Effects of Different Co-Feeding Protocols on the Early Weaning of Flathead Grey Mullet (Mugil cephalus) Larvae
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Larval Rearing
2.2. Feeding Protocols
2.3. Sampling Protocols
2.4. Survival and Growth
2.5. Biochemical Analyses
2.6. Gene Expression Analyses
2.7. Statistical Analyses
3. Results
3.1. Survival and Growth
3.2. Biochemical Analyses
3.3. Gene Expression Analyses
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tveterås, S.; Asche, F.; Bellemare, M.F.; Smith, M.D.; Guttormsen, A.G.; Lem, A.; Lien, K.; Vannuccini, S. Fish is food-the FAO’s fish price index. PLoS ONE 2012, 7, e36731. [Google Scholar] [CrossRef] [PubMed]
- Garlock, T.; Asche, F.; Anderson, J.; Bjørndal, T.; Kumar, G.; Lorenzen, K.; Ropicki, A.; Smith, M.D.; Tveterås, R. A Global Blue Revolution: Aquaculture Growth Across Regions, Species, and Countries. Rev. Fish. Sci. Aquac. 2020, 28, 107–116. [Google Scholar] [CrossRef]
- Izquierdo, M.S.; Fernandez-Palacios, H.; Tacon, A.G.J. Effect of broodstock nutrition on reproductive performance of fish. Aquaculture 2001, 197, 25–42. [Google Scholar] [CrossRef]
- Dhont, J.; Dierckens, K.; Støttrup, J.; Van Stappen, G.; Wille, M.; Sorgeloos, P. Rotifers, Artemia and copepods as live feeds for fish larvae in aquaculture. In Advances in Aquaculture Hatchery Technology; Woodhead Publishing: Cambridge, UK, 2013; pp. 57–202. [Google Scholar]
- Kolkovski, S. Microdiets as alternatives to live feeds for fish larvae in aquaculture: Improving the efficiency of feed particle utilization. In Advances in Aquaculture Hatchery Technology; Woodhead Publishing: Cambridge, UK, 2013; pp. 203–222. [Google Scholar]
- Giebichenstein, J.; Giebichenstein, J.; Hasler, M.; Schulz, C.; Ueberschär, B. Comparing the performance of four commercial microdiets in an early weaning protocol for European seabass larvae (Dicentrarchus labrax). Aquac. Res. 2022, 53, 544–558. [Google Scholar] [CrossRef]
- Pinto, W.; Engrola, S.; Conceição, L.E.C. Towards an early weaning in Senegalese sole: A historical review. Aquaculture 2018, 496, 1–9. [Google Scholar] [CrossRef]
- Izquierdo, M.S.; Ghrab, W.; Roo, J.; Hamre, K.; Hernández-Cruz, C.M.; Bernardini, G.; Terova, G.; Saleh, R. Organic, inorganic and nanoparticles of Se, Zn and Mn in early weaning diets for gilthead seabream (Sparus aurata; Linnaeus, 1758). Aquac. Res. 2017, 48, 2852–2867. [Google Scholar] [CrossRef]
- Eryalçın, K.M.; Domínguez, D.; Roo, J.; Hernandez-Cruz, C.M.; Zamorano, M.J.; Castro, P.; Hamre, K.; Izquierdo, M. Effect of dietary microminerals in early weaning diets on growth, survival, mineral contents and gene expression in gilthead sea bream (Sparus aurata, L.) larvae. Aquac. Nutr. 2020, 26, 1760–1770. [Google Scholar] [CrossRef]
