The Impact of Curcumin on Growth Performance, Growth-Related Gene Expression, Oxidative Stress, and Immunological Biomarkers in Broiler Chickens at Different Stocking Densities
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals
2.1.1. Animal Care
2.1.2. Birds and Housing Conditions
2.2. Growth Performance
2.3. Behavioral Observations
2.4. Blood Sampling
2.5. Hematological and Immunological Parameters Measurements
2.6. Biochemical and Hormonal Analysis
2.7. Serum Malondialdehyde Level and Anti-Oxidative Enzymes Activity
2.8. Gene Expression Analysis
2.9. Statistical Analysis
3. Results
3.1. Productive Performance
3.2. Behavioural Observation
3.3. Haematological Parameters
3.4. Immunological Parameters
3.5. Biochemical and Hormonal Analysis
3.6. Serum Oxidant/Antioxidant Measurements
3.7. Gene Expression of Growth Regulatory Factors
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Petek, M.; Çİbİk, R.; Yİldİz, H.; Sonat, F.A.; Gezen, S.S.; Orman, A.; Aydİn, C. The influence of different lighting programs, stocking densities and litter amounts on the welfare and productivity traits of a commercial broiler line. Vet. Zootech. 2010, 51, 36–43. [Google Scholar]
- Pulina, G.; Francesconi, A.H.D.; Stefanon, B.; Sevi, A.; Calamari, L.; Lacetera, N.; Dell’Orto, V.; Pilla, F.; Ajmone Marsan, P.; Mele, M. Sustainable ruminant production to help feed the planet. Ital. J. Anim. Sci. 2017, 16, 140–171. [Google Scholar] [CrossRef] [Green Version]
- Sejian, V.; Silpa, M.V.; Reshma Nair, M.R.; Devaraj, C.; Krishnan, G.; Bagath, M.; Chauhan, S.S.; Suganthi, R.U.; Fonseca, V.F.; König, S. Heat stress and goat welfare: Adaptation and production considerations. Animals 2021, 11, 1021. [Google Scholar] [CrossRef] [PubMed]
- Lara, L.J.; Rostagno, M.H. Impact of heat stress on poultry production. Animals 2013, 3, 356–369. [Google Scholar] [CrossRef]
- Goo, D.; Kim, J.H.; Park, G.H.; Delos Reyes, J.B.; Kil, D.Y. Effect of heat stress and stocking density on growth performance, breast meat quality, and intestinal barrier function in broiler chickens. Animals 2019, 9, 107. [Google Scholar] [CrossRef] [Green Version]
- Feddes, J.J.; Emmanuel, E.J.; Zuidhoft, M.J. Broiler performance, body weight variance, feed and water intake, and carcass quality at different stocking densities. Poult. Sci. 2002, 81, 774–779. [Google Scholar] [CrossRef]
- Škrbić, Z.; Pavlovski, Z.; Lukić, M.; Perić, L.; Milošević, N. The effect of stocking density on certain broiler welfare parameters. Biotechnol. Anim. Husb. 2009, 25, 11–21. [Google Scholar] [CrossRef] [Green Version]
- Abudabos, A.M.; Samara, E.M.; Hussein, E.O.; Al-Ghadi, M.a.Q.; Al-Atiyat, R.M. Impacts of stocking density on the performance and welfare of broiler chickens. Ital. J. Anim. Sci. 2013, 12, e11. [Google Scholar] [CrossRef] [Green Version]
- Beloor, J.; Kang, H.; Kim, Y.; Subramani, V.; Jang, I.; Sohn, S.; Moon, Y.S. The effect of stocking density on stress related genes and telomeric length in broiler chickens. Asian-Australas. J. Anim. Sci. 2010, 23, 437–443. [Google Scholar] [CrossRef]
- Nager, R.; Monaghan, P.; Griffiths, R.; Houston, D.; Dawson, R. Experimental demonstration that offspring sex ratio varies with maternal condition. Proc. Natl. Acad. Sci. USA 1999, 96, 570–573. [Google Scholar] [CrossRef] [Green Version]
