Porcine Reproductive and Respiratory Syndrome (PRRS) and CD163 Resistance Polymorphic Markers: What Is the Scenario in Naturally Infected Pig Livestock in Central Italy?
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Investigated Pig Populations
2.2. Samples Collection and RNA Extraction
2.3. CD163 RT-PCR and Sequencing
2.4. PRRSV RT-qPCR
2.5. Statistical Analysis and Data Elaboration
3. Results
3.1. Association between SNPs and Risk of PRRS Infection
3.2. Association between the Animal Genotypes and the Risk of PRRS Infection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Keffaber, K. Reproduction failure of unknown etiology. Am. Assoc. Swine Pract. Newsl. 1989, 1, 1–9. [Google Scholar]
- Ye, N.; Wang, B.; Feng, W.; Tang, D.; Zeng, Z. PRRS virus receptors and an alternative pathway for viral invasion. Virus Res. 2022, 320, 198885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Snijder, E.J.; Meulenberg, J.J. The molecular biology of arteriviruses. J. Gen. Virol. 1998, 79 Pt 5, 961–979. [Google Scholar] [CrossRef] [Scilit]
- Kuhn, J.H.; Lauck, M.; Bailey, A.L.; Shchetinin, A.M.; Vishnevskaya, T.V.; Bào, Y.; Ng, T.F.; LeBreton, M.; Schneider, B.S.; Gillis, A.; et al. Reorganization and expansion of the nidoviral family Arteriviridae. Arch. Virol. 2016, 161, 755–768. [Google Scholar] [CrossRef] [Scilit]
- An, T.Q.; Li, J.N.; Su, C.M.; Yoo, D. Molecular and Cellular Mechanisms for PRRSV Pathogenesis and Host Response to Infection. Virus Res. 2020, 286, 197980. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Guo, C. Recent advances in inhibition of porcine reproductive and respiratory syndrome virus through targeting CD163. Front. Microbiol. 2022, 13, 1006464. [Google Scholar] [CrossRef] [Scilit]
- Stoian, A.M.M.; Raymond, R.R.; Brandariz-Nunez, A. Identification of CD163 regions that are required for porcine reproductive and respiratory syndrome virus (PRRSV) infection but not for binding to viral envelope glycoproteins. Virology 2022, 574, 71–83. [Google Scholar] [CrossRef] [Scilit]
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reiner, G. Genetic resistance—An alternative for controlling PRRS? Porc. Health Manag. 2016, 2, 27. [Google Scholar] [CrossRef] [Scilit]
- Onofre, G.; Kolácková, M.; Jankovicová, K.; Krejsek, J. Scavenger receptor CD163 and its biological functions. Acta Med. 2009, 52, 57–61. [Google Scholar] [CrossRef] [Scilit]
- Su, C.M.; Rowland, R.R.R.; Yoo, D. Recent advances in PRRS virus receptors and the targeting of receptor–ligand for control. Vaccines 2021, 9, 354. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Subramanian, K.; Du, R.; Tan, N.S.; Ho, B.; Ding, J.L. CD163 and IgG codefend against cytotoxic hemoglobin via autocrine and paracrine mechanisms. J. Immunol. 2013, 190, 5267–5278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burkard, C.; Lillico, S.G.; Reid, E.; Jackson, B.; Mileham, A.J.; Ait-Ali, T.; Whitelaw, C.B.; Archibald, A.L. Precision engineering for PRRSV resistance in pigs: Macrophages from genome edited pigs lacking CD163 SRCR5 domain are fully resistant to both PRRSV genotypes while maintaining biological function. PLoS Pathog. 2017, 13, e1006206. [Google Scholar] [CrossRef] [Scilit]
