Next Article in Journal
Effects of Melatonin and Silymarin on Reactive Oxygen Species, Nitric Oxide Production, and Sperm Viability and Motility during Sperm Freezing in Pigs
Next Article in Special Issue
Effects of Replacing Soybean Meal Protein with Chlorella vulgaris Powder on the Growth and Intestinal Health of Grass Carp (Ctenopharyngodon idella)
Previous Article in Journal
Foraging and Food Selection in a Desert Rodent: Diet Shifts of the Sandy Inland Mouse between Population Booms and Busts
Previous Article in Special Issue
Digestibility of Conventional and Novel Dietary Lipids in Channel Catfish Ictalurus punctatus
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary Fishmeal Can Be Partially Replaced with Non-Grain Compound Proteins through Evaluating the Growth, Biochemical Indexes, and Muscle Quality in Marine Teleost Trachinotus ovatus

1
University Joint Laboratory of Guangdong Province, Hong Kong and Macao Region on MBCE, College of Marine Sciences, South China Agricultural University, Guangzhou 510642, China
2
Guangdong Provincial Key Laboratory of Marine Biotechnology, Shantou University, Shantou 515063, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Animals 2023, 13(10), 1704; https://doi.org/10.3390/ani13101704
Submission received: 23 April 2023 / Revised: 12 May 2023 / Accepted: 19 May 2023 / Published: 21 May 2023

Simple Summary

The application of more inedible ingredients in aquafeeds will contribute to sustainable development and alleviate food security. The rising prices and declining yields of traditional aquafeed protein sources such as fishmeal and soybean meal are hindering the development of aquaculture. Therefore, in this study, bovine bone meal, dephenolized cottonseed protein, and blood cell meal were utilized to replace dietary fishmeal in the form of compound protein. Culture trials were conducted on the economically farmed fish, juvenile golden pompano, and the feasibility and suitable ratio of non-grain proteins for application in aquafeeds were evaluated by indicators such as growth performance and muscle quality. The results of this study provide data support for the development of new aquafeeds with less fishmeal and high efficiency, which can help alleviate the shortage of aquafeed feedstuff, and provide theoretical and data references for the study of securing a sustainable food supply.

Abstract

In the context of human food shortages, the incorporation of non-grain feedstuff in fish feed deserves more research attention. Here, the feasibility and appropriate ratio of non-grain compound protein (NGCP, containing bovine bone meal, dephenolized cottonseed protein, and blood cell meal) for dietary fishmeal (FM) replacement were explored in golden pompano (Trachinotus ovatus). Four isonitrogenous (45%) and isolipidic (12%) diets (Control, 25NGP, 50NGP, and 75NGP) were prepared. Control contained 24% FM, whereas the FM content of 25NGP, 50NGP, and 75NGP was 18%, 12%, and 6%, respectively, representing a 25%, 50%, and 75% replacement of FM in Control by NGCP. Juvenile golden pompano (initial weight: 9.71 ± 0.04 g) were fed the four diets for 65 days in sea cages. There was no significant difference between the 25NGP and Control groups in terms of weight gain, weight gain rate, and specific growth rate; contents of crude protein, crude lipid, moisture, and ash in muscle and whole fish; muscle textural properties including hardness, chewiness, gumminess, tenderness, springiness, and cohesiveness; and serum biochemical indexes including total protein, albumin, blood urea nitrogen, HDL cholesterol, total cholesterol, and triglycerides. However, the golden pompano in 50NGP and 75NGP experienced nutritional stress, and thus some indicators were negatively affected. In addition, compared to the Control group, the expression levels of genes related to protein metabolism (mtor, s6k1, and 4e-bp1) and lipid metabolism (pparγ, fas, srebp1, and acc1) of the 25NGP group showed no significant difference, but the 4e-bp1 and pparγ of the 75NGP group were significantly upregulated and downregulated, respectively (p < 0.05), which may explain the decline in fish growth performance and muscle quality after 75% FM was replaced by NGCP. The results suggest that at least 25% FM of Control can be replaced by NGCP, achieving a dietary FM content of as low as 18%; however, the replacement of more than 50% of the dietary FM negatively affects the growth and muscle quality of golden pompano.

1. Introduction

The global population is estimated to grow by 50% by 2050, doubling the demand for animal protein; the existing food productivity will not be able to meet such an enormous demand [1]. Aquaculture is an essential component of food production, and aquaculture species represent a source of nutrition and healthy proteins for humans [2]. Aquatic animals tend to have higher feed efficiency than livestock and poultry, which facilitates a higher feed conversion ratio and contributes to a sustainable supply of protein for humans in the future [3]. Due to its rich nutritional value and balanced amino acid composition, fishmeal (FM) is often added to aquafeeds, especially feeds for carnivorous marine teleosts [4]. However, in recent years, with the depletion of wild fishery resources worldwide, the production of capture fisheries has been decreasing every year, whereas the production of FM has decreased, and its price has increased [5]. Currently, soybean meal and corn gluten meal are the traditional feed protein sources being widely used in feed production [6]. However, in the future, grain products such as soybean meal and corn, which are sources of human edible protein (HEP), may be more required for human consumption [7]. HEP is defined as protein that has a sufficiently high nutritional value and can be consumed by humans; humans are in competition with animals for the use of HEP sources [7]. It has been reported that approximately 60% of globally produced protein is used for animal and fish feed, and a large range of underutilized non-food proteins are worthy of full consideration as alternative proteins [8]. In addition, the increasing prices and decreasing availability of FM and soybean necessitate the search for additional protein sources with high nutritional value and low cost for aquafeeds [9,10]. The incorporation of more non-grain proteins in aquatic feeds would help restructure the current feed composition and alleviate the potential food crisis.
In fact, many by-products of animal and plant production have a high nutritional value, but are not fully utilized in aquatic feeds. For example, cottonseed meal, a by-product of oilseed crops and fibers (55–68% protein content) [11], is the common protein source for poultry feed [12]. In recent years, it has received attention as an alternative protein to FM in aquafeeds, such as rainbow trout (Oncorhynchus mykiss) [13], large yellow croaker (Larimichthys crocea) [14], sturgeon (Acipenser schrenckii) [15], etc., but due to the toxic effects of free cottonseed on fish, the high percentage of addition may affect the growth and health of fish. According to statistics, in 2020, the global meat production was approximately 252.6 billion kg, including 57.7 billion kg of beef, 99.1 billion kg of chicken, and 95.8 billion kg of pork [16], while the meat industry produces several by-products during slaughter and processing, such as blood, bones, skin, organs, internal organs, horns, hooves, feet, and skulls [17]. Among them, blood meal—a product of fresh blood obtained from slaughtered food animals processed using high-temperature cooking, sterilization, and drying—has a protein content of 90–95% [18]. Currently, blood meal has been reported In FM replacement studies for totoaba (Totoaba macdonaldi) [19], rainbow trout [20], and Atlantic salmon (Salmo salar L.) [21], and its low digestibility is the main limiting factor for its application. In addition, bovine bone meal, a type of meat and bone meal—obtained from livestock by-products such as unconsumable bones using heating, drying, and crushing—has the advantages of high protein content and low price [22]. However, meat and bone meal has also been reported to have low apparent digestibility in mandarin fish (Siniperca chuatsi) [23]. In general, the above reports demonstrate that the high substitution of these proteins for fishmeal in aquafeeds reduces the growth and muscle quality of fish and even endangers their health. Therefore, how to rationally use these non-grain protein sources to replace FM in aquatic formula feed has become a key problem in FM substitution applications.
The golden pompano (Trachinotus ovatus), a carnivorous marine teleost, is mainly distributed in the Indian Ocean, China Sea, off the coasts of Indonesia, Australia, and Japan, tropical and temperate Atlantic waters of America, and off the west coast of Africa [24]. Because of its high nutritional value, stress resistance, and survival rate, golden pompano is widely farmed along the southern coast of East Asia [25], and its annual production in China is more than 150 million kg [26]. The aquaculture of this fish is highly dependent on FM, and the FM content in its commercial feed is typically more than 30%, which greatly limits the sustainability and economic benefits of its aquaculture [24]. Therefore, many studies have focused on FM substitution in golden pompano feed. Wu et al. reported that the use of soybean protein concentrate, together with supplementation with selenium yeast to the feed, can reduce the percentage of FM to 24% [27]. Shen et al. discovered that dietary FM could be reduced to 13.60% with cottonseed protein concentrate without affecting the weight gain rate [28]. However, Fu et al. found that the replacement of more than 20% of FM in the diet by low-gossypol cottonseed meal resulted in impaired intestinal barrier function in golden pompano [29]. Similarly, Qin et al. found that the use of cottonseed meal could only reduce the feed FM content to 20% without affecting the growth of golden pompano [30] and that the fish muscle nutritive deposition was negatively affected when the feed FM was below 15% [31]. The several different results mentioned above may correlate with the level of detoxification of cottonseed protein. Notably, a previous study in our laboratory found that the high percentage of FM in the diet of golden pompano could be substituted with a terrestrial compound protein, reducing the FM content to 6% without negatively affecting growth performance [32]. This finding suggests that compound protein replacing FM in aquatic feed has a better culture effect than single protein replacing FM, which prompted us to investigate whether non-grain compound protein (NGCP) could be used in the feed of golden pompano, which may help solve the current problem of protein shortage in aquafeed.
In the present study, a source of NGCP was formulated to replace dietary FM in golden pompano feed in different proportions. After a 65-day rearing trial, the feasibility of application and suitable ratio of this NGCP were determined by evaluating the growth index, proximate composition, serum biochemical indexes, muscle quality, and protein and lipid metabolism gene mRNA expression levels of fish in each group. In this study, three common non-food proteins (bovine bone meal, dephenolized cottonseed protein, and blood cell meal) were innovatively applied to marine carnivorous fish feeds in the form of compound proteins, and the possible mechanisms for the differences in growth and muscle quality of cultured animals were analyzed from the perspectives of muscle protein metabolism and lipid metabolism.