- Griffiths, R. Sex-biased mortality in the lesser black-backed gull Larus fuscus during the nestling stage. Ibis 1992, 134, 237–244. [Google Scholar] [CrossRef]
- Kamel, N.; Hady, M.; Ragaa, N.; Mohamed, F. Effect of nucleotides on growth performance, gut health, and some immunological parameters of broiler chicken exposed to high stocking density. Livest. Sci. 2021, 253, 104703. [Google Scholar] [CrossRef]
- Li, W.; Wei, F.; Xu, B.; Sun, Q.; Deng, W.; Ma, H.; Bai, J.; Li, S. Effect of stocking density and alpha-lipoic acid on the growth performance, physiological and oxidative stress and immune response of broilers. Asian-Australas. J. Anim. Sci. 2019, 32, 1914–1922. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Selvam, R.; Saravanakumar, M.; Suresh, S.; Sureshbabu, G.; Sasikumar, M.; Prashanth, D. Effect of vitamin E supplementation and high stocking density on the performance and stress parameters of broilers. Rev. Bras. Ciência Avícola 2017, 19, 587–594. [Google Scholar] [CrossRef] [Green Version]
- Li, X.M.; Zhang, M.H.; Liu, S.M.; Feng, J.H.; Ma, D.D.; Liu, Q.X.; Zhou, Y.; Wang, X.J.; Xing, S. Effects of stocking density on growth performance, growth regulatory factors, and endocrine hormones in broilers under appropriate environments. Poult. Sci. 2019, 98, 6611–6617. [Google Scholar] [CrossRef]
- Qasem, M.A.A.; Alhajj, M.S.; Ger El Nabi, A.R.; Al-Mufarrej, S.I. Effect of turmeric powder as a dietary supplement on performance indicators and immune responses in broiler chickens. J. Anim. Vet. Adv. 2015, 14, 30–35. [Google Scholar]
- Hady, M.M.; Zaki, M.M.; EL-Ghany, W.A.; Korany, M.S.R. Assessment of the broilers performance, gut healthiness and carcass characteristics in response to dietary inclusion of dried coriander, turmeric and thyme. Int. J. Environ. Agric. Res. 2016, 2, 153–159. [Google Scholar]
- Valenzuela-Grijalva, N.V.; Pinelli-Saavedra, A.; Muhlia-Almazan, A.; Dominguez-Diaz, D.; Gonzalez-Rios, H. Dietary inclusion effects of phytochemicals as growth promoters in animal production. J. Anim. Sci. Technol. 2017, 59, 8. [Google Scholar] [CrossRef] [Green Version]
- Prasad, S.; Tyagi, A.K.; Aggarwal, B.B. Recent developments in delivery, bioavailability, absorption and metabolism of curcumin: The golden pigment from golden spice. Cancer Res. Treat. 2014, 46, 2–18. [Google Scholar] [CrossRef] [Green Version]
- Al-Mashhadani, H.E. Effect of different levels of turmeric (Curcuma longa) supplementation on broiler performance, carcass characteristic and bacterial count. Egypt. Poult. Sci. J. 2015, 35, 25–39. [Google Scholar]
- Salah, A.S.; Mahmoud, M.A.; Ahmed-Farid, O.A.; El-Tarabany, M.S. Effects of dietary curcumin and acetylsalicylic acid supplements on performance, muscle amino acid and fatty acid profiles, antioxidant biomarkers and blood chemistry of heat-stressed broiler chickens. J. Therm. Biol. 2019, 84, 259–265. [Google Scholar] [CrossRef] [PubMed]
- Nawab, A.; Li, G.; Liu, W.; Lan, R.; Wu, J.; Zhao, Y.; Kang, K.; Kieser, B.; Sun, C.; Tang, S.; et al. Effect of dietary curcumin on the antioxidant status of laying hens under high-temperature condition. J. Therm. Biol. 2019, 86, 102449. [Google Scholar] [CrossRef] [PubMed]