- Calvert, J.G.; Slade, D.E.; Shields, S.L.; Jolie, R.; Mannan, R.M.; Ankenbauer, R.G.; Welch, S.K.W. CD163 expression confers susceptibility to porcine reproductive and respiratory syndrome viruses. J. Virol. 2007, 81, 7371–7379. [Google Scholar] [CrossRef] [Scilit]
- Wells, K.D.; Bardot, R.; Whitworth, K.M.; Trible, B.R.; Fang, Y.; Mileham, A.; Kerrigan, M.A.; Samuel, M.S.; Prather, R.S.; Rowland, R.R.R. Replacement of porcine CD163 scavenger receptor cysteine-rich domain 5 with a CD163-like homolog confers resistance of pigs to genotype 1 but not genotype 2 porcine reproductive and respiratory syndrome virus. J. Virol. 2017, 91, e01521-16. [Google Scholar] [CrossRef] [Scilit]
- Yang, H.; Zhang, J.; Zhang, X.; Shi, J.; Pan, Y.; Zhou, R.; Li, G.; Li, Z.; Cai, G.; Wu, Z. CD163 knockout pigs are fully resistant to highly pathogenic porcine reproductive and respiratory syndrome virus. Antivir. Res. 2018, 151, 63–70. [Google Scholar] [CrossRef] [Scilit]
- Whitworth, K.M.; Rowland, R.R.R.; Ewen, C.L.; Trible, B.R.; Kerrigan, M.A.; Cino-Ozuna, A.G.; Samuel, M.S.; Lightner, J.E.; McLaren, D.G.; Mileham, A.J.; et al. Gene-edited pigs are protected from porcine reproductive and respiratory syndrome virus. Nat. Biotechnol. 2016, 34, 20–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prather, R.S.; Wells, K.D.; Whitworth, K.M.; Kerrigan, M.A.; Samuel, M.S.; Mileham, A.; Popescu, L.N.; Rowland, R.R.R. Knockout of maternal CD163 protects fetuses from infection with porcine reproductive and respiratory syndrome virus (PRRSV). Sci. Rep. 2017, 7, 13371. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Shen, L.; Chen, J.; Liu, X.; Tan, T.; Hu, Y.; Bai, X.; Li, Y.; Tian, K.; Ning Li, N.; et al. Deletion of CD163 Exon 7 Confers Resistance to Highly Pathogenic Porcine Reproductive and Respiratory Viruses on Pigs. Int. J. Biol. Sci. 2019, 15, 1993–2005. [Google Scholar] [CrossRef] [Scilit]
- Ren, Y.W.; Zhang, Y.Y.; Affara, N.A.; Sargent, C.A.; Yang, L.G.; Zhao, J.L.; Fang, L.R.; Wu, J.J.; Fang, R.; Tong, Q.; et al. The polymorphism analysis of CD169 and CD163 related with the risk of porcine reproductive and respiratory syndrome virus (PRRSV) infection. Mol. Biol. Rep. 2012, 39, 9903–9909. [Google Scholar] [CrossRef] [Scilit]
- Lim, B.; Khatun, A.; Kim, S.W.; Nazki, S.; Jeong, C.G.; Gu, S.; Lee, J.; Lee, K.T.; Park, C.K.; Lee, S.M.; et al. Polymorphisms in the porcine CD163 associated with response to PRRSV infection. Anim. Genet. 2017, 49, 98–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, Q.; Dunkelberger, J.; Lim, K.S.; Lunney, J.K.; Tuggle, C.K.; Raymond, R.R.; Rowland, R.R.R.; Jack, C.M.; Dekkers, J.C.M. Associations of natural variation in the CD163 and other candidate genes on host response of nursery pigs to porcine reproductive and respiratory syndrome virus infection. J. Anim. Sci. 2021, 99, skab274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Knap, P.W.; Doeschi-Wilson, A. Why breed disease-reslient livestock, and how? Genet. Sel. Evol. 2020, 52, 60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, T.; Nan, Y.; Xiao, S.; Zhao, Q.; Zhou, E.-M. Antiviral Strategies against PRRSV Infection. Trends Microbiol. 2017, 25, 968. [Google Scholar] [CrossRef] [Scilit]