- Cahu, C.L.; Zambonino Infante, J.L. Early weaning of sea bass (Dicentrarchus labrax) larvae with a compound diet: Effect on digestive enzymes. Comp. Biochem. Physiol. 1994, 109, 213–222. [Google Scholar] [CrossRef]
- Gisbert, E.; Solovyev, M.; Bonpunt, E.; Mauduit, C. Weaning in Siberian Sturgeon Larvae. In The Siberian Sturgeon (Acipenser baerii, Brandt, 1869) Volume 2—Farming; Williot, P., Nonnotte, G., Chebanov, M., Eds.; Springer: Berlin/Heidelberg, Germany, 2018; pp. 59–72. [Google Scholar] [CrossRef]
- Lebreton, B.; Richard, P.; Parlier, E.P.; Guillou, G.; Blanchard, G.F. Trophic ecology of mullets during their spring migration in a European saltmarsh: A stable isotope study. Estuar. Coast. Shelf Sci. 2011, 91, 502–510. [Google Scholar] [CrossRef][Green Version]
- Crosetti, D.; Blaber, S.J. (Eds.) Biology, Ecology and Culture of Grey Mullets (Mugilidae); CRC Press: Boca Raton, FL, USA, 2016. [Google Scholar]
- Aizen, J.; Meiri, I.; Tzchori, I.; Levavi-Sivan, B.; Rosenfeld, H. Enhancing spawning in the grey mullet (Mugil cephalus) by removal of dopaminergic inhibition. Gen. Comp. Endocrinol. 2005, 142, 212–221. [Google Scholar] [CrossRef]
- Besbes, R.; Benseddik, A.B.; Kokokiris, L.; Changeux, T.; Hamza, A.; Kammoun, F.; Missaoui, H. Thicklip (Chelon labrosus) and flathead (Mugil cephalus) grey mullets fry production in Tunisian aquaculture. Aquac. Rep. 2020, 17, 100380. [Google Scholar] [CrossRef]
- Vallainc, D.; Concu, D.; Papiol, G.G.; Loi, B.; Leggieri, F.; Brundu, G.; Chindris, A.; Sanna, G.; Fois, N.; Antognarelli, F.; et al. Producing flat-head grey mullet Mugil cephalus (Linnaeus, 1758) fries in captivity from sexually mature adults collected in Sardinian lagoons. Aquac. Rep. 2021, 21, 100844. [Google Scholar] [CrossRef]
- Quirós-Pozo, R.; Robaina, L.; Calderón, J.A.; Filgueira, J.R. Reproductive management of the mugilid Liza aurata and characterization of proximate and fatty acid composition of broodstock tissues and spawnings. Aquaculture 2023, 564, 739055. [Google Scholar] [CrossRef]
- Whitfield, A.K.; Panfili, J.; Durand, J.D. A global review of the cosmopolitan flathead mullet Mugil cephalus Linnaeus 1758 (Teleostei: Mugilidae), with emphasis on the biology, genetics, ecology, and fisheries aspects of this apparent species complex. Rev. Fish Biol. Fish. 2012, 22, 641–681. [Google Scholar] [CrossRef]