- Laganá, C.; Saldanha, E.S.P.B.; Sartori, J.R.; Turco, P.H.N.; Gonzales, E.; Luciano, R.L.; Zanatta, G.; Fascina, V.B. Turmeric on poultry production: A Review. Agric. Sci. 2019, 10, 1592–1601. [Google Scholar] [CrossRef] [Green Version]
- Moniruzzaman, M.; Min, T. Curcumin, curcumin nanoparticles and curcumin nanospheres: A review on their pharmacodynamics based on monogastric farm animal, poultry and fish nutrition. Pharmaceutics 2020, 12, 447. [Google Scholar] [CrossRef]
- Nawab, A.; Tang, S.; Li, G.; An, L.; Wu, J.; Liu, W.; Xiao, M. Dietary curcumin supplementation effects on blood immunological profile and liver enzymatic activity of laying hens after exposure to high temperature conditions. J. Therm. Biol. 2020, 90, 102573. [Google Scholar] [CrossRef]
- Paw, M.; Gogoi, R.; Sarma, N.; Pandey, S.K.; Borah, A.; Begum, T.; Lal, M. Study of anti-oxidant, anti-inflammatory, genotoxicity, and antimicrobial activities and analysis of different constituents found in rhizome essential oil of Curcuma caesia Roxb., collected from north east India. Curr. Pharm. Biotechnol. 2020, 21, 403–413. [Google Scholar] [CrossRef]
- Ruan, D.; Wang, W.; Lin, C.; Fouad, A.; Chen, W.; Xia, W.; Wang, S.; Luo, X.; Zhang, W.; Yan, S. Effects of curcumin on performance, antioxidation, intestinal barrier and mitochondrial function in ducks fed corn contaminated with ochratoxin A. Animal 2019, 13, 42–52. [Google Scholar] [CrossRef]
- Rajput, N.; Muhammad, N.; Yan, R.; Zhong, X.; Wang, T. Effect of dietary supplementation of curcumin on growth performance, intestinal morphology and nutrients utilization of broiler chicks. J. Poult. Sci. 2013, 50, 44–52. [Google Scholar] [CrossRef] [Green Version]
- Saleh, A.A.; Alhotan, R.A.; Alharthi, A.S.; Nassef, E.; Kassab, M.A.; Farrag, F.A.; Hendam, B.M.; Abumnadour, M.; Shukry, M. Insight view on the role of in ovo feeding of clenbuterol on hatched chicks: Hatchability, growth efficiency, serum metabolic profile, muscle, and lipid-related markers. Animals 2021, 11, 2429. [Google Scholar] [CrossRef]
- El-Kazaz, S.E.; Hafez, M.H. Evaluation of copper nanoparticles and copper sulfate effect on immune status, behavior, and productive performance of broilers. J. Adv. Vet. Anim. Res. 2020, 7, 16–25. [Google Scholar] [CrossRef]
- Reiter, K.; Bessei, W. The behaviour of broilers in response to group size and stocking density. Arch. Geflügelk 1999, 64, 93–98. [Google Scholar]
- Schalm, O.W.; Jain, N.C.; Carroll, E.J. Veterinary Hematology; Lea & Febiger: Columbus, OH, USA, 1975. [Google Scholar]
- Reitman, S.; Frankel, S. A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am. J. Clin. Pathol. 1957, 28, 56–63. [Google Scholar] [CrossRef] [PubMed]
- Kirrella, A.A.; Abdo, S.E.; El-Naggar, K.; Soliman, M.M.; Aboelenin, S.M.; Dawood, M.A.O.; Saleh, A.A. Use of corn silk meal in broiler diet: Effect on growth performance, blood biochemistry, immunological responses, and growth-related gene expression. Animals 2021, 11, 1170. [Google Scholar] [CrossRef] [PubMed]
- SAS Institute. Using JMP Student Edition for Windows and Macintosh: The User’s Guide to Statistics with JMP Student Edition; SAS Institute: Cary, NC, USA, 2009. [Google Scholar]
- Levene, H. Robust tests for equality of variances. In Contributions to Probability and Statistics. Essays in Honor of Harold Hotelling; Stanford University Press: Palo Alto, CA, USA, 1961; pp. 279–292. [Google Scholar]