- You, X.; Li, G.; Lei, Y.; Xu, Z.; Zhang, P.; Yang, Y. Role of genetic factors in different swine breeds exhibiting varying levels of resistance/susceptibility to PRRSV. Virus Res. 2023, 326, 199057. [Google Scholar] [CrossRef] [Scilit]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program forWindows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Stephens, M.; Donnelly, P. A comparison of bayesian methods for allele reconstruction from population genotype data. Am. J. Hum. Genet. 2003, 73, 1162–1169. [Google Scholar] [CrossRef] [Scilit]
- Shen, J.; Li, Z.; Chen, J.; Song, Z.; Zhou, Z.; Shi, Y. SHEsisPlus, a toolset for genetic studies on polyploid species. Sci. Rep. 2016, 6, 24095. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Zhang, Z.; He, Z.; Tang, W.; Li, T.; Zeng, Z.; He, L.; Shi, Y. A partition-ligationcombination- subdivision EM algorithm for haplotype inference with multiallelic markers: Update of the SHEsis (http://analysis.bio-x.cn). Cell Res. 2009, 19, 519–523. [Google Scholar] [CrossRef] [Scilit]
- Shi, Y.Y.; He, L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res. 2005, 15, 97–98. [Google Scholar] [CrossRef] [Scilit]
- Sole, X.; Guino, E.; Valls, J.; Iniesta, R.; Moreno, V. SNPStats: A web tool for the analysis of association studies. Bioinformatics 2006, 22, 1928–1929. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Altman, D.G. Practical Statistics for Medical Research; Chapman and Hall/CRC: London, UK, 1991. [Google Scholar]
- Haldane, J.B.S. The mean and variance of the moments of chi-squared when used as a test of homogeneity, when expectations are small. Biometrika 1940, 29, 133–134. [Google Scholar]
- Pena, R.N.; Fernández, C.; Blasco-Felip, M.; Fraile, L.J.; Estany, J. Genetic Markers Associated with Field PRRSV-Induced Abortion Rates. Viruses 2019, 11, 706. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arjin, C.; Tateing, S.; Potapohn, N.; Arunorat, J.; Pringproa, K.; Lumsangkul, C.; Seel-Audom, M.; Ruksiriwanich, W.; Sringarm, K. Brazilin from Caesalpinia sappan inhibits viral infection against PRRSV via CD163ΔSRCR5 MARC-145 cells: An in silico and in vitro studies. Sci. Rep. 2022, 12, 21595. [Google Scholar] [CrossRef] [Scilit] [PubMed]
| Target Gene | Primer Sequence 5′--->3′ | Amplicon Length | Reference |
|---|---|---|---|
| CD163 | For TTAATGCCACTGGTTCTGCTC | 1411 bp | Lim et al., 2017 [21] |
| Rev TGCCCTTGAAAGTCTTACATA |
| SNP | SNP ID | Chr | Location 1 | ID Variant | Allele 1 | Allele 2 | Location | Type of Mutation |
|---|---|---|---|---|---|---|---|---|
| c.2494G>A | CD163_SNP1 | 5 | 63,325,006 | rs1107556229 | G | A | Exon 10 | synonymous |