- Loi, B.; Papadakis, I.E.; Leggieri, F.; Giménez Papiol, G.; Vallainc, D. Ontogeny of the digestive system and eye of reared flathead grey mullet, Mugil cephalus (Linnaeus, 1758), and evaluation of lipid deposition in the liver according to the feeding protocol. Aquaculture 2020, 526, 735386. [Google Scholar] [CrossRef]
- Thieme, P.; Vallainc, D.; Moritz, T. Postcranial skeletal development of Mugil cephalus (Teleostei: Mugiliformes): Morphological and life-history implications for Mugiliformes. Zool. J. Linn. Soc. 2021, 192, 1071–1089. [Google Scholar] [CrossRef]
- Koven, W.; Gisbert, E.; Nixon, O.; Solovyev, M.M.; Gaon, A.; Allon, G.; Meiri-Ashkenazi, I.; Tandler, A.; Rosenfeld, H. The effect of algal turbidity on larval performance and the ontogeny of digestive enzymes in the grey mullet (Mugil cephalus). Comp. Biochem. Physiol. Mol. Integr. Physiol. 2019, 228, 71–80. [Google Scholar] [CrossRef]
- Gisbert, E.; Mozanzadeh, M.T.; Kotzamanis, Y.; Estévez, A. Weaning wild flathead grey mullet (Mugil cephalus) fry with diets with different levels of fish meal substitution. Aquaculture 2016, 462, 92–100. [Google Scholar] [CrossRef]
- Koven, W.; Gisbert, E.; Meiri-Ashkenazi, I.; Nixon, O.; Israeli, D.; Tandler, A.; Nolasco Soria, H.; Solovyev, M.M.; Rosenfeld, H. The effect of weaning diet type on grey mullet (Mugil cephalus) juvenile performance during the trophic shift from carnivory to omnivory. Aquaculture 2020, 518, 734848. [Google Scholar] [CrossRef]
- Ben Khemis, I.; Zouiten, D.; Besbes, R.; Kamoun, F. Larval rearing and weaning of thick lipped grey mullet (Chelon labrosus) in mesocosm with semi-extensive technology. Aquaculture 2006, 259, 190–201. [Google Scholar] [CrossRef]
- Zouiten, D.; Khemis, I.; Besbes, R.; Cahu, C. Ontogeny of the digestive tract of thick lipped grey mullet (Chelon labrosus) larvae reared in “mesocosms. Aquaculture 2008, 279, 166–172. [Google Scholar] [CrossRef]
- Gilannejad, N.; de Las Heras, V.; Martos-Sitcha, J.A.; Moyano, F.J.; Yúfera, M.; Martínez-Rodríguez, G. Ontogeny of Expression and Activity of Digestive Enzymes and Establishment of gh/igf1 Axis in the Omnivorous Fish Chelon labrosus. Animals 2020, 10, 874. [Google Scholar] [CrossRef] [PubMed]
- Djellata, A. Advances in Greater Amberjack (Seriola dumerili, Risso, 1810) Larval Husbandry: Nutrition, Rearing Systems and Weaning Protocols. Ph.D. Thesis, University of Las Palmas de Gran Canaria, Gran Canaria, Spain, 2022; p. 112. [Google Scholar]
- Association of Official Analytical Chemists (AOAC). Official Methods of Analysis, 17th ed.; Association of Official Analytical Chemists: Gaithersburg, MD, USA, 2000. [Google Scholar]
- Kjeldahl, J.A. Neue Methode zur Bestimmung des Stickstoffs in Organischen Korpern. Z Anal. Chem. 1883, 22, 366–382. [Google Scholar] [CrossRef]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef] [PubMed]
- Christie, W.W. Gas Chromatography and Lipids: A Practical Guide; The Oily Press: Glasgow, UK, 1989. [Google Scholar]
- Izquierdo, M.S.; Arakawa, T.; Takeuchi, T.; Haroun, R.; Watanabe, T. Effect of n3HUFA levels in Artemia on growth of larval Japanese flounder (Paralichthys olivaceous). Aquaculture 1992, 105, 73–82. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zinadah, O.A.; Khalil, W.K.; Ashmaoui, H.M.; Abdul, F.; Alsoud, M.E. Evaluation of the anti-genotoxicity and growth performance impacts of green algae on Mugil cephalus. Life Sci. 2013, 10, 1543–1554. [Google Scholar]
- Raingeard, D.; Cancio, I.; Cajaraville, M.P. Cloning and expression pattern of peroxisome proliferator-activated receptor α in the thicklip grey mullet Chelon labrosus. Mar. Environ. Res. 2006, 62, S113–S117. [Google Scholar] [CrossRef]
- Shirota, A. Studies on the mouth size of fish larvae. Bull. Jpn. Soc. Sci. Fish. 1970, 36, 353–369. [Google Scholar] [CrossRef]
- Santhosh, B.; Anil, M.K.; Muhammed Anzeer, F.; Aneesh, K.S.; Abraham, M.V.; Gopakumar, G.; George, R.M.; Gopalakrishnan, A.; Unnikrishnan, C. Culture Techniques of Marine Copepods; Booklet No. 9/2018; CMFRI: Kochi, India, 2018. [Google Scholar]
- Oz, I.; Gajbhiye, D.S.; Columbus-Shenkar, Y.Y.; David, L.; Golan, M. Non-uniform metamorphosis underlies different development trajectories in hatchery-reared flathead grey mullet (Mugil cephalus). Front. Mar. Sci. 2022, 9, 1365. [Google Scholar] [CrossRef]
- Roo, J.; Fernández-Palacios, H.; Hernández-Cruz, C.M.; Mesa-Rodriguez, A.; Schuchardt, D.; Izquierdo, M. First results of spawning and larval rearing of longfin yellowtail Seriola rivoliana as a fast-growing candidate for European marine finfish aquaculture diversification. Aquac. Res. 2014, 45, 689–700. [Google Scholar] [CrossRef]
- Roo, J.; Hernández-Cruz, C.M.; Borrero, C.; Schuchardt, D.; Fernández-Palacios, H. Effect of larval density and feeding sequence on meagre (Argyrosomus regius; Asso, 1801) larval rearing. Aquaculture 2010, 302, 82–88. [Google Scholar] [CrossRef]
- Yanes-Roca, C.; Mráz, J.; Born-Torrijos, A.; Holzer, A.S.; Imentai, A.; Policar, T. Introduction of rotifers (Brachionus plicatilis) during pikeperch first feeding. Aquaculture 2018, 497, 260–268. [Google Scholar] [CrossRef]
- Imentai, A.; Rašković, B.; Steinbach, C.; Rahimnejad, S.; Yanes-Roca, C.; Policar, T. Effects of first feeding regime on growth performance, survival rate and development of digestive system in pikeperch (Sander lucioperca) larvae. Aquaculture 2020, 529, 735636. [Google Scholar] [CrossRef]