- Ran, L.; Wang, X.; Mi, A.; Liu, Y.; Wu, J.; Wang, H.; Guo, M.; Sun, J.; Liu, B.; Li, Y. Loss of adipose growth hormone receptor in mice enhances local fatty acid trapping and impairs brown adipose tissue thermogenesis. Iscience 2019, 16, 106–121. [Google Scholar] [CrossRef] [Green Version]
- Farkašová, H.; Hron, T.; Pačes, J.; Pajer, P.; Elleder, D. Identification of a GC-rich leptin gene in chicken. Agri. Gene 2016, 1, 88–92. [Google Scholar] [CrossRef]
- Yadav, S.; Teng, P.-Y.; Dos Santos, T.S.; Gould, R.L.; Craig, S.W.; Fuller, A.L.; Pazdro, R.; Kim, W.K. The effects of different doses of curcumin compound on growth performance, antioxidant status, and gut health of broiler chickens challenged with Eimeria species. Poult. Sci. 2020, 99, 5936–5945. [Google Scholar] [CrossRef]
- Sokół, R.; Koziatek-Sadłowska, S.; Michalczyk, M. The influence of Dermanyssus gallinae and different lighting regimens on selected blood proteins, corticosterone levels and egg production in layer hens. Vet. Res. Commun. 2019, 43, 31–36. [Google Scholar] [CrossRef] [Green Version]
- Fouad, M.A.; Abdel Razek, A.H.; Badawy, E.M. Broilers welfare and economics under two management alternatives on commercial scale. Int. J. Poult. Sci. 2008, 7, 1167–1173. [Google Scholar] [CrossRef] [Green Version]
- Hall, A.L. The effect of stocking density on the welfare and behaviour of broiler chickens reared commercially. Anim. Welf. 2001, 10, 23–40. [Google Scholar]
- Thomas, D.G.; Son, J.-H.; Ravindran, V.; Thomas, D.V. The Effect of stocking density on the behaviour of broiler chickens. Korean J. Poult. Sci. 2011, 38, 1–4. [Google Scholar] [CrossRef] [Green Version]
- Pimson, C.; Bakban, P.; Suwanrat, S.; Chanutsa, N. The effect of curcumin on growth performance, blood biochemistry and antioxidant activities in broiler chickens. Vet. Integr. Sci. 2018, 16, 95–107. [Google Scholar]
- Lin, H.; Decuypere, E.; Buyse, J. Oxidative stress induced by corticosterone administration in broiler chickens (Gallus gallus domesticus): 1. Chronic exposure. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2004, 139, 737–744. [Google Scholar] [CrossRef] [PubMed]
- Goo, D.; Kim, J.H.; Park, G.H.; Delos Reyes, J.B.; Kil, D.Y. Effect of stocking density and dietary tryptophan on growth performance and intestinal barrier function in broiler chickens. Poult. Sci. 2019, 98, 4504–4508. [Google Scholar] [CrossRef] [PubMed]
- El-Gogary, M.; Abo El-Maaty, H. Impact of zinc supplementation and stocking density on performance, physiological and immune responses in broiler chickens. J. Anim. Poult. Prod. 2020, 11, 95–102. [Google Scholar] [CrossRef]
- Polinska, B.; Matowicka-Karna, J.; Kemona, H. The cytokines in inflammatory bowel disease. Postepy Hig. Med. Dosw. (Online) 2009, 63, 389–394. [Google Scholar]
- Rahmani, M.; Golian, A.; Kermanshahi, H.; Reza Bassami, M. Effects of curcumin or nanocurcumin on blood biochemical parameters, intestinal morphology and microbial population of broiler chickens reared under normal and cold stress conditions. J. Appl. Anim. Res. 2017, 46, 200–209. [Google Scholar] [CrossRef] [Green Version]
- Akbarian, A.; Golian, A.; Kermanshahi, H.; Gilani, A.; Moradi, S. Influence of turmeric rhizome and black pepper on blood constituents and performance of broiler chickens. Afr. J. Biotechnol. 2012, 11, 8606–8611. [Google Scholar]