| c.2509G>C | CD163_SNP2 | 5 | 63,326,686 | / | G | C | Exon 11 | synonymous |
| c.2592A>G | CD163_SNP3 | 5 | 63,326,769 | / | A | G | Exon 11 | missense |
| c.2638G>A | CD163_SNP4 | 5 | 63,326,815 | / | G | A | Exon 11 | synonymous |
| c.2935G>A | CD163_SNP5 | 5 | 63,327,893 | rs81215636 | G | A | Exon 12 | synonymous |
| c.2983C>A | CD163_SNP6 | 5 | 63,327,941 | rs81215637 | C | A | Exon 12 | synonymous |
| c.3082C>T | CD163_SNP7 | 5 | 63,328,040 | rs81215638 | C | T | Exon 12 | synonymous |
| c.3121T>C | CD163_SNP8 | 5 | 63,328,079 | rs1111118836 | T | C | Exon 12 | synonymous |
| c.3346G>A | CD163_SNP9 | 5 | 63,330,243 | / | G | A | Exon 14 | 3′ UTR |
| c.3534C>T | CD163_SNP10 | 5 | 63,334,407 | / | C | T | Exon 15 | 3′ UTR |
| c.3547A>G | CD163_SNP11 | 5 | 63,334,420 | / | A | G | Exon 15 | 3′ UTR |
| All Subjects | Healthy | Infected | |||||
|---|---|---|---|---|---|---|---|
| SNP | Allele | Count | Frequency * | Count | Frequency * | Count | Frequency * |
| G2494A | |||||||
| G | 564 | 0.75 | 506 | 0.75 | 58 | 0.72 | |
| A | 190 | 0.25 | 168 | 0.25 | 22 | 0.28 | |
| G2509C | |||||||
| G | 461 | 0.61 | 424 | 0.63 | 37 | 0.46 | |
| C | 293 | 0.39 | 250 | 0.37 | 43 | 0.54 | |
| A2592G | |||||||
| A | 558 | 0.74 | 499 | 0.74 | 59 | 0.74 | |
| G | 196 | 0.26 | 175 | 0.26 | 21 | 0.26 | |
| G2638A | |||||||
| G | 642 | 0.85 | 568 | 0.84 | 74 | 0.92 | |
| A | 112 | 0.15 | 106 | 0.16 | 6 | 0.08 | |
| G2935A | |||||||
| G | 749 | 0.99 | 671 | 1.00 | 78 | 0.98 | |
| A | 5 | 0.01 | 3 | 0.00 | 2 | 0.02 | |
| C2983A | |||||||
| C | 749 | 0.99 | 671 | 1.00 | 78 | 0.98 | |
| A | 5 | 0.01 | 3 | 0.00 | 2 | 0.02 | |
| C3082T | |||||||
| C | 640 | 0.85 | 567 | 0.84 | 73 | 0.91 | |
| T | 114 | 0.15 | 107 | 0.16 | 7 | 0.09 | |
| C3121T | |||||||
| T | 535 | 0.71 | 481 | 0.71 | 54 | 0.68 | |
| C | 219 | 0.29 | 193 | 0.29 | 26 | 0.32 | |
| G3346A | |||||||
| G | 627 | 0.83 | 555 | 0.82 | 72 | 0.9 | |
| A | 127 | 0.17 | 119 | 0.18 | 8 | 0.1 | |
| C3534T | |||||||
| C | 450 | 0.6 | 408 | 0.61 | 42 | 0.52 | |
| T | 304 | 0.4 | 266 | 0.39 | 38 | 0.48 | |
| G3547A | |||||||
| A | 545 | 0.72 | 488 | 0.72 | 57 | 0.71 | |
| G | 209 | 0.28 | 186 | 0.28 | 23 | 0.29 | |
| SNP Genotype | Healthy Pigs | Infected Pigs | OR (95% CI) | p-Value |
|---|---|---|---|---|
| G2494A | ||||
| G/G | 190 (56.4%) | 20 (50%) | 1.00 | 0.64 |
| G/A | 126 (37.4%) | 18 (45%) | 1.36 (0.69–2.67) | |
| A/A | 21 (6.2%) | 2 (5%) | 0.90 (0.20–4.14) | |
| G2509C | ||||
| G/G | 144 (42.7%) | 13 (32.5%) | 1.00 | 0.0054 |
| G/C | 136 (40.4%) | 11 (27.5%) | 0.90 (0.39–2.07) | |
| C/C | 57 (16.9%) | 16 (40%) | 3.11 (1.41–6.88) | |
| A2592G | ||||
| A/A | 183 (54.3%) | 20 (50%) | 1.00 | 0.42 |
| A/G | 133 (39.5%) | 19 (47.5%) | 1.31 (0.67–2.55) | |
| G/G | 21 (6.2%) | 1 (2.5%) | 0.44 (0.06–3.41) | |
| G2638A | ||||
| G/G | 231 (68.5%) | 34 (85%) | 1.00 | 0.022 |
| G/A | 106 (31.4%) | 6 (15%) | 0.38 (0.16–0.94) | |
| G2935A | ||||
| G/G | 334 (99.1%) | 38 (95%) | 1.00 | 0.084 |
| G/A | 3 (0.9%) | 2 (5%) | 5.86 (0.95–36.18) | |
| C2983A | ||||
| C/C | 334 (99.1%) | 38 (95%) | 1.00 | 0.084 |
| C/A | 3 (0.9%) | 2 (5%) | 5.86 (0.95–36.18) | |
| C3082T | ||||
| C/C | 230 (68.2%) | 33 (82.5%) | 1.00 | 0.052 * |
| C/T | 107 (31.8%) | 7 (17.5%) | 0.46 (0.20–1.06) | |
| C3121T | ||||
| T/T | 170 (50.5%) | 17 (42.5%) | 1.00 | 0.6 |
| C/T | 141 (41.8%) | 20 (50%) | 1.42 (0.72–2.81) | |
| C/C | 26 (7.7%) | 3 (7.5%) | 1.15 (0.32–4.21) | |
| G3346A | ||||
| G/G | 221 (65.6%) | 32 (80%) | 1.00 | 0.13 |
| G/A | 113 (33.5%) | 8 (20%) | 0.49 (0.22–1.10) | |
| A/A | 3 (0.9%) | 0 (0%) | 0.00 (0.00–NA) | |
| C3534T | ||||
| C/C | 132 (39.2%) | 17 (42.5%) | 1.00 | 0.0039 |
| C/T | 144 (42.7%) | 8 (20%) | 0.43 (0.18–1.03) | |
| T/T | 61 (18.1%) | 15 (37.5%) | 1.91 (0.89–4.07) | |
| G3547A | ||||
| A/A | 175 (51.9%) | 19 (47.5%) | 1.00 | 0.69 |
| G/A | 138 (41%) | 19 (47.5%) | 1.27 (0.65–2.49) | |
| G/G | 24 (7.1%) | 2 (5%) | 0.77 (0.17–3.50) | |
| Genotype | Infected Pigs (N) | Healthy Pigs (N) | OR | 95% CI | p-Value ** |
|---|---|---|---|---|---|
| (16,30) | 6 | 57 | 0.351 | 0.127–0.973 | 0.0442 |
| (3,9) | 1 | 46 | 0.072 | 0.009–0.571 | 0.0130 |
| (3,16) | 0 | 38 | 0.042 * | 0.002–0.729 | 0.0300 |
| (9,30) | 3 | 29 | 0.345 | 0.092–1.293 | 0.1143 |
| (3,30) | 6 | 14 | 1.429 | 0.468–4.365 | 0.5314 |
| (30,30) | 1 | 18 | 0.185 | 0.023–1.504 | 0.1146 |
| (9,16) | 0 | 16 | 0.099 * | 0.006–1.742 | 0.1139 |
| (2,30) | 0 | 6 | 0.251 * | 0.013–4.704 | 0.355 |
| (16,19) | 0 | 4 | 0.362 * | 0.018–7.104 | 0.5035 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Torricelli, M.; Fratto, A.; Ciullo, M.; Sebastiani, C.; Arcangeli, C.; Felici, A.; Giovannini, S.; Sarti, F.M.; Sensi, M.; Biagetti, M. Porcine Reproductive and Respiratory Syndrome (PRRS) and CD163 Resistance Polymorphic Markers: What Is the Scenario in Naturally Infected Pig Livestock in Central Italy? Animals 2023, 13, 2477. https://doi.org/10.3390/ani13152477
Torricelli M, Fratto A, Ciullo M, Sebastiani C, Arcangeli C, Felici A, Giovannini S, Sarti FM, Sensi M, Biagetti M. Porcine Reproductive and Respiratory Syndrome (PRRS) and CD163 Resistance Polymorphic Markers: What Is the Scenario in Naturally Infected Pig Livestock in Central Italy? Animals. 2023; 13(15):2477. https://doi.org/10.3390/ani13152477
Chicago/Turabian StyleTorricelli, Martina, Anna Fratto, Marcella Ciullo, Carla Sebastiani, Chiara Arcangeli, Andrea Felici, Samira Giovannini, Francesca Maria Sarti, Marco Sensi, and Massimo Biagetti. 2023. "Porcine Reproductive and Respiratory Syndrome (PRRS) and CD163 Resistance Polymorphic Markers: What Is the Scenario in Naturally Infected Pig Livestock in Central Italy?" Animals 13, no. 15: 2477. https://doi.org/10.3390/ani13152477
APA StyleTorricelli, M., Fratto, A., Ciullo, M., Sebastiani, C., Arcangeli, C., Felici, A., Giovannini, S., Sarti, F. M., Sensi, M., & Biagetti, M. (2023). Porcine Reproductive and Respiratory Syndrome (PRRS) and CD163 Resistance Polymorphic Markers: What Is the Scenario in Naturally Infected Pig Livestock in Central Italy? Animals, 13(15), 2477. https://doi.org/10.3390/ani13152477