- Baskerville-Bridges, B.; Kling, L.J. Early weaning of Atlantic cod (Gadus morhua) larvae onto a microparticulate diet. Aquaculture 2000, 189, 109–117. [Google Scholar] [CrossRef]
- Nguyen, H.Q.; Reinertsen, H.; Wold, P.A.; Tran, T.M.; Kjørsvik, E. Effects of early weaning strategies on growth, survival and digestive enzyme activities in cobia (Rachycentron canadum L.) larvae. Aquac. Int. 2011, 19, 63–78. [Google Scholar] [CrossRef]
- Roo, F.J.; Hernández-Cruz, C.M.; Socorro, J.A.; Fernández-Palacios, H.; Montero, D.; Izquierdo, M.S. Effect of DHA content in rotifers on the occurrence of skeletal deformities in red porgy Pagrus pagrus (Linnaeus, 1758). Aquaculture 2009, 287, 84–93. [Google Scholar] [CrossRef]
- Torres, M.; Navarro, J.C.; Varó, I.; Agulleiro, M.J.; Morais, S.; Hontoria, F.M. Expression of genes related to long-chain (C18–22) and very long-chain (>C24) fatty acid biosynthesis in gilthead seabream (Sparus aurata) and Senegalese sole (Solea senegalensis) larvae: Investigating early ontogeny and nutritional regulation. Aquaculture 2020, 520, 734949. [Google Scholar] [CrossRef]
- Izquierdo, M.S.; Koven, W. Lipids in Larval Fish Nutrition; Holt, J., Ed.; John Wiley and Sons: New York, NY, USA, 2011; pp. 47–81. [Google Scholar]
- Roo, J.; Hernández-Cruz, C.M.; Mesa-Rodriguez, A.; Fernández-Palacios, H.; Izquierdo, M.S. Effect of increasing n-3 HUFA content in enriched Artemia on growth, survival, and skeleton anomalies occurrence of greater amberjack Seriola dumerili larvae. Aquaculture 2019, 500, 651–659. [Google Scholar] [CrossRef]
- Villalta, M.; Estévez, A.; Bransden, M.P.; Bell, J.G. The effect of graded concentrations of dietary DHA on growth, survival and tissue fatty acid profile of Senegal sole (Solea senegalensis) larvae during the Artemia feeding period. Aquaculture 2005, 249, 353–365. [Google Scholar] [CrossRef]
- Vizcaíno-Ochoa, V.; Lazo, J.P.; Barón-Sevilla, B.; Drawbridge, M.A. The effect of dietary docosahexaenoic acid (DHA) on growth, survival and pigmentation of California halibut Paralichthys californicus larvae (Ayres, 1810). Aquaculture 2010, 302, 228–234. [Google Scholar] [CrossRef]
- Galindo, A.; Garrido, D.; Pérez, J.A.M.; Betancor, M.B.; Acosta, N.G.; Kabeya, N.; Marrero, M.A.; Bolaños, A.; Rodríguez, C. Polyunsaturated fatty acid metabolism in three fish species with different trophic level. Aquaculture 2021, 530, 735761. [Google Scholar] [CrossRef]
- Djellata, A.; Sarih, S.; Hernández-Cruz, C.M.; Martínez-Rodríguez, G.; Gilannejad, N.; Roo, J. The effect of different co-feeding protocols on greater amberjack (Seriola dumerili, Risso 1810) larvae. Aquac. Nutr. 2021, 27, 1761–1776. [Google Scholar] [CrossRef]
- Benítez-Dorta, V.; Caballero, M.J.; Izquierdo, M.; Manchado, M.; Infante, C.; Zamorano, M.J.; Montero, D. Total substitution of fish oil by vegetable oils in Senegalese sole (Solea senegalensis) diets: Effects on fish performance, biochemical composition, and expression of some glucocorticoid receptor-related genes. Fish Physiol. Biochem. 2013, 39, 335–349. [Google Scholar] [CrossRef]
- Montero, D.; Izquierdo, M. Welfare and health of fish fed vegetable oils as alternative lipid sources to fish oil. In Fish Oil Replacement and Alternative Lipid Sources in Aquaculture Feeds; Turchini, G., Ng, W., Tocher, D., Eds.; CRC Press: Cambridge, UK, 2010; pp. 439–486. [Google Scholar]
- Opazo, R.; Valladares, L.; Romero, J. Comparison of gene expression patterns of key growth genes between different rate growths in zebrafish (Danio rerio) siblings. Lat. Am. J. Aquat. Res. 2017, 45, 766–775. [Google Scholar] [CrossRef]
Artemia sp. | Rotifers | D1 | D2 | |
---|---|---|---|---|
Proximate composition (% dry weight) | ||||
Lipids | 20.11 ± 2.32 | 16.07 ± 1.13 | 22.01 ± 1.57 | 16.20 ± 0.75 |
Protein | 63.66 ± 2.80 | 62.35 ± 3.58 | 60.12 ± 0.22 | 67.97 ± 0.06 |
Ash | 11.55 ± 3.06 | 12.43 ± 1.20 | 16.40 ± 0.18 | 9.08 ± 0.13 |
Fatty acid composition (% TFAs) | ||||
14:0 | 0.70 ± 0.22 | 1.29 ± 0.17 | 1.33 | 2.44 |
16:0 | 14.94 ± 4.67 | 14.09 ± 1.31 | 18.4 | 21.5 |
16:1n-7 | 2.81 ± 0.61 | 9.27 ± 0.36 | 1.98 | 3.86 |
18:0 | 7.59 ± 2.19 | 4.61 ± 0.37 | 4.88 | 5.48 |
18:1n-9 | 23.85 ± 4.35 | 13.08 ± 2.77 | 15.85 | 21.25 |
18:1n-7 | 8.33 ± 1.08 | 4.67 ± 0.21 | 2.36 | 2.99 |
18:2n-6 | 4.26 ± 1.15 | 10.71 ± 0.17 | 29.59 | 17.07 |
18:3n-3 | 21.58 ± 9.95 | 7.43 ± 0.05 | 2.67 | 2.31 |
20:1n-9 | 0.06 ± 0.02 | 0.55 ± 0.13 | 0.35 | 0.36 |
ARA (20:4n-6) | 0.74 ± 0.27 | 3.89 ± 0.70 | 0.9 | 0.79 |
EPA (20:5n-3) | 2.13 ± 0.94 | 5.72 ± 1.68 | 3.72 | 3.99 |
DHA (22:6n-3) | 1.30 ± 0.58 | 3.01 ± 0.71 | 8.02 | 6.11 |
DPA (22:5n-6) | 0.27 ± 0.12 | 1.47 ± 0.36 | 0.69 | 0.4 |
DHA/DPA | 4.77 ± 0.03 | 2.05 ± 0.02 | 11.59 | 15.41 |
ARA/EPA | 0.35 ± 0.03 | 0.69 ± 0.08 | 0.24 | 0.2 |
DHA/EPA | 0.74 ± 0.60 | 0.53 ± 0.03 | 2.16 | 1.53 |
DHA/ARA | 2.04 ± 1.53 | 0.77 ± 0.04 | 8.9 | 7.76 |
Oleic/DHA | 6.09 ± 1.06 | 1.59 ± 0.50 | 1.98 | 3.48 |
Oleic/n-3 PUFAs | 0.92 ± 0.53 | 0.63 ± 0.22 | 1.01 | 1.5 |
n-3/n-6 | 4.73 ± 0.92 | 1.09 ± 0.05 | 0.49 | 0.75 |
Total SFAs | 24.00 ± 6.87 | 20.56 ± 1.93 | 25.29 | 30.38 |
Total MUFAs | 38.17 ± 6.83 | 34.93 ± 2.94 | 26.3 | 35.09 |
Total n-3 | 29.60 ± 12.30 | 22.75 ± 2.86 | 15.94 | 14.51 |
Total n-6 | 6.12 ± 1.41 | 20.79 ± 1.67 | 32.58 | 19.32 |