2. Materials and Methods

2.1. Experimental Diets

Here, a NGCP containing dephenolized cottonseed protein, bovine bone meal, and blood cell meal (in the ratio 5:3:2) was used as an ingredient in three of four isonitrogenous (45%) and isolipidic (12%) diets (Control, 25NGP, 50NGP, and 75NGP), replacing 0%, 25%, 50%, and 75% of FM in each diet, respectively. Control contained 24% FM, whereas the FM in 25NGP, 50NGP, and 75NGP was reduced to 18%, 12%, and 6%, respectively, owing to its replacement with NGCP. The basic protein sources in each diet were soybean protein concentrate, poultry meal, corn gluten meal, and fermented soybean meal. The lipid source in each diet was an oil blend designed for golden pompano feed previously developed in our laboratory, mainly formulated with fish oil, soybean oil, rapeseed oil, perilla oil, phospholipids, and small quantities of emulsifiers and antioxidants [33]. The specific ratios and basic nutrition composition of the four diets have been shown in Table 1. The preparation process of diets and the equipment used in this study were according to Ma et al. [32]. After pelleting, all feeds were placed in a room at 17 °C for about 3 days until dried, then sealed and stored in a freezer at 20 °C.
The dietary amino acid composition and fatty acid profile are shown in Table 2 and Table 3, respectively.

2.2. Animal and Breeding Management

The juvenile golden pompano (approximately 2 g) for this experiment were purchased from a local fish hatchery (Shantou, China) and subsequently temporarily housed in an offshore net (2 m × 2 m × 1.5 m. L/W/H) at the Nan’ao Marine Biological Station (NAMBS) of Shantou University until trials. During the acclimatization, the juvenile fish were fed with commercial feed (Guangdong Yuehai Feed Co., Ltd., Jiangmen, China) for about 6 weeks. Before the trial, the fish (initial weight: 9.71 ± 0.04 g) were gathered up. For each replicate, 30 fish were randomly selected to be anesthetized with 0.01% 2-phenoxyethanol and weighed; three replicates were established in each group. In the 65-day rearing trial, golden pompano were fed twice daily at 6:00 a.m. and 5:00 p.m. until they did not scramble at the water surface; the seawater temperature was 24–30 °C and salinity was 28–31% during the trial.

2.3. Sample Collection

Before sampling, the fish in each experimental group were fasted for 24 h. In each net cage, four fish were caught at random for anesthesia; subsequently, serum and muscle tissue samples (12 samples per group) were collected and preserved in liquid nitrogen. Another four fish were caught from each net (12 fish per group) for the determination of muscle textural properties and body composition. Finally, all the remaining fish in the nets were retrieved, counted, and weighed.

2.4. Proximate Composition and Serum Biochemical Index Assays

The crude protein, crude lipid, ash, and moisture content of the diets, whole fish, and tissue in this experiment were referred to the standard methods of the Association of Official Analytical Chemists, and a specific determination procedure was carried out with reference to that described by Ma et al. [32]. Of these, feed samples were measured in three replicates per group, while whole fish and tissue samples were measured in six replicates per group.
Among the biochemical indexes of serum in this experiment, the indexes related to protein metabolism, such as TP, ALB, and BUN content, and the indexes related to lipid metabolism, such as TG, T-CHO, HDL cholesterol, and LDL cholesterol, were determined by assay kits (Nanjing Jiancheng Bioengineering Co., Ltd., Nanjing, China) using a microplate reader (BilTek Instruments, Inc., Winooski, VT, USA), and six samples of each group were measured as replicates for the above indexes.

2.5. Amino Acid and Fatty Acid Composition Assays

The dietary amino acid composition in this experiment was assayed according to the acid hydrolysis method [34]. In brief, first, 10 mL of 6 mol/L HCl was added to the sample (6 replicates per group) and hydrolyzed at 110 °C for 22 h. Subsequently, the samples were filtered through filter paper and dried in a water bath (65 °C); the residual HCl was eluted with double-distilled water, and the procedure was repeated twice. Finally, 4 mL of the buffer (pH = 2.2) was added, and the samples were loaded into the injection vials and assessed with an analysis system (L-8900, Hitachi, Tokyo, Japan).
The diets and tissue fatty acid composition in this experiment were assayed with reference to previously published methods of our research group [32]. As replicates, three feed samples and six tissue samples per group were measured after extracting the lipid from the samples by soaking them in the chloroform/methanol (2:1) solution for 24 h in centrifuge tube I. Then, the chloroform layer was mixed well with distilled water and aspirated into centrifuge tube II, and the crude lipid samples were blown dry with N2 in a water bath (45 °C). The samples were saponified by adding the 0.5 M KOH–methanol solution into centrifuge tube II and shaking in a water bath (65 °C) for 1 h. Then the centrifuge tube II was added with anhydrous methanol and boron trifluoride methanol solution, and subsequently placed in a water bath (72 °C) for 45 min. Hexane and saturated saline were added to dissolve fatty acid methyl esters and centrifuged at 12,000 rpm, then 500 µL of supernatant was transferred to a brown injection bottle and assessed using gas chromatography (7890B, Agilent, Palo Alto, CA, USA).

2.6. Textural Properties Assays

The test method for the textural properties of muscle was performed with reference to the operational procedure described by Ma et al. [32], in which six samples per group were measured as replicates. Firstly, thin slices of uniform width and thickness (approximately 2.0 cm × 2.0 cm × 0.5 cm) were cut out of the fresh fish dorsal muscle (6 samples per group). Subsequently, all samples were assessed with a texture analyzer (Shanghai turnkey pull, Shanghai, China).

2.7. Real-Time Quantitative PCR Assay

Firstly, the total RNA extraction kit (BioFlux, Beijing, China) was used to extract the total RNA from the muscle (6 replicates per group). All samples were diluted to achieve the same RNA concentration. RNA reverse transcription was carried out using the PrimeScript TMRT reagent kit (Takara, Tokyo, Japan). The primers used in this experiment are shown in Table 4. The qRT-PCR was assayed by SYBR® Green Master Mix (Toyobo Co., Ltd., Osaka, Japan) with a CFX Connect Real-Time System (Bio-Rad Laboratories, Inc., Hercules, CA, USA), which was previously described by Zhang et al. [33]. Finally, statistical analysis of all data was carried out with the 2−ΔΔCT method.

2.8. Estimation and Statistical

The following formulas were used to estimate the below indicators:
Weight gain (WG, g) = final body weight (g) − initial body weight (g)
Weight gain rate (WGR, %) = 100 × [final body weight (g) − initial body weight (g)/initial body weight (g)]
Specific growth rate (SGR, %/day) = 100 × [ ln final weight (g) − ln initial weight (g)]/days of feeding trial
Feed conversion ratio (FCR) = dry feed consumed (g)/wet weight body gain (g)
Survival rate (SR, %) = 100 × (final fish number/initial fish number)
Viscerosomatic index (VSI, %) = 100 × [viscera wet weight (g)/final body weight (g)]
Hepatosomatic index (HSI, %) = 100 × [liver wet weight (g)/final body weight (g)]
Condition factor (CF, g/cm−3) = 100 × [final body weight (g)/body length (cm)3]
The data of this trial were expressed as mean ± SEM. One-way ANOVA was used to analyze the data in this trial with SPSS software (Ver 22.0, International Business Machines Co., Ltd., Armonk, NY, USA). The Tukey’s multiple comparison method was utilized to analyze the significance of differences between groups, and p < 0.05 means that the data was significantly different.

3. Results

3.1. Growth and Somatic Indexes

Table 5 shows that the survival of each group was 100%, and the CF was not significantly different among all groups. Compared to the Control group (24% FM), the WG, WGR, SGR, and FCR of the 25NGP group (18% FM) showed no significant difference, whereas the WG, WGR, and SGR of the 50NGP (12% FM) group and the 75NGP (6% FM) group significantly decreased and the FCR significantly increased (p < 0.05). Moreover, the VSI and HSI of the 25NGP–75NGP groups were not significantly different from those of the Control group. Furthermore, the VSI of 25NGP was significantly decreased compared to that of the 50NGP and 75NGP groups, while the HSI of 25NGP showed a significant decrease compared to that of the 75NGP group (p < 0.05). The above results indicate that the substitution of 25% of dietary FM with NGCP is feasible, without affecting the growth and somatic indexes of golden pompano.

3.2. Whole-Body and Muscle Proximate Composition

Table 6 shows that there was no significant difference in all indexes of whole-body and muscle proximate composition between the 25NGP and Control groups. However, compared to the Control group, the muscle crude lipid content in the 75NGP group was significantly decreased, and the whole-body ash content and muscle moisture content were significantly increased (p < 0.05). Besides, the whole-body ash content of the 25NGP group was significantly decreased compared to the 75NGP group, while the muscle crude lipid content of the 25NGP group was significantly increased compared to the 50NGP and 75NGP groups (p < 0.05). The above results indicate that the substitution of 25% FM with NGCP had no negative impacts on the proximate composition of golden pompano.

3.3. Serum Biochemical Indexes

Figure 1 showed that, compared to the Control group, the TP, ALB, and BUN levels of the 25NGP group had no significant difference, whereas the TP and ALB levels of the 50NGP and 75NGP groups were significantly higher (p ˂ 0.05). In addition, the TP level of the 25NGP group was significantly lower than the 75NGP group, and the ALB level of the 25NGP group was significantly lower than the 50NGP and 75NGP groups (p ˂ 0.05).
In serum lipid metabolism indexes, compared to the Control group, the T-CHO and TG levels of the 25NGP group were not significantly different, but T-CHO levels in the 50NGP group, TG levels in group 75NGP, and LDL-C levels in groups 25NGP and 50NGP were significantly higher (p ˂ 0.05). The HDL-C levels in each group had no significant difference.

3.4. Textural Properties

The muscle textural properties of the juvenile golden pompano are shown in Figure 2. The muscle hardness, chewiness, and gumminess in each group showed no significant difference. Compared to the Control group, the tenderness, springiness, and cohesiveness of the 25NGP group were not significantly different, whereas the tenderness of the 75NGP group was significantly decreased. Furthermore, the tenderness of the 25NGP group was significantly higher than that of the 50NGP and 75NGP groups (p < 0.05). The above results indicate that the substitution of 25% FM with NGCP had no negative impact on the muscle textural properties of golden pompano.

3.5. Fatty Acid Composition in Muscle

Table 7 shows that, compared to the Control group, the muscle n-3 PUFA content in the 25NGP-75NGP groups was significantly decreased, and the 75NGP group was significantly decreased compared to the 25NGP-50NGP groups (p < 0.05). The muscle n-6 PUFA content of the 25NGP-50NGP groups was not significantly different from the Control group, whereas the 75NGP group was significantly decreased (p < 0.05). In addition, the muscle SFA and MUFA content in each group showed no significant differences.

3.6. Protein Metabolism in Muscle

Figure 3 shows that, compared to the Control group, the mRNA expression of 4e-bp1 in the 25NGP and 50NGP groups had no significant difference, but the 75NGP group was significantly up-regulated (p < 0.05). Moreover, the mRNA expression of mtor and s6k1 in each group had no significant differences. The above results indicate that the substitution of 50% FM with NGCP did not negatively affect the protein metabolism of golden pompano.

3.7. Lipid Metabolism in Muscle

Figure 4 showed that, compared to the Control group, the mRNA expression of pparγ in the 25NGP–50NGP groups had no significant difference, but the 75NGP group was significantly down-regulated (p < 0.05). Moreover, there was no significant difference in the mRNA expression of fas, srebp1, and acc1 among all groups. The above results indicate that the substitution of 50% FM with NGCP had no negative effects on the lipid metabolism of juvenile golden pompano.

4. Discussion

Those inexpensive and widely available animal and plant processing by-products should be considered more to replace FM and soybean meal in aquafeeds. Previously, spray-dried blood cell meal was proven to be a viable alternative to FM in the diet of whiteleg shrimp (Litopenaeus vannamei), but the percentage of substitution should not be higher than 60%; otherwise, the growth performance was reduced [36]. Moreover, a study on ussuri catfish (Pseudobagrus ussuriensis) found that growth performance was significantly reduced, while 40% of dietary FM was replaced by meat and bone meal [37]. These studies suggest that the replacement of high percentages of FM in aquafeeds by a particular feed protein is difficult because it affects the growth of aquatic animals. In the present study, bovine bone meal, dephenolized cottonseed protein, and blood cell meal were used to produce an NGCP to replace FM in the feed of golden pompano. After 65 days of culture trials, the survival rate of all groups was found to be 100%, indicating that all feeds were safe for fish. Furthermore, the growth indexes of fish in the 25NGP group were not affected when 25% dietary FM was substituted with NGCP, which proved that the incorporation of non-grain proteins in golden pompano feed was feasible. These findings were comparable to previous reports on the replacement of FM by compound proteins in aquafeeds; for example, a study performed on gibel carp (Carassius auratus gibelio) found that the entire FM in the feed could be replaced by compound plant protein without reducing growth performance [38]. Similarly, the replacement of dietary FM with a mixture of shrimp hydrolysate and plant proteins did not diminish the growth of largemouth bass (Micropterus salmoides), and the weight gain reached its maximum at the replacement ratio of 22.2% [39]. These studies illustrated that the application of non-grain mixed proteins in fish feeds was superior compared to those containing single proteins. Regarding growth indicators as a reference, the dietary FM of golden pompano could be reduced to 18% by NGCP substitution.
The muscle quality and serum indexes are also important aspects in assessing the feasibility of NGCP application in feeds. In terms of muscle quality, first, the textural properties of muscle determine the physical properties and affect the taste of food [40]. The results of this study showed that 25% and 50% FM replacement by NGCP had no negative effect on muscle tenderness, hardness, springiness, chewiness, gumminess, or cohesiveness in fish. Moreover, the proximate composition of whole fish and muscle signifies the edibility of fish products [41]. In this study, the substitution of 25% and 50% dietary FM with NGCP had no negative impact on the whole-body or muscle proximate composition. Therefore, regarding nutritional value, it is feasible to reduce the proportion of FM in golden pompano feed to at least 12% using NGCP as a replacement. On the other hand, serum biochemical indexes are also used to assess the health and nutritional metabolism of fish [42]. Serum TP—comprising ALB and GLB—has several physiological roles, such as maintaining the osmotic pressure and pH of blood vessels, transporting metabolites of the body, regulating transported substances, and being an important indicator of feed protein absorption and metabolism [43]. Serum HDL-C and LDL-C are responsible for the transport of cholesterol between the liver and blood or tissues [44,45], and the levels of TG and T-CHO are closely associated with excessive liver lipid deposition [46]. The present findings indicate that serum TP, ALB, TG, T-CHO, and HDL-C showed no significant differences between the group with 25% dietary FM replacement with NGCP and the control group, indicating that this replacement ratio is feasible. The above-mentioned muscle quality and serum biochemical indexes signify the potential and applicability of NGCP in golden pompano feed.
However, there are limitations to the incorporation of NGCP in golden pompano feed. In this study, the substitution of more than 50% dietary FM with NGCP significantly decreased certain indicators of growth performance, muscle quality, and serum biochemical indexes of juvenile fish, which may be related to the following factors.
The content of limiting amino acids (LAA, lysine, and methionine) markedly decreased in the groups with high replacement ratios of dietary FM. It is well known that amino acids can be classified as essential amino acids (EAA) and non-essential amino acids (NEAA), of which EAA are those that are insufficiently synthesized or cannot be synthesized by animals, and they must be provided in the diet to ensure the normal growth of farmed animals [47]. In aquatic animals, lysine [48], methionine [49], and arginine [50] are considered LAA, and their deficiency affects the growth of fish. The dietary amino acid composition in this study showed that lysine and methionine decreased as the ratio of dietary FM replacement by NGCP increased. It has been reported that the levels of dietary arginine [51] and lysine [52] affect the expression of the target of rapamycin (TOR) pathway, which is believed to respond to nutritional status in fish, leading to protein synthesis and growth [53]. The eIF4E-binding protein and ribosomal protein S6 kinase 1 are downstream effectors in the TOR pathway that regulate mTOR activity in an antagonistic manner [54]. In this study, the expression level of 4e-bp1 in muscle was significantly up-regulated when 75% of dietary FM was replaced by NGCP. The study on largemouth bass showed that adding protein hydrolysate to the diet improved the weight gain of fish and activated targets of the TOR pathway, including upregulation of tor and akt1 and downregulation of 4e-bp1 [55]. Similarly, growth performance showed an opposite trend to the expression level of 4e-bp1 in the study of grass carp (Ctenopharyngodon idella) [56]. Therefore, the increased expression of 4e-bp1, an antagonistic factor, may be responsible for the inhibition of protein synthesis in the muscles of the golden pompano, which may contribute to the growth performance results described above.
In this study, diets with low FM showed an imbalance of fatty acid composition; the SFA and MUFA levels increased and the n-3 PUFA levels decreased with the decrease in the dietary FM content. In most marine carnivorous fish, the ability to convert linoleic acid (LA) and linolenic acid (LNA) to highly unsaturated fatty acids (HUFAs) is poor [57]. The golden pompano, a marine carnivorous fish, has a high dietary requirement for n-3 HUFAs to maintain normal growth and metabolism [58]. A deficiency of n-3 HUFAs may lead to abnormalities in physiological functions. In general, the fatty acid deposition of tissue is consistent with dietary fatty acids [59]. Similarly, in this study, the muscle fatty acid composition signified the fatty acid composition of diets, where the SFA content of muscle increased with the proportion of FM substitution, whereas the n-3 PUFA content subsequently decreased. Therefore, the impaired growth of golden pompano mentioned above may also be due to an imbalance of dietary fatty acids. In addition, the imbalance of dietary fatty acids led to the abnormal metabolism of lipid deposition in fish. Several studies have shown that polyunsaturated fatty acids facilitate the activation of PPARγ ligands and promote lipid synthesis [60,61]. PPAR is a ligand-activated receptor in the nuclear hormone receptor family, including PPARα, PPARβ, and PPARγ, which control many cellular metabolic processes, among which PPARγ is primarily involved in the regulation of lipid storage [62]. In this study, the expression levels of pparγ were significantly down-regulated after 75% replacement of dietary FM. This may be due to the decrease in muscle crude lipid when a high percentage of dietary FM was replaced. Similarly, a study performed on grass carp showed that the crude lipid content of muscle was positively related to the expression of pparγ [63]. Moreover, it has been reported that the textural properties of fish may be influenced by the oil source and fatty acid composition of the feed [64]. It has been reported that a higher content of SFAs than unsaturated fatty acids in muscle increases muscle hardness [65]. In addition, the textural properties are affected by the crude lipid content of muscle; for example, muscle hardness tends to increase when the muscle lipid content is low [66]. In this study, muscle tenderness and crude lipid content showed significant reductions when 75% of the dietary FM was replaced by NGCP. This finding was contrary to the previous findings, which may be due to other factors used in this experiment, such as plant protein. A study in Senegalese sole (Solea senegalensis) showed that 100% substitution of dietary FM by mixed plant protein decreased the textural properties of muscle [67], indicating that the addition of plant protein to the feed has a significant effect on the textural properties of fish muscles, and similar findings have been reported in grass carp [68]. In addition, it has been reported that feed lysine levels affect muscle hardness by mediating the development of muscle fibers [69]. Therefore, the low lysine content in plant protein may also be the reason for the reduced muscle quality when a high percentage of FM is substituted. The findings indicate that when the dietary FM was replaced by a high proportion of NGCP, the resulting low n-3 PUFA content in the diet may have led to the above-mentioned decrease in muscle quality, whereas the differences in textural properties may be attributed to certain components of plant proteins, which need to be further analyzed and explored.

5. Conclusions

The present study found that dephenolized cottonseed protein, bovine bone meal, and blood cell meal could be combined to form a compound protein to replace at least 25% of FM in the feed without reducing growth performance or muscle quality, so that the proportion of FM in the diet of golden pompano could be reduced to 18%. However, the imbalance of amino acids and fatty acids in feed caused by high ratio substitution (higher than 50%) might affect the protein and lipid metabolism of muscle. This study provides new ideas to alleviate the shortage of protein sources in aquafeeds and broaden the application of non-grain proteins.

Author Contributions

Conceptualization and methodology, Z.S. and Y.M.; Writing—original draft, Z.S.; Validation, F.C.; Formal analysis, W.A.; Investigation, W.A. and G.Z.; Data curation, G.Z.; Resources and supervision, C.X. and S.W.; Visualization, D.X.; Writing—review & editing, F.C. and D.X.; Project administration and Funding acquisition, Y.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was financially supported by the National Key R&D Program of China (grant number 2018YFD0900400).

Institutional Review Board Statement

All animals were handled in compliance with the requirements of the Animal Care and Use Committee (ACUC). The International Cooperation Committee for Animal Welfare of South China Agricultural University has approved this trial (Approval number: SYXK-2019-0136).

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are contained within the article.

Acknowledgments

The authors sincerely thank the people who provided guidance and suggestions for this research.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Saeed, F.; Afzaal, M.; Khalid, A.; Shah, Y.A.; Ateeq, H.; Islam, F.; Akram, N.; Ejaz, A.; Nayik, G.A.; Shah, M.A. Role of mycoprotein as a non-meat protein in food security and sustainability: A review. Int. J. Food Prop. 2023, 26, 683–695. [Google Scholar] [CrossRef] [Scilit]
  2. Boyd, C.E.; Mcnevin, A.A.; Davis, R.P. The contribution of fisheries and aquaculture to the global protein supply. Food Secur. 2022, 14, 805–827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Tacon, A.; Metian, M. Fish matters: Importance of aquatic foods in human nutrition and global food supply. Rev. Fish. Sci. 2013, 21, 22–38. [Google Scholar] [CrossRef] [Scilit]
  4. NRC. Nutrient Requirements of Fish and Shrimp; National Academies Press: Washington, DC, USA, 2011. [Google Scholar]
  5. Costello, C.; Ovando, D.; Clavelle, T.; Strauss, C.K.; Hilborn, R.; Melnychuk, M.C.; Branch, T.A.; Gaines, S.D.; Szuwalski, C.S.; Cabral, R.B.; et al. Global fishery prospects under contrasting management regimes. Proc. Natl. Acad. Sci. USA 2016, 113, 5125–5129. [Google Scholar] [CrossRef] [Scilit]
  6. Naylor, R.L.; Hardy, R.W.; Buschmann, A.H.; Bush, S.R.; Cao, L.; Klinger, D.H.; Little, D.C.; Lubchenco, J.; Shumway, S.E.; Troell, M. A 20-year retrospective review of global aquaculture. Nature 2021, 591, 551. [Google Scholar] [CrossRef] [Scilit]
  7. Te Pas, M.; Veldkamp, T.; de Haas, Y.; Bannink, A.; Ellen, E.D. Adaptation of livestock to new diets using feed components without competition with human edible protein sources-a review of the possibilities and recommendations. Animals 2021, 11, 2293. [Google Scholar] [CrossRef] [Scilit]
  8. Salter, A.M.; Lopez-Viso, C. Role of novel protein sources in sustainably meeting future global requirements. Proc. Nutr. Soc. 2021, 80, 186–194. [Google Scholar] [CrossRef] [Scilit]
  9. Dawood, M.; Habotta, O.; Elsabagh, M.; Azra, M.N.; Van Doan, H.; Kari, Z.A.; Sewilam, H. Fruit processing by-products in the aquafeed industry: A feasible strategy for aquaculture sustainability. Rev. Aquac. 2022, 14, 1945–1965. [Google Scholar] [CrossRef] [Scilit]
  10. Tallentire, C.W.; Mackenzie, S.G.; Kyriazakis, I. Can novel ingredients replace soybeans and reduce the environmental burdens of European livestock systems in the future? J. Clean. Prod. 2018, 187, 338–347. [Google Scholar] [CrossRef] [Scilit]
  11. Alford, B.B.; Liepa, G.U.; Vanbeber, A.D. Cottonseed protein: What does the future hold? Plant Foods Hum. Nutr. 1996, 49, 1–11. [Google Scholar] [CrossRef] [Scilit]
  12. Swiatkiewicz, S.; Arczewska-Wlosek, A.; Jozefiak, D. The use of cottonseed meal as a protein source for poultry: An updated review. Worlds Poult. Sci. J. 2016, 72, 473–483. [Google Scholar] [CrossRef] [Scilit]
  13. Liu, Y.; Ma, S.; Lv, W.; Shi, H.; Qiu, G.; Chang, H.; Lu, S.; Wang, D.; Wang, C.; Han, S.; et al. Effects of replacing fishmeal with cottonseed protein concentrate on growth performance, blood metabolites, and the intestinal health of juvenile rainbow trout (Oncorhynchus mykiss). Front. Immunol. 2022, 13, 1079677. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Tian, S.; Wu, Y.; Yuan, J.; Zhang, Z.; Huang, D.; Zhou, H.; Zhang, W.; Mai, K. Replacement of dietary fishmeal by cottonseed protein concentrate on growth performance, feed utilization and protein metabolism of large yellow croaker Larimichthys crocea. Aquacult. Rep. 2022, 26, 101313. [Google Scholar] [CrossRef] [Scilit]
  15. Wang, C.; Zhao, Z.; Lu, S.; Liu, Y.; Han, S.; Jiang, H.; Yang, Y.; Liu, H. Physiological, Nutritional and Transcriptomic Responses of Sturgeon (Acipenser schrenckii) to Complete Substitution of Fishmeal with Cottonseed Protein Concentrate in Aquafeed. Biology 2023, 12, 490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Wang, S.L.; Jena, U.; Das, K.C. Long term performance of pilot methanogenic digester filled with seashell wastes treating slaughterhouse wastes: Biogas production and environmental impact. Biochem. Eng. J. 2022, 187, 108651. [Google Scholar] [CrossRef] [Scilit]
  17. Toldra, F.; Reig, M.; Mora, L. Management of meat by- and co-products for an improved meat processing sustainability. Meat Sci. 2021, 181, 108608. [Google Scholar] [CrossRef] [Scilit]
  18. Jedrejek, D.; Levic, J.; Wallace, J.; Oleszek, W. Animal by-products for feed: Characteristics, European regulatory framework, and potential impacts on human and animal health and the environment. J. Anim. Feed Sci. 2016, 25, 189–202. [Google Scholar] [CrossRef] [Scilit]
  19. Villanueva-Gutierrez, E.; Gonzalez-Felix, M.L.; Gatlin, D.M.I.; Perez-Velazquez, M. Use of alternative plant and animal protein blends, in place of fishmeal, in diets for juvenile totoaba, Totoaba macdonaldi. Aquaculture 2020, 529, 735698. [Google Scholar] [CrossRef] [Scilit]
  20. Lu, F.; Haga, Y.; Satoh, S. Effects of replacing fish meal with rendered animal protein and plant protein sources on growth response, biological indices, and amino acid availability for rainbow trout Oncorhynchus mykiss. Fish. Sci. 2015, 81, 95–105. [Google Scholar] [CrossRef] [Scilit]
  21. Hatlen, B.; Oaland, O.; Tvenning, L.; Breck, O.; Jakobsen, J.V.; Skaret, J. Growth performance, feed utilization and product quality in slaughter size Atlantic salmon (Salmo salar L.) fed a diet with porcine blood meal, poultry oil and salmon oil. Aquac. Nutr. 2013, 19, 573–584. [Google Scholar] [CrossRef] [Scilit]
  22. Woodgate, S.L.; Wan, A.; Hartnett, F.; Wilkinson, R.G.; Davies, S.J. The utilisation of European processed animal proteins as safe, sustainable and circular ingredients for global aquafeeds. Rev. Aquac. 2022, 14, 1572–1596. [Google Scholar] [CrossRef] [Scilit]
  23. Mo, A.J.; Sun, J.X.; Wang, Y.H.; Yang, K.; Yang, H.S.; Yuan, Y.C. Apparent digestibility of protein, energy and amino acids in nine protein sources at two content levels for mandarin fish, Siniperca chuatsi. Aquaculture 2019, 499, 42–50. [Google Scholar] [CrossRef] [Scilit]
  24. Tan, X.H.; Sun, Z.Z.; Chen, S.; Chen, S.L.; Huang, Z.; Zhou, C.P.; Zou, C.Y.; Liu, Q.Y.; Ye, H.Q.; Lin, H.Z.; et al. Effects of dietary dandelion extracts on growth performance, body composition, plasma biochemical parameters, immune responses and disease resistance of juvenile golden pompano Trachinotus ovatus. Fish Shellfish Immunol. 2017, 66, 198–206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. You, C.H.; Chen, B.J.; Wang, M.; Wang, S.Q.; Zhang, M.; Sun, Z.J.; Juventus, A.J.; Ma, H.Y.; Li, Y.Y. Effects of dietary lipid sources on the intestinal microbiome and health of golden pompano (Trachinotus ovatus). Fish Shellfish Immunol. 2019, 89, 187–197. [Google Scholar] [CrossRef] [Scilit]
  26. Ma, Y.C.; Li, Y.Y.; Xu, C.; Li, M.M.; Chen, H.Y.; Ye, R.K.; Zhang, G.R.; Xie, D.Z.; Ning, L.J.; Wang, S.Q.; et al. Diet with a high proportion replacement of fishmeal by terrestrial compound protein displayed better farming income and environmental benefits in the carnivorous marine teleost (Trachinotus ovatus). Aquacult. Rep. 2020, 18, 100449. [Google Scholar] [CrossRef] [Scilit]
  27. Wu, Y.B.; Fang, H.Y.; Ma, H.J.; Wang, X.J. Supplementation of Selenium-Yeast Enhances Fishmeal Replacement by Soy Protein Concentrate in Diets for Golden Pompano (Trachinotus ovatus). Aquac. Res. 2023, 2023, 8953076. [Google Scholar] [CrossRef] [Scilit]