- Wang, B.; Min, Z.; Yuan, J.; Zhang, B.; Guo, Y. Effects of dietary tryptophan and stocking density on the performance, meat quality, and metabolic status of broilers. J. Anim. Sci. Biotechnol. 2014, 5, 44. [Google Scholar] [CrossRef] [Green Version]
- Kim, M.; Kim, Y. Hypocholesterolemic effects of curcumin via up-regulation of cholesterol 7a-hydroxylase in rats fed a high fat diet. Nutr. Res. Pract. 2010, 4, 191–195. [Google Scholar] [CrossRef] [Green Version]
- Xiao, Y.; Wu, C.; Li, K.; Gui, G.; Zhang, G.; Yang, H. Association of growth rate with hormone levels and myogenic gene expression profile in broilers. J. Anim. Sci. Biotechnol. 2017, 8, 43. [Google Scholar] [CrossRef] [Green Version]
- Wen, C.; Chen, Y.; Wu, P.; Wang, T.; Zhou, Y. MSTN, mTOR and FoxO4 are involved in the enhancement of breast muscle growth by methionine in broilers with lower hatching weight. PLoS ONE 2014, 9, e114236. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seroussi, E.; Cinnamon, Y.; Yosefi, S.; Genin, O.; Smith, J.G.; Rafati, N.; Bornelov, S.; Andersson, L.; Friedman-Einat, M. Identification of the long-sought leptin in chicken and duck: Expression pattern of the highly GC-rich avian leptin fits an autocrine/paracrine rather than endocrine function. Endocrinology 2016, 157, 737–751. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Ingredients | Diet | ||
---|---|---|---|
Starter | Grower | Finisher | |
Yellow corn | 542 | 558.8 | 606 |
Soybean meal (44%) | 319 | 281 | 253.3 |
Corn gluten meal (60%) | 71 | 81 | 48.1 |
Vegetable oil | 29.8 | 41 | 54.4 |
Limestone 1 | 15 | 15 | 15 |
Monocalcium phosphate 2 | 14 | 14 | 14 |
Common salt | 3 | 3 | 3 |
Mineral Premix 3 | 1.5 | 1.5 | 1.5 |
Vitamin Premix 3 | 1.5 | 1.5 | 1.5 |
Methionine 4 | 1 | 1 | 1 |
Lysine 5 | 1 | 1 | 1 |
Anti-coccidial 6 | 0.2 | 0.2 | 0.2 |
Antimould 7 | 1 | 1 | 1 |
Calculated analysis | |||
Crude protein (CP, %) | 23.1 | 22.18 | 19.39 |
Metabolizable energy (ME, Kcal/kg diet) 8 | 3053 | 3160.7 | 3252.6 |
Calorie/protein ratio 9 | 132.16 | 142.5 | 167.7 |
Behaviour | Description |
---|---|
Feeding | Pecking at feed-on-feed troughs. |
Drinking | Obtaining water from the cup. |
Standing idle | The abdomen is not touching the litter, and the bird is motionless with no other behaviour. |
Crouching | The bird remains sitting and lying on the litter, looking around or with closed eyes, no other behaviour. |
Walking | Take at least two successive steps. |
Preening | The bird cleans and aligns its feathers using the beak. |
Ruffling | The action of ruffle or shackling all body feathers. |
Shaking | The action of body trembling. |
Gene | Accession No. | Primer | References | Amplicon Size (bp) | Annealing Temp (°C) |
---|---|---|---|---|---|
Growth hormone receptor (GHR) | NM_001001293 | R: AGAAGTCAGTGTTTGTCAGGG F: AACACAGATACCCAACAGCC | [37] | 93 | 60 |
Insulin-like growth factor-1 (IGF-1) | NM_001004384 | R: CTTGTGGATGGCATGATCT F: CACCTAAATCTGCACGCT | [34] | 91 | 60 |
Leptin | KT970642.1 | R: CCAGGACGCCATCCAGGCTCTCTGGC F: TCCGCCAAGCAGAGGGGT | [38] | 261 | 58 |
Myostatin (MSTN) | NM_001001461 | F: TACCCGCTGACAGTGGATTTC R: GCCTCTGGGATTTGCTTGG | [37] | 173 | 58 |
β-actin | NM_205518 | F: ACCTGAGCGCAAGTACTCTGTCT R: CATCGTACTCCTