C.; Mertens, D. Effect of diet on populations of three species of ruminal cellulolytic bacteria in lactating dairy cows. J. Dairy Sci. 1999, 82, 122–134. [Google Scholar] [CrossRef] [PubMed]
- Dehority, B.A.; Tirabasso, P.A. Effect of ruminal cellulolytic bacterial concentrations on in situ digestion of forage cellulose. J. Anim. Sci. 1998, 76, 2905–2911. [Google Scholar] [CrossRef] [PubMed]
- Ghasemi, S.; Naserian, A.; Valizadeh, R.; Tahmasebi, A.; Vakili, A.; Behgar, M.; Ghovvati, S. Inclusion of pistachio hulls as a replacement for alfalfa hay in the diet of sheep causes a shift in the rumen cellulolytic bacterial population. Small Rumin. Res. 2012, 104, 94–98. [Google Scholar] [CrossRef]
- Saro, C.; Ranilla, M.J.; Tejido, M.L.; Carro, M.D. Influence of forage type in the diet of sheep on rumen microbiota and fermentation characteristics. Livest. Sci. 2014, 160, 52–59. [Google Scholar] [CrossRef]
- Bergman, E.N. Glucose metabolism in ruminants as related to hypoglycemia and ketosis. Cornell Vet. 1973, 63, 341–382. [Google Scholar]
- Kanjanapruthipong, J.; Buatong, N.; Buaphan, S. Effects of roughage neutral detergent fiber on dairy performance under tropical conditions. Asian-Australas. J. Anim. Sci. 2001, 14, 1400–1404. [Google Scholar] [CrossRef]
- Kendall, C.; Leonardi, C.; Hoffman, P.; Combs, D. Intake and milk production of cows fed diets that differed in dietary neutral detergent fiber and neutral detergent fiber digestibility. J. Dairy Sci. 2009, 92, 313–323. [Google Scholar] [CrossRef] [PubMed]
Ingredients | DM | CP | NDF | ADF | EE | Ca | P | Ash |
---|---|---|---|---|---|---|---|---|
Corn silage | 26.65 | 8.80 | 47.39 | 28.24 | 2.40 | 0.31 | 0.27 | 22.33 |
Imported alfalfa | 93.69 | 19.20 | 38.63 | 29.58 | 2.50 | 1.47 | 0.28 | 10.85 |
Local alfalfa | 93.33 | 14.50 | 52.21 | 40.63 | 1.10 | 1.30 | 0.04 | 7.68 |
Leymus chinensis | 92.66 | 7.16 | 70.00 | 40.03 | 3.90 | 0.40 | 0.20 | 5.62 |
Local oat hay | 93.08 | 9.10 | 64.38 | 38.60 | 1.60 | 0.43 | 0.36 | 16.42 |
Items | Treatments | |||
---|---|---|---|---|
25.49% | 28.65% | 31.66% | 34.65% | |
Ingredients, % | ||||
Corn silage | 18.00 | 18.00 | 16.00 | 10.00 |
Imported alfalfa hay | 15.00 | 10.00 | 6.00 | 2.00 |
Local alfalfa hay | 5.00 | 6.00 | 8.00 | 6.00 |
Leymus chinensis | 1.00 | 4.00 | 8.00 | 12.00 |
Local oat hay | 1.00 | 2.00 | 4.00 | 10.00 |
Corn grain | 17.99 | 15.99 | 13.99 | 13.52 |
Steam-flaked Corn | 13.26 | 11.47 | 9.00 | 7.00 |
Extruded soybean | 3.18 | 3.18 | 3.18 | 3.18 |
Soybean meal | 10.20 | 10.20 | 10.70 | 11.30 |
Rapeseed meal | 5.08 | 5.08 | 5.08 | 5.08 |
Apple pomace | 1.60 | 1.60 | 1.60 | 2.60 |
Beet pulp | 1.68 | 1.68 | 1.68 | 1.68 |
Whole Cottonseed | 0.88 | 4.46 | 5.79 | 8.33 |
Bergafat T 300 | 1.32 | 1.42 | 2.02 | 2.22 |
Molasses | 1.12 | 1.12 | 1.12 | 1.12 |
Premix | 3.69 | 3.80 | 3.84 | 3.97 |
Total | 100.00 | 100.00 | 100.00 | 100.00 |
DM, % | 52.40 | 52.32 | 52.20 | 52.14 |
NEL, Mcal/kg | 1.68 | 1.68 | 1.67 | 1.69 |
CP, % | 17.02 | 16.96 | 16.95 | 16.97 |
NDF, % | 25.49 | 28.65 | 31.66 | 34.65 |
ADF, % | 16.88 | 18.81 | 20.54 | 22.14 |
NFC, % | 45.02 | 41.54 | 38.03 | 34.84 |
Starch, % | 27.92 | 25.42 | 21.99 | 19.23 |
EE, % | 5.17 | 5.85 | 6.65 | 7.22 |
Ca, % | 0.87 | 0.87 | 0.87 | 0.87 |
P, % | 0.34 | 0.34 | 0.34 | 0.34 |
Gene Name | Forward/Reward Primer | Base Number | Product Size |
---|---|---|---|
General bacteria | F:CGGCAACGAGCGCAACCC | 18 | 146 bp |
R:CCATTGTAGCACGTGTGTAGCC | 22 | ||
Ruminococcu flavefaciens | F:CGAACGGAGATAATTTGAGTTTACTTAGG | 29 | 132 bp |
R:CGGTCTCTGTATGTTATGAGGTATTACC | 28 | ||
Ruminococcu albus | F:CCCTAAAAGCAGTCTTAGTTCG | 22 | 176 bp |
R:CCTCCTTGCGGTTAGAACA | 19 | ||
Fibrobacter succinogenes | F:GTTCGGAATTACTGGGCGTAAA | 22 | 121 bp |
R: CGCCTGCCCCTGAACTATC | 19 |
Items | Treatment | SEM | p Value | |||||
---|---|---|---|---|---|---|---|---|
25% | 28% | 31% | 34% | All | L | Q | ||
Feed intake, kg/d | ||||||||
DM | 23.89 a | 23.66 a | 23.28 ab | 22.67 b | 0.19 | 0.02 | <0.01 | 0.37 |
NDF | 6.09 d | 6.78 c | 7.37 b | 7.85 a | 0.08 | <0.01 | <0.01 | 0.23 |
peNDF8.0 | 2.68 d | 3.25 c | 3.62 b | 4.01 a | 0.03 | <0.01 | <0.01 | 0.05 |
Feeding Behavior | Treatment | SEM | p Value | |||||
---|---|---|---|---|---|---|---|---|
25% | 28% | 31% | 34% | All | L | Q | ||
Eating Time | ||||||||
min/d | 181.58 c | 215.78 b | 253.53 a | 261.46 a | 4.58 | <0.01 | <0.01 | 0.03 |
min/kg of DM | 7.60 c | 9.13 b | 10.89 a | 11.53 a | 0.20 | <0.01 | <0.01 | 0.07 |
min/kg of NDF | 29.82 c | 31.89 bc | 34.41 a | 33.28 ab | 0.67 | 0.01 | 0.01 | 0.05 |
min/kg of peNDF8.0 | 67.70 ab | 66.44 ab | 70.22 a | 65.26 b | 1.36 | 0.16 | 0.56 | 0.23 |
Ruminating time | ||||||||
min/d | 371.06 b | 379.25 b | 411.75 b | 491.00 a | 12.35 | <0.01 | <0.01 | 0.03 |
min/kg of DM | 15.56 c | 16.04 bc | 17.70 b | 21.66 a | 0.52 | <0.01 | <0.01 | 0.02 |
min/kg of NDF | 61.05 | 56.00 | 55.94 | 62.53 | 2.03 | 0.13 | 0.65 | 0.03 |
min/kg of peNDF8.0 | 138.75 a | 116.67 b | 114.16 b | 122.62 b | 4.45 | 0.03 | 0.04 | 0.01 |
Item | Treatment | SEM | p Value | |||||
---|---|---|---|---|---|---|---|---|
25% | 28% | 31% | 34% | All | L | Q | ||
Mean pH | 6.13 b | 6.25 b | 6.29 b | 6.51 a | 0.05 | 0.01 | <0.01 | 0.36 |
NH3-N, mg/dL | 11.50 a | 10.88 b | 9.83 b | 9.48 b | 0.29 | <0.01 | <0.01 | 0.60 |
MCP, mg/dL | 104.52 a | 103.10 a | 100.03 b | 91.74 c | 0.67 | <0.01 | <0.01 | <0.01 |
Lactate, mmol/L | 0.39 a | 0.38 a | 0.34 b | 0.32 b | 0.01 | <0.01 | <0.01 | 0.27 |
VFA, mmol/L | ||||||||
Total VFA | 103.89 a | 102.27 ab | 99.56 ab | 98.75 b | 1.25 | 0.09 | 0.02 | 0.76 |
Acetate (A) | 59.12 b | 59.21 b | 60.82 a | 61.52 a | 0.38 | 0.01 | <0.01 | 0.48 |
Propionate (P) | 28.28 a | 27.71 a | 24.39 b | 23.94 b | 0.54 | <0.01 | <0.01 | 0.91 |
Butyrate | 11.16 a | 10.31 ab | 9.52 ab | 8.75 b | 0.61 | 0.12 | 0.03 | 0.95 |
Isobutyrate | 1.00 | 1.04 | 0.98 | 0.96 | 0.03 | 0.45 | 0.29 | 0.42 |
Isovalerate | 2.91 | 2.68 | 2.55 | 2.38 | 0.15 | 0.19 | 0.04 | 0.84 |
Caproate | 1.43 | 1.33 | 1.31 | 1.21 | 0.06 | 0.23 | 0.06 | 0.99 |
A:P | 2.10 b | 2.14 b | 2.50 a | 2.57 a | 0.05 | <0.01 | <0.01 | 0.81 |
Item | Treatments | SEM | p Value | |||||
---|---|---|---|---|---|---|---|---|
25% | 28% | 31% | 34% | All | L | Q | ||
Fibrobacter succinogenes | 0.1425 b | 0.1966 ab | 0.2113 a | 0.2240 a | 0.01 | 0.02 | <0.01 | 0.16 |
Ruminococcu albus | 0.1291 | 0.1303 | 0.1366 | 0.1375 | 0.02 | 0.98 | 0.75 | 0.99 |
Ruminococcu flavefaciens | 0.0112 b | 0.0139 ab | 0.0149 ab | 0.0187 a | <0.01 | 0.16 | 0.04 | 0.79 |
Item | Treatments | SEM | p Value | |||||
---|---|---|---|---|---|---|---|---|
25% | 28% | 31% | 34% | All | L | Q | ||
Milk yield, kg/d | 43.08 a | 42.16 ab | 40.42 ab | 37.68 b | 1.28 | 0.09 | 0.02 | 0.5 |
4% FCM yield, kg/d | 41.81 | 40.58 | 39.69 | 39.65 | 1.38 | 0.67 | 0.28 | 0.68 |
Feed efficiency | 1.75 | 1.71 | 1.71 | 1.75 | 0.06 | 0.93 | 0.99 | 0.53 |
Milk fat percentage, % | 3.83 b | 3.99 ab | 4.15 ab | 4.36 a | 0.11 | 0.03 | 0.01 | 0.05 |
Milk lactose percentage, % | 5.01 | 4.95 | 4.90 | 4.95 | 0.06 | 0.67 | 0.42 | 0.41 |
Milk protein percentage, % | 3.14 | 3.06 | 3.01 | 2.94 | 0.06 | 0.18 | 0.04 | 0.86 |
Milk fat yield, kg/d | 1.64 | 1.69 | 1.68 | 1.64 | 0.06 | 0.03 | 0.01 | 0.05 |
Milk lactose yield, kg/d | 2.15 a | 2.09 a | 1.98 ab | 1.86 b | 0.06 | 0.04 | 0.01 | 0.67 |
Milk protein yield, kg/d | 1.34 a | 1.29 a | 1.21 ab | 1.11 b | 0.04 | 0.02 | 0.01 | 0.58 |
MUN, mg/dL | 11.23 c | 12.72 a | 14.25 b | 14.51 a | 0.37 | <0.01 | <0.01 | 0.15 |
Nitrogen efficiency, % | 0.33 a | 0.32 ab | 0.30 ab | 0.29 b | 0.01 | 0.13 | 0.03 | 0.92 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, R.; Dong, S.; Mao, J.; Wang, J.; Cao, Z.; Wang, Y.; Li, S.; Zhao, G. Dietary Neutral Detergent Fiber Levels Impacting Dairy Cows’ Feeding Behavior, Rumen Fermentation, and Production Performance during the Period of Peak-Lactation. Animals 2023, 13, 2876. https://doi.org/10.3390/ani13182876
Shi R, Dong S, Mao J, Wang J, Cao Z, Wang Y, Li S, Zhao G. Dietary Neutral Detergent Fiber Levels Impacting Dairy Cows’ Feeding Behavior, Rumen Fermentation, and Production Performance during the Period of Peak-Lactation. Animals. 2023; 13(18):2876. https://doi.org/10.3390/ani13182876
Chicago/Turabian StyleShi, Renhuang, Shuangzhao Dong, Jiang Mao, Jingjun Wang, Zhijun Cao, Yajing Wang, Shengli Li, and Guoqi Zhao. 2023. "Dietary Neutral Detergent Fiber Levels Impacting Dairy Cows’ Feeding Behavior, Rumen Fermentation, and Production Performance during the Period of Peak-Lactation" Animals 13, no. 18: 2876. https://doi.org/10.3390/ani13182876
APA StyleShi, R., Dong, S., Mao, J., Wang, J., Cao, Z., Wang, Y., Li, S., & Zhao, G. (2023). Dietary Neutral Detergent Fiber Levels Impacting Dairy Cows’ Feeding Behavior, Rumen Fermentation, and Production Performance during the Period of Peak-Lactation. Animals, 13(18), 2876. https://doi.org/10.3390/ani13182876