  28. Shen, J.F.; Liu, H.Y.; Tan, B.P.; Dong, X.H.; Yang, Q.H.; Chi, S.Y.; Zhang, S. Effects of replacement of fishmeal with cottonseed protein concentrate on the growth, intestinal microflora, haematological and antioxidant indices of juvenile golden pompano (Trachinotus ovatus). Aquac. Nutr. 2020, 26, 1119–1130. [Google Scholar] [CrossRef] [Scilit]
  29. Fu, S.; Qian, K.; Liu, H.; Song, F.; Ye, J. Effects of fish meal replacement with low-gossypol cottonseed meal on the intestinal barrier of juvenile golden pompano (Trachinotus ovatus). Aquac. Res. 2022, 53, 285–299. [Google Scholar] [CrossRef] [Scilit]
  30. Qin, Y.W.; He, C.Q.; Wang, W.Q.; Yang, P.; Wang, J.; Qin, Q.B.; Mai, K.S.; Song, F. Changes in Growth Performance, Nutrient Metabolism, Antioxidant Defense and Immune Response After Fishmeal Was Replaced by Low-Gossypol Cottonseed Meal in Golden Pompano (Trachinotus ovatus). Front. Mar. Sci. 2021, 8, 775575. [Google Scholar] [CrossRef] [Scilit]
  31. Qin, Y.; He, C.; Geng, H.; Wang, W.; Yang, P.; Mai, K.; Song, F. Muscle Nutritive Metabolism Changes after Dietary Fishmeal Replaced by Cottonseed Meal in Golden Pompano (Trachinotus ovatus). Metabolites 2022, 12, 576. [Google Scholar] [CrossRef] [Scilit]
  32. Ma, Y.C.; Li, M.M.; Xie, D.Z.; Chen, S.J.; Dong, Y.W.; Wang, M.; Zhang, G.R.; Zhang, M.; Chen, H.Y.; Ye, R.K.; et al. Fishmeal can be replaced with a high proportion of terrestrial protein in the diet of the carnivorous marine teleost (Trachinotus ovatus). Aquaculture 2020, 519, 734910. [Google Scholar] [CrossRef] [Scilit]
  33. Zhang, G.R.; Ning, L.J.; Jiang, K.S.; Zheng, J.; Guan, J.F.; Li, H.J.; Ma, Y.C.; Wu, K.; Xu, C.; Xie, D.Z.; et al. The importance of fatty acid precision nutrition: Effects of dietary fatty acid composition on growth, hepatic metabolite, and intestinal microbiota in marine teleost Trachinotus ovatus. Aquac. Nutr. 2023, 2023, 2556799. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Hamzeh, A.; Moslemi, M.; Karaminasab, M.; Khanlar, M.A.; Faizbakhsh, R.; Navai, M.B.; Tahergorabi, R. Amino acid composition of roe from wild and farmed beluga sturgeon (Huso huso). J. Agric. Sci. Technol. 2015, 17, 357–364. [Google Scholar]
  35. Tan, X.H.; Sun, Z.Z.; Huang, Z.; Zhou, C.P.; Lin, H.Z.; Tan, L.J.; Xun, P.W.; Huang, Q. Effects of dietary hawthorn extract on growth performance, immune responses, growth- and immune-related genes expression of juvenile golden pompano (Trachinotus ovatus) and its susceptibility to Vibrio harveyi infection. Fish Shellfish Immunol. 2017, 70, 656–664. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Niu, H.; Chang, J.; Guo, S.; Xie, Z.; Zhu, A. Effects of spray-dried blood cell meal with microencapsulated methionine substituting fish meal on the growth, nutrient digestibility and amino acid retention of Litopenaeus vannamei. Aquac. Res. 2011, 42, 480–489. [Google Scholar] [CrossRef] [Scilit]
  37. Wang, Y.; Tao, S.Q.; Liao, Y.L.; Lian, X.Q.; Luo, C.Z.; Zhang, Y.; Yang, C.H.; Cui, C.H.; Yang, J.M.; Yang, Y.H. Partial fishmeal replacement by mussel meal or meat and bone meal in low-fishmeal diets for juvenile Ussuri catfish (Pseudobagrus ussuriensis): Growth, digestibility, antioxidant capacity and IGF-I gene expression. Aquac. Nutr. 2020, 26, 727–736. [Google Scholar] [CrossRef] [Scilit]
  38. Cai, W.; Liu, H.; Han, D.; Zhu, X.; Jin, J.; Yang, Y.; Xie, S. Complete Replacement of Fishmeal With Plant Protein Ingredients in Gibel Carp (Carassius auratus gibelio) Diets by Supplementation With Essential Amino Acids Without Negative Impact on Growth Performance and Muscle Growth-Related Biomarkers. Front. Mar. Sci. 2022, 8, 759086. [Google Scholar] [CrossRef] [Scilit]
  39. Li, S.L.; Dai, M.; Qiu, H.J.; Chen, N.S. Effects of fishmeal replacement with composite mixture of shrimp hydrolysate and plant proteins on growth performance, feed utilization, and target of rapamycin pathway in largemouth bass, Micropterus salmoides. Aquaculture 2021, 533, 736185. [Google Scholar] [CrossRef] [Scilit]
  40. Zhang, Z.Y.; Jiang, Z.Y.; Lv, H.B.; Jin, J.Y.; Chen, L.Q.; Zhang, M.L.; Du, Z.Y.; Qiao, F. Dietary aflatoxin impairs flesh quality through reducing nutritional value and changing myofiber characteristics in yellow catfish (Pelteobagrus fulvidraco). Anim. Feed Sci. Technol. 2021, 274, 114764. [Google Scholar] [CrossRef] [Scilit]
  41. Ahmed, I.; Jan, K.; Fatma, S.; Dawood, M. Muscle proximate composition of various food fish species and their nutritional significance: A review. J. Anim. Physiol. Anim. Nutr. 2022, 106, 690–719. [Google Scholar] [CrossRef] [Scilit]
  42. Xie, R.T.; Amenyogbe, E.; Chen, G.; Huang, J.S. Effects of feed fat level on growth performance, body composition and serum biochemical indices of hybrid grouper (Epinephelus fuscoguttatus x Epinephelus polyphekadion). Aquaculture 2021, 530, 735813. [Google Scholar] [CrossRef] [Scilit]
  43. Ding, L.Y.; Zhang, L.M.; Wang, J.Y.; Ma, J.J.; Meng, X.J.; Duan, P.C.; Sun, L.H.; Sun, Y.Z. Effect of dietary lipid level on the growth performance, feed utilization, body composition and blood chemistry of juvenile starry flounder (Platichthys stellatus). Aquac. Res. 2010, 41, 1470–1478. [Google Scholar] [CrossRef] [Scilit]
  44. Stein, O.; Stein, Y. Atheroprotective mechanisms of HDL. Atherosclerosis 1999, 144, 285–301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. von Eckardstein, A.; Assmann, G. Prevention of coronary heart disease by raising high-density lipoprotein cholesterol? Curr. Opin. Lipidol. 2000, 11, 627–637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Lee, J.J.; Lee, H.J.; Oh, S.W. Antiobesity Effects of Sansa (Crataegi fructus) on 3T3-L1 Cells and on High-Fat-High-Cholesterol Diet-Induced Obese Rats. J. Med. Food 2017, 20, 19–29. [Google Scholar] [CrossRef] [Scilit]
  47. Li, P.; Mai, K.S.; Trushenski, J.; Wu, G.Y. New developments in fish amino acid nutrition: Towards functional and environmentally oriented aquafeeds. Amino Acids 2009, 37, 43–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Mai, K.S.; Zhang, L.; Ai, Q.H.; Duan, Q.Y.; Zhang, C.X.; Li, H.T.; Wan, J.L.; Liufu, Z.G. Dietary lysine requirement of juvenile Japanese seabass, Lateolabrax japonicus. Aquaculture 2006, 258, 535–542. [Google Scholar] [CrossRef] [Scilit]
  49. Mai, K.S.; Wan, J.L.; Ai, Q.H.; Xu, W.; Liufu, Z.G.; Zhang, L.; Zhang, C.X.; Li, H.T. Dietary methionine requirement of large yellow croaker, Pseudosciaena crocea R. Aquaculture 2006, 253, 564–572. [Google Scholar] [CrossRef] [Scilit]
  50. Rahimnejad, S.; Lee, K. Dietary arginine requirement of juvenile red sea bream Pagrus major. Aquaculture 2014, 434, 418–424. [Google Scholar] [CrossRef] [Scilit]
  51. Gu, D.H.; Zhao, J.Y.; Limbu, S.M.; Liang, Y.A.; Deng, J.M.; Bi, B.L.; Kong, L.F.; Yan, H.; Wang, X.W.; Hu, Q.; et al. Arginine supplementation in plant-rich diets affects growth, feed utilization, body composition, blood biochemical indices and gene expressions of the target of rapamycin signaling pathway in juvenile Asian redtailed catfish (Hemibagrus wyckoiides). J. World Aquacult. Soc. 2022, 53, 133–150. [Google Scholar] [CrossRef] [Scilit]
  52. Shao, M.; Xu, H.; Ge, X.P.; Zhu, J.; Huang, D.Y.; Ren, M.C.; Liang, H.L. Salinity levels affect the lysine nutrient requirements and nutrient metabolism of juvenile genetically improved farmed tilapia (Oreochromis niloticus). Brit. J. Nutr. 2023, 129, 564–575. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. van Meijl, L.; Popeijus, H.E.; Mensink, R.P. Amino acids stimulate Akt phosphorylation, and reduce IL-8 production and NF-kappa B activity in HepG2 liver cells. Mol. Nutr. Food Res. 2010, 54, 1568–1573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Holz, M.K.; Ballif, B.A.; Gygi, S.P.; Blenis, J. mTOR and S6K1 mediate assembly of the translation preinitiation complex through dynamic protein interchange and ordered phosphorylation events. Cell 2021, 184, 2255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Sheng, Z.Y.; Turchini, G.M.; Xu, J.M.; Fang, Z.S.; Chen, N.S.; Xie, R.T.; Zhang, H.T.; Li, S.L. Functional Properties of Protein Hydrolysates on Growth, Digestive Enzyme Activities, Protein Metabolism, and Intestinal Health of Larval Largemouth Bass (Micropterus salmoides). Front. Immunol. 2022, 13, 913024. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Yu, H.; Liang, H.L.; Ren, M.C.; Ge, X.P.; Ji, K.; Huang, D.Y.; Pan, L.K.; Xia, D. A study to explore the effects of low dietary protein levels on the growth performance and nutritional metabolism of grass carp (Ctenopharyngodon idella) fry. Aquaculture 2022, 546, 737324. [Google Scholar] [CrossRef] [Scilit]
  57. Castro, L.; Tocher, D.R.; Monroig, O. Long-chain polyunsaturated fatty acid biosynthesis in chordates: Insights into the evolution of Fads and Elovl gene repertoire. Prog. Lipid Res. 2016, 62, 25–40. [Google Scholar] [CrossRef] [Scilit]
  58. Zhang, M.; Chen, C.Y.; You, C.H.; Chen, B.J.; Wang, S.Q.; Li, Y.Y. Effects of different dietary ratios of docosahexaenoic to eicosapentaenoic acid (DHA/EPA) on the growth, non-specific immune indices, tissue fatty acid compositions and expression of genes related to LC-PUFA biosynthesis in juvenile golden pompano Trachinotus ovatus. Aquaculture 2019, 505, 488–495. [Google Scholar] [CrossRef] [Scilit]