Total n-9 | 24.39 ± 4.35 | 15.85 ± 1.94 | 16.68 | 22.18 |
Total n-3 PUFAs | 29.51 ± 12.32 | 21.45 ± 3.23 | 15.76 | 14.17 |
Total n-6 PUFAs | 1.28 ± 0.22 | 7.71 ± 1.48 | 2.08 | 1.67 |
Gene | Access. Number | Primer Sequence 5′–3′ | Initial Denaturation (°C) (Duration in min) | Denaturing Temperature | Annealing Temperature (°C) (Duration in s) | Extension Temperature (°C) (Duration in s) | Number of Cycles | Reference | |
---|---|---|---|---|---|---|---|---|---|
(°C) (Duration in s) | |||||||||
pla2g1b | MH350433 | F | ACACCTGTTGATGACCTGGA | 95 (3) | 95 (15) | 58.5 (30) | 58.5 (30) | 35 | [26] |
R | GTCTTGGTGGCCTTGTCAC | 95 (3) | 95 (15) | 58.5 (30) | 35 | ||||
amy2a | KF684941 | F | CCAAACTGGGAACTGTCATCAG | 95 (3) | 95 (15) | 58.5 (30) | 58.5 (30) | 35 | [26] |
R | TCTGGTTGTCGTGGTTGTCA | 95 (3) | 95 (15) | 58.5 (30) | 35 | ||||
cel | MH350432 | F | CTGACCATGCTGATGACCTG | 95 (3) | 95 (15) | 60 (30) | 58.5 (30) | 35 | [26] |
R | GGCAATCATGTAACCGGAGA | 95 (3) | 95 (15) | 58.5 (30) | 35 | ||||
ctr | KC195969 | F | CGTCCCTTCAGGATTATACCG | 95 (3) | 95 (15) | 60 (30) | 58.5 (30) | 35 | [26] |
R | AGTTGGAGGAACGGTCATGTT | 95 (3) | 95 (15) | 58.5 (30) | 35 | ||||
try2 | KF684940 | F | CTCCAGAACACAGCCATGAAG | 95 (3) | 95 (15) | 60 (30) | 58.5 (30) | 35 | [26] |
R | ACGTTCAGAGAGGCCTGGTAG | ||||||||
igf1 | AY427954.1 | F | TCT TCA AGA GTG CGA TGT GC | 95 (3) | 95 (15) | 53.8 (30) | 72 (30) | 35 | [34] |
R | ACA GCT TTG GAA GCA GCA CT | ||||||||
gh | AF134605.1 | F | CATG CAC AAG GTG AGG AAG A | 95 (3) | 95 (15) | 53.8 (30) | 72 (30) | 35 | [34] |
R | AGG TCT CAA CCT GCA AAC ATC | ||||||||
18S-rRNA | F | CACATCCAAGGAAGGCAGCA | 94 (2) | 94 (30) | 60 (30) | 68 (30) | 30 | [35] | |
R | AAGATACGCTATTGGAGCTG |
Initial (22 dph) | Intermediate (29 dph) | Final (36 dph) | |||||||
---|---|---|---|---|---|---|---|---|---|
WW (mg) | DW (mg) | TL (mm) | WW (mg) | DW (mg) | TL (mm) | WW (mg) | DW (mg) | TL (mm) | |
A100 | 1.82 ± 0.80 | 0.46 ± 0.09 | 5.60 ± 0.16 | 6.31 ± 1.33 a | 1.83 ± 0.27 a | 8.79 ± 0.33 | 41.28 ± 1.48 a | 9.84 ± 0.26 a | 15.51 ± 0.86 a |
A50 | 1.79 ± 0.64 | 0.42 ± 0.06 | 5.56 ± 0.08 | 3.78 ± 1.16 b | 1.09 ± 0.21 b | 8.03 ± 0.12 | 31.23 ± 3.65 b | 7.23 ± 1.02 b | 14.01 ± 1.24 ab |
A0 | 1.74 ± 0.69 | 0.46 ± 0.08 | 5.73 ± 0.27 | 3.95 ± 1.61 b | 1.15 ± 0.23 b | 8.01 ± 0.75 | 24.03 ± 7.99 b | 5.31 ± 2.02 b | 12.19 ± 1.45 b |
A100 | A50 | A0 | |
---|---|---|---|
Proximate composition (% dry weight) | |||
Lipids | 25.49 ± 0.73 a | 23.42 ± 0.86 ab | 23.17 ± 1.01 b |
Protein | 66.82 ± 1.78 | 69.72 ± 2.28 | 69.46 ± 2.28 |
Fatty acid composition (% TFAs) | |||