  59. Nieminen, P.; Westenius, E.; Halonen, T.; Mustonen, A.M. Fatty acid composition in tissues of the farmed Siberian sturgeon (Acipenser baerii). Food Chem. 2014, 159, 80–84. [Google Scholar] [CrossRef] [Scilit]
  60. De Queiroz, J.; Alonso-Vale, M.; Curi, R.; Lima, F.B. Control of adipogenesis by fatty acids. Arq. Bras. Endocrinol. 2009, 53, 582–594. [Google Scholar] [CrossRef] [Scilit]
  61. Kliewer, S.A.; Sundseth, S.S.; Jones, S.A.; Brown, P.J.; Wisely, G.B.; Koble, C.S.; Devchand, P.; Wahli, W.; Willson, T.M.; Lenhard, J.M.; et al. Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors alpha and gamma. Proc. Natl. Acad. Sci. USA 1997, 94, 4318–4323. [Google Scholar] [CrossRef] [Scilit]
  62. Poulsen, L.L.; Siersbk, M.; Mandrup, S. PPARs: Fatty acid sensors controlling metabolism. Semin. Cell Dev. Biol. 2012, 23, 631–639. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Dong, G.F.; Zou, Q.; Wang, H.; Huang, F.; Liu, X.C.; Chen, L.; Yang, C.Y.; Yang, Y.O. Conjugated linoleic acid differentially modulates growth, tissue lipid deposition, and gene expression involved in the lipid metabolism of grass carp. Aquaculture 2014, 432, 181–191. [Google Scholar] [CrossRef] [Scilit]
  64. Xu, H.; Dong, X.; Zuo, R.; Mai, K.; Ai, Q. Response of juvenile Japanese seabass (Lateolabrax japonicus) to different dietary fatty acid profiles: Growth performance, tissue lipid accumulation, liver histology and flesh texture. Aquaculture 2016, 461, 40–47. [Google Scholar] [CrossRef] [Scilit]
  65. Xu, H.G.; Dong, X.J.; Ai, Q.H.; Mai, K.S.; Xu, W.; Zhang, Y.J.; Zuo, R.T. Regulation of tissue lc-pufa contents, d6 fatty acyl desaturase (fads2) gene expression and the methylation of the putative fads2 gene promoter by different dietary fatty acid profiles in japanese seabass (Lateolabrax japonicus). PLoS ONE 2014, 9, e87726. [Google Scholar] [CrossRef] [Scilit]
  66. Gao, X.; Zhai, H.; Peng, Z.; Yu, J.; Yan, L.; Wang, W.; Ren, T.; Han, Y. Comparison of nutritional quality, flesh quality, muscle cellularity, and expression of muscle growth-related genes between wild and recirculating aquaculture system (RAS)-farmed black rockfish (Sebastes schlegelii). Aquac. Int. 2023. [Google Scholar] [CrossRef] [Scilit]
  67. Valente, L.; Cabral, E.M.; Sousa, V.; Cunha, L.; Fernandes, J. Plant protein blends in diets for Senegalese sole affect skeletal muscle growth, flesh texture and the expression of related genes. Aquaculture 2016, 453, 77–85. [Google Scholar] [CrossRef] [Scilit]
  68. Li, X.X.; Chen, S.J.; Sun, J.J.; Huang, X.D.; Tang, H.J.; He, Y.H.; Pan, Q.; Gan, L. Partial substitution of soybean meal with faba bean meal in grass carp (Ctenopharyngodon idella) diets, and the effects on muscle fatty acid composition, flesh quality, and expression of myogenic regulatory factors. J. World Aquacult. Soc. 2020, 51, 1145–1160. [Google Scholar] [CrossRef] [Scilit]
  69. Wu, M.; Li, M.; Wen, H.; Yu, L.; Jiang, M.; Lu, X.; Tian, J.; Huang, F. Dietary lysine facilitates muscle growth and mediates flesh quality of Pacific white shrimp (Litopenaeus vannamei) reared in low-salinity water. Aquac. Int. 2023, 31, 603–625. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Serum biochemical indexes of juvenile golden pompano fed different diets for 65 days. Values are presented as mean ± SEM (n = 6). Significance analysis between groups was performed using Tukey’s multiple comparison method, and bars without sharing a common letter indicate a significant difference (p < 0.05), while those lacking letters indicate no significant difference. (A): TP, total protein (g L−1); (B): ALB, albumin (g L−1); (C): BUN, blood urea nitrogen (mmol L−1); (D): T-CHO, total cholesterol (mmol L−1); (E): HDL-C, high-density lipoprotein cholesterol (mmol L−1); (F): LDL-C, low-density lipoprotein cholesterol (mmol L−1); (G): TG, triglyceride (mmol L−1).
Figure 1. Serum biochemical indexes of juvenile golden pompano fed different diets for 65 days. Values are presented as mean ± SEM (n = 6). Significance analysis between groups was performed using Tukey’s multiple comparison method, and bars without sharing a common letter indicate a significant difference (p < 0.05), while those lacking letters indicate no significant difference. (A): TP, total protein (g L−1); (B): ALB, albumin (g L−1); (C): BUN, blood urea nitrogen (mmol L−1); (D): T-CHO, total cholesterol (mmol L−1); (E): HDL-C, high-density lipoprotein cholesterol (mmol L−1); (F): LDL-C, low-density lipoprotein cholesterol (mmol L−1); (G): TG, triglyceride (mmol L−1).
Animals 13 01704 g001
Figure 2. Textural properties indexes in the muscle of juvenile golden pompano fed different diets for 65 days. Values are presented as mean ± SEM (n = 6). Significance analysis between groups was performed using Tukey’s multiple comparison method, and bars without sharing a common letter indicate a significant difference (p < 0.05), while those lacking letters indicate no significant difference. (A): Tenderness (gf); (B): Hardness (gf); (C): Springiness; (D): Chewiness (gf); (E): Gumminess (gf); (F): Cohesiveness (gf-mm).
Figure 2. Textural properties indexes in the muscle of juvenile golden pompano fed different diets for 65 days. Values are presented as mean ± SEM (n = 6). Significance analysis between groups was performed using Tukey’s multiple comparison method, and bars without sharing a common letter indicate a significant difference (p < 0.05), while those lacking letters indicate no significant difference. (A): Tenderness (gf); (B): Hardness (gf); (C): Springiness; (D): Chewiness (gf); (E): Gumminess (gf); (F): Cohesiveness (gf-mm).
Animals 13 01704 g002
Figure 3. mRNA expression levels of genes related to the protein metabolism of juvenile golden pompano fed different diets for 65 days. Values are presented as mean ± SEM (n = 6). Significance analysis between groups was performed using Tukey’s multiple comparison method, and the bars without sharing a common letter indicate a significant difference (p < 0.05), while those lacking letters indicate no significant difference. mtor, mechanistic target of rapamycin kinase; s6k1, ribosomal S6 kinase; 4e-bp1, 4E-binding protein 1.
Figure 3. mRNA expression levels of genes related to the protein metabolism of juvenile golden pompano fed different diets for 65 days. Values are presented as mean ± SEM (n = 6). Significance analysis between groups was performed using Tukey’s multiple comparison method, and the bars without sharing a common letter indicate a significant difference (p < 0.05), while those lacking letters indicate no significant difference. mtor, mechanistic target of rapamycin kinase; s6k1, ribosomal S6 kinase; 4e-bp1, 4E-binding protein 1.
Animals 13 01704 g003
Figure 4. mRNA expression levels of genes related to the lipid metabolism of juvenile golden pompano fed different diets for 65 days. Values are presented as the mean ± SEM (n = 6). Significance analysis between groups was performed using Tukey’s multiple comparison method, and the bars with different letters are significantly different (p < 0.05). pparγ, peroxisome proliferator-activated receptor γ; fas, fatty acid synthase; srebp1, sterol regulatory element binding proteins 1; acc1, acetyl coenzyme a carboxylase 1.
Figure 4. mRNA expression levels of genes related to the lipid metabolism of juvenile golden pompano fed different diets for 65 days. Values are presented as the mean ± SEM (n = 6). Significance analysis between groups was performed using Tukey’s multiple comparison method, and the bars with different letters are significantly different (p < 0.05). pparγ, peroxisome proliferator-activated receptor γ; fas, fatty acid synthase; srebp1, sterol regulatory element binding proteins 1; acc1, acetyl coenzyme a carboxylase 1.
Animals 13 01704 g004
Table 1. Ingredients and nutrient composition of the experimental diets (% dry weight).
Table 1. Ingredients and nutrient composition of the experimental diets (% dry weight).
Diets
Control25NGP50NGP75NGP
Percentage of FM replaced by NGCP0255075
Fishmeal24.0018.0012.006.00
Non-grain compound protein 1 6.0013.0019.50
Soybean protein concentrate7.007.007.007.00
Poultry meal8.008.008.008.00
Corn gluten meal9.009.009.009.00
Fermented soybean meal10.0010.0010.0010.00
Compound oil 28.008.108.408.70
Flour17.0017.0017.0017.00
Vitamin mineral mixture 31.001.001.001.00
Premix compound 42.502.502.502.50
Corn husk13.5013.2711.8610.94
L-lysine 0.070.120.18
DL-methionine 0.060.120.18
Total100.00100.00100.00100.00
Proximate composition (% dry weight)
Dry weight92.3491.4792.2191.97
Crude protein45.1344.9645.1945.20
Crude lipid12.1811.9811.9611.95
Ash8.818.688.578.62
Fishmeal, bovine bone meal, dephenolized cottonseed protein, blood cell meal, soybean protein concentrate, poultry meal, corn gluten meal, fermented soybean meal, flour, corn husk, L-lysine, DL-methionine, and premix compound were provided by Taishan Xiangxing Feed Co., Ltd., Taishan, China. 1 NGCP consists of 50% dephenolized cottonseed protein, 30% bovine bone meal, and 20% blood cell meal. 2 Consists of fish, soybean, rapeseed, perilla, palm oils, and phospholipids, together with small amount of emulsifier and antioxidant, which were provided by Guangzhou UBT Feed Technology Co., Ltd., Guangzhou, China. Details are not shown here due to the application for a patent. 3 Consists of a vitamin mixture and mineral compound. Vitamin mixture (per kg): VA: 1100000 IU; VD3: 320000 IU; VK3: 1000 mg; VB1: 1500 mg; VB2: 2800 mg; VC: 17 mg; VE: 8 mg; calcium pantothenate: 2000 mg; nicotinamide: 7800 mg; folic acid: 400 mg; inositol: 12800 mg; VB6: 1000 mg. Mineral compound (per kg): potassium iodide: 0.8 mg; sodium fluoride: 2 mg; copper sulfate: 10 mg; cobalt chloride (1%): 50 mg; zinc sulfate: 50 mg; calcium sulfate: 80 mg; magnesium sulfate: 1200 mg; manganese sulfate: 60 mg; table salt: 100 mg; zeolite powder: 15.45 g. Purchased from Guangdong Yuehai Feeds Group Co., Ltd., Zhanjiang, China. 4 Consists of choline chloride, monocalcium phosphate, ethoxyquinoline, and glycine betaine.
Table 2. Amino acid composition of the experimental diets (% dry weight).
Table 2. Amino acid composition of the experimental diets (% dry weight).
Amino AcidsControl25NGP50NGP75NGP
Lys2.272.252.162.09
Phe1.901.962.032.10
Met0.770.740.720.71
Thr1.721.711.651.61
Ile1.641.491.501.37
Leu3.713.713.783.75
Val1.951.872.001.98
Arg2.372.542.692.81
His1.101.111.121.13
EAA17.4317.3817.6517.55
Asp3.543.623.623.70
Ser1.942.011.982.05
Glu7.397.567.627.84
Gly2.182.222.232.32
Ala2.752.732.732.75
Cys0.490.470.490.49
Pro2.762.762.802.86
NEAA21.0521.3721.4722.01
Data are the mean of three duplicate determinations. EAA: Essential amino acids, including Lys, Phe, Met, Thr, Ile, Leu, Val, Arg, and His. NEAA: Non-essential amino acids, including Asp, Ser, Glu, Gly, Ala, Cys, and Pro.
Table 3. Fatty acid composition of the experimental diets (% total fatty acids).
Table 3. Fatty acid composition of the experimental diets (% total fatty acids).
Main Fatty AcidsControl25NGP50NGP75NGP
14:05.515.726.095.88
15:00.470.510.550.57
16:024.9426.6127.1529.90
17:00.680.730.710.75
18:04.114.534.445.42
20:00.210.230.340.36
SFA35.9338.2639.1642.88
16:15.665.625.715.73
17:10.860.910.950.85
18:1n-920.7821.7522.0224.79
MUFA27.3128.2928.6831.38
18:2n-616.7817.3317.4915.86
18:3n-61.431.411.411.08
20:3n-60.200.560.510.30
20:4n-60.730.800.730.75
n-6 PUFA19.6520.1020.1317.99
18:3n-30.990.951.050.65
20:5n-36.084.433.791.85
22:6n-35.434.143.501.58
n-3 PUFA12.499.528.344.08
n-3/n-60.640.470.410.23
Data are the mean of three duplicate determinations. SFA: saturated fatty acids, including 14:0, 15:0, 16:0, 17:0, 18:0, and 20:0. MUFA: monounsaturated fatty acids, including 16:1, 17:1, and 18:1n-9. n-6 PUFA: n-6 polyunsaturated fatty acids, including 18:2n-6 (LA), 18:3n-6, 20:3n-6, and 20:4n-6 (ARA). n-3 PUFA: n-3 polyunsaturated fatty acids, including 18:3n-3 (ALA), 20:5n-3 (EPA), and 22:6n-3 (DHA).
Table 4. Nucleotide sequences of the primers used to assay gene expressions by real-time PCR.
Table 4. Nucleotide sequences of the primers used to assay gene expressions by real-time PCR.
Target GeneForward Primer (5′-3′)Reverse Primer (3′-5′)Reference
mtorGATCAGGAGAGAGGCCATCCAGCCGGGTAAAACTCATCCAGenome sequences
s6k1GAAGCCCAAGAACACCTGTGGCTTGTGTCCATTTGCTCCAGenome sequences
4e-bp1GGGACTCTGTTCAGCACCACGGTTGAGTCACTGGGTTTGGenome sequences
pparγTCAGGGTTTCACTATGGCGTCTGGAAGCGACAGTATTGGCGenome sequences
fasGATGGATACAAAGAGCAAGGGTGGAGCCGATAAGAAGAGenome sequences
srebp1GAGCCAAGACAGAGGAGTGTGTCCTCTTGTCTCCCAGCTTGenome sequences
acc1GTGGAGCCGATAAGAAGAGCTTCCAGCAGCAAACGGenome sequences
β-actinTACGAGCTGCCTGACGGACAGGCTGTGATCTCCTTCTGCTan et al. [35]
The primers used in this experiment, according to Tan et al. [35], and the genome sequences of golden pompano (10.6084/m9.figshare.7570727.v3). mtor, mechanistic target of rapamycin kinase; s6k1, S6 kinase 1; 4e-bp1, 4E binding protein 1; pparγ, peroxisome proliferators-activated receptor gamma; fas, fatty acid synthase; srebp1, sterol regulatory element binding protein 1; acc1, acetyl-CoA-carboxylase.
Table 5. Growth performance, feed utilization, and morphometric parameters of juvenile golden pompano fed different diets for 65 days.
Table 5. Growth performance, feed utilization, and morphometric parameters of juvenile golden pompano fed different diets for 65 days.
GroupsControl25NGP50NGP75NGP
Initial body weight9.72 ± 0.119.61 ± 0.159.72 ± 0.119.78 ± 0.14
Final body weight86.82 ± 2.47 a80.12 ± 0.65 b74.24 ± 1.00 b61.11 ± 0.92 c
Weight gain77.1 ± 2.46 a70.51 ± 0.65 ab64.52 ± 1.11 b51.33 ± 0.90 c
Weight gain rate793.43 ± 26.89 a733.98 ± 14.00 ab655.72 ± 23.53 b524.83 ± 11.11 c
Specific growth rate3.36 ± 0.05 a3.26 ± 0.03 ab3.13 ± 0.04 b2.82 ± 0.03 c
Feed conversion ratio1.17 ± 0.05 c1.25 ± 0.01 bc1.40 ± 0.03 b1.73 ± 0.05 a
Survival rate100.00 ± 0.00100.00 ± 0.00100.00 ± 0.00100.00 ± 0.00
Viscerosomatic index6.22 ± 0.09 ab5.83 ± 0.24 b6.60 ± 0.19 a6.76 ± 0.18 a
Hepatosomatic index1.45 ± 0.11 ab1.08 ± 0.09 b1.32 ± 0.12 ab1.54 ± 0.08 a
Condition factor3.02 ± 0.083.14 ± 0.083.11 ± 0.073.23 ± 0.13
The results of initial body weight (IBW, g fish−1), final body weight (FBW, g fish−1), weight gain (WG, g), weight gain rate (WGR, %), specific growth rate (SGR, % day−1), feed conversion ratio (FCR), and survival rate (SR, %) are presented as the mean ± SEM (n = 3), and the results of viscerosomatic index (VSI, %), hepatosomatic index (HSI, %), and condition factor (CF, g cm−3) are presented as the mean ± SEM (n = 6). Significance analysis between groups was performed using Tukey’s multiple comparison method, and in each row, means without sharing a common letter are significantly different (p < 0.05), while those lacking letters indicate no significant difference.
Table 6. Whole body and muscle composition (% dry weight) of the juvenile golden pompano fed different diets for 65 days.
Table 6. Whole body and muscle composition (% dry weight) of the juvenile golden pompano fed different diets for 65 days.
GroupsControl25NGP50NGP75NGP
Whole body
Crude protein54.17 ± 0.2856.42 ± 0.9857.16 ± 0.1956.05 ± 1.21
Crude lipid31.3 ± 0.9829.27 ± 1.4231.12 ± 0.1929.46 ± 0.52
Ash12.2 ± 0.19 b12.51 ± 0.34 b12.62 ± 0.12 b13.84 ± 0.29 a
Moisture66.49 ± 0.4168.14 ± 0.7467.92 ± 0.1567.82 ± 0.4
Muscle
Crude protein83.36 ± 0.9482.12 ± 0.7585.18 ± 0.6185.09 ± 0.9
Crude lipid9.84 ± 0.55 ab11.44 ± 0.95 a6.09 ± 1.21 bc5.98 ± 0.45 c
Ash6.23 ± 0.135.84 ± 0.176.11 ± 0.255.99 ± 0.29
Moisture74.79 ± 0.27 b75.09 ± 0.34 ab75.77 ± 0.26 ab75.93 ± 0.07 a
Results are presented as the mean ± SEM (n = 6). Significance analysis between groups was performed using Tukey’s multiple comparison method, and in each row, means without sharing a common letter are significantly different (p < 0.05), while those lacking letters indicate no significant difference.
Table 7. Fatty acid composition (% total fatty acids) in the muscle of juvenile golden pompano fed different diets for 65 days.
Table 7. Fatty acid composition (% total fatty acids) in the muscle of juvenile golden pompano fed different diets for 65 days.
Main Fatty AcidsControl25NGP50NGP75NGP
14:03.73 ± 0.233.63 ± 0.093.53 ± 0.113.59 ± 0.05
15:00.39 ± 0.01 b0.43 ± 0.01 a0.42 ± 0.00 a0.43 ± 0.01 a
16:026.04 ± 0.30 b27.3 ± 0.13 b26.83 ± 0.48 b30.03 ± 0.28 a
17:00.49 ± 0.01 c0.51 ± 0.01 bc0.54 ± 0.01 a0.52 ± 0.00 ab
18:05.09 ± 0.08 c5.76 ± 0.04 b6.55 ± 0.06 a6.58 ± 0.11 a
20:00.23 ± 0.010.25 ± 0.010.38 ± 0.080.44 ± 0.06
SFA35.1 ± 1.2437.06 ± 0.8136.03 ± 1.2437.99 ± 1.24
16:14.98 ± 0.10 a4.75 ± 0.06 ab4.51 ± 0.05 b4.68 ± 0.03 b
17:10.71 ± 0.01 a0.68 ± 0.02 ab0.62 ± 0.02 b0.64 ± 0.02 b
18:1n-925.11 ± 0.13 c26.51 ± 0.22 b26.23 ± 0.23 b29.36 ± 0.21 a
20:11.73 ± 0.131.67 ± 0.021.64 ± 0.041.86 ± 0.03
MUFA32.36 ± 0.4433.61 ± 0.2030.78 ± 1.5434.71 ± 0.93
18:2n-611.94 ± 0.15 bc12.44 ± 0.14 ab12.64 ± 0.19 a11.3 ± 0.12 c
20:3n-60.77 ± 0.04 a0.76 ± 0.06 a0.53 ± 0.03 b0.28 ± 0.03 c
20:4n-60.5 ± 0.08 a0.59 ± 0.03 a0.26 ± 0.01 b0.21 ± 0.01 b
n-6 PUFA12.99 ± 0.27 a13.5 ± 0.37 a13.26 ± 0.26 a11.78 ± 0.07 b
18:3n-30.28 ± 0.01 a0.28 ± 0.01 a0.21 ± 0.00 b0.13 ± 0.01 c
20:5n-31.93 ± 0.05 a1.47 ± 0.02 b1.22 ± 0.05 c0.72 ± 0.02 d
22:6n-36.76 ± 0.09 a5.77 ± 0.04 c6.27 ± 0.10 b3.13 ± 0.08 d
n-3 PUFA8.9 ± 0.14 a7.53 ± 0.05 b7.67 ± 0.19 b3.86 ± 0.04 c
n-3/n-60.67 ± 0.00 a0.55 ± 0.02 b0.58 ± 0.04 b0.33 ± 0.00 c
Results are presented as the mean ± SEM (n = 6). Significance analysis between groups was performed using Tukey’s multiple comparison method, and in each row, means without sharing a common letter are significantly different (p < 0.05), while those lacking letters indicate no significant difference. SFA: saturated fatty acids, including 14:0, 15:0, 16:0, 17:0, 18:0, and 20:0. MUFA: monounsaturated fatty acids, including 16:1, 17:1, 18:1n-9, and 20:1. N-6 PUFA: n-6 polyunsaturated fatty acids, including 18:2n-6, 20:3n-6, and 20:4n-6. N-3 PUFA: n-3 polyunsaturated fatty acids, including 18:3n-3, 20:5n-3, and 22:6n-3.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Su, Z.; Ma, Y.; Chen, F.; An, W.; Zhang, G.; Xu, C.; Xie, D.; Wang, S.; Li, Y. Dietary Fishmeal Can Be Partially Replaced with Non-Grain Compound Proteins through Evaluating the Growth, Biochemical Indexes, and Muscle Quality in Marine Teleost Trachinotus ovatus. Animals 2023, 13, 1704. https://doi.org/10.3390/ani13101704