14:0 | 1.43 ± 0.05 | 1.31 ± 0.15 | 1.43 ± 0.32 |
16:0 | 21.61 ± 1.69 | 20.52 ± 1.41 | 21.41 ± 2.66 |
16:1n-7 | 3.62 ± 0.16 | 3.32 ± 0.42 | 3.86 ± 0.46 |
18:0 | 7.76 ± 0.73 | 7.92 ± 0.20 | 7.98 ± 0.51 |
18:1n-9 | 22.42 ± 0.91 a | 21.04 ± 1.02 ab | 19.18 ± 0.80 b |
18:1n-7 | 6.20 ± 0.46 a | 5.54 ± 0.33 a | 4.36 ± 0.10 b |
18:2n-6 | 8.67 ± 1.09 b | 10.00 ± 0.72 ab | 11.50 ± 0.79 a |
18:3n-3 | 6.32 ± 0.98 a | 5.49 ± 0.27 a | 2.82 ± 0.24 b |
20:1n-9 | 0.30 ± 0.02 b | 0.34 ± 0.03 b | 0.42 ± 0.02 a |
ARA (20:4n-6) | 1.05 ± 0.08 | 1.21 ± 0.19 | 1.45 ± 0.21 |
EPA (20:5n-3) | 2.51 ± 0.41 | 2.86 ± 0.41 | 2.99 ± 0.39 |
DHA (22:6n-3) | 5.37 ± 1.10 | 7.38 ± 1.73 | 9.18 ± 1.94 |
DPA (22:5n-6) | 0.37 ± 0.06 b | 0.50 ± 0.11 ab | 0.69 ± 0.15 a |
DHA/DPA | 14.46 ± 0.88 b | 14.81 ± 0.28 ab | 13.26 ± 0.55 a |
ARA/EPA | 0.42 ± 0.05 | 0.42 ± 0.01 | 0.49 ± 0.06 |
DHA/EPA | 2.14 ± 0.11 b | 2.58 ± 0.24 ab | 3.07 ± 0.38 a |
DHA/ARA | 5.09 ± 0.72 | 6.07 ± 0.46 | 6.32 ± 0.69 |
Oleic/DHA | 4.33 ± 1.13 | 2.97 ± 0.74 | 2.17 ± 0.60 |
Oleic/n-3 PUFAs | 1.30 ± 0.30 | 1.11 ± 0.16 | 1.07 ± 0.22 |
n-3/n-6 | 1.56 ± 0.12 a | 1.47 ± 0.06 a | 1.18 ± 0.09 b |
Total SFAs | 31.50 ± 2.50 | 30.49 ± 1.52 | 31.57 ± 3.27 |
Total MUFAs | 37.51 ± 1.71 | 35.48 ± 1.52 | 33.35 ± 0.97 |
Total n-3 | 17.88 ± 2.97 | 19.46 ± 2.12 | 18.49 ± 2.98 |
Total n-6 | 11.43 ± 1.29 b | 13.23 ± 1.14 ab | 15.65 ± 1.37 a |
Total n-9 | 23.76 ± 0.87 a | 22.31 ± 1.05 ab | 20.58 ± 0.73 b |
Total n-3 PUFAs | 17.64 ± 2.96 | 19.20 ± 2.11 | 18.26 ± 2.98 |
Total n-6 PUFAs | 11.06 ± 1.23 b | 12.74 ± 1.04 ab | 14.96 ± 1.23 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Quirós-Pozo, R.; Concu, D.; Robaina, L.; Vallainc, D.; Loi, B.; Roo, J. Effects of Different Co-Feeding Protocols on the Early Weaning of Flathead Grey Mullet (Mugil cephalus) Larvae. Animals 2023, 13, 1685. https://doi.org/10.3390/ani13101685
Quirós-Pozo R, Concu D, Robaina L, Vallainc D, Loi B, Roo J. Effects of Different Co-Feeding Protocols on the Early Weaning of Flathead Grey Mullet (Mugil cephalus) Larvae. Animals. 2023; 13(10):1685. https://doi.org/10.3390/ani13101685
Chicago/Turabian StyleQuirós-Pozo, Raquel, Danilo Concu, Lidia Robaina, Dario Vallainc, Barbara Loi, and Javier Roo. 2023. "Effects of Different Co-Feeding Protocols on the Early Weaning of Flathead Grey Mullet (Mugil cephalus) Larvae" Animals 13, no. 10: 1685. https://doi.org/10.3390/ani13101685
APA StyleQuirós-Pozo, R., Concu, D., Robaina, L., Vallainc, D., Loi, B., & Roo, J. (2023). Effects of Different Co-Feeding Protocols on the Early Weaning of Flathead Grey Mullet (Mugil cephalus) Larvae. Animals, 13(10), 1685. https://doi.org/10.3390/ani13101685