AMA Style

Su Z, Ma Y, Chen F, An W, Zhang G, Xu C, Xie D, Wang S, Li Y. Dietary Fishmeal Can Be Partially Replaced with Non-Grain Compound Proteins through Evaluating the Growth, Biochemical Indexes, and Muscle Quality in Marine Teleost Trachinotus ovatus. Animals. 2023; 13(10):1704. https://doi.org/10.3390/ani13101704

Chicago/Turabian Style

Su, Zeliang, Yongcai Ma, Fang Chen, Wenqiang An, Guanrong Zhang, Chao Xu, Dizhi Xie, Shuqi Wang, and Yuanyou Li. 2023. "Dietary Fishmeal Can Be Partially Replaced with Non-Grain Compound Proteins through Evaluating the Growth, Biochemical Indexes, and Muscle Quality in Marine Teleost Trachinotus ovatus" Animals 13, no. 10: 1704. https://doi.org/10.3390/ani13101704

APA Style

Su, Z., Ma, Y., Chen, F., An, W., Zhang, G., Xu, C., Xie, D., Wang, S., & Li, Y. (2023). Dietary Fishmeal Can Be Partially Replaced with Non-Grain Compound Proteins through Evaluating the Growth, Biochemical Indexes, and Muscle Quality in Marine Teleost Trachinotus ovatus. Animals, 13(10), 1704. https://doi.org/10.3390/ani13101704

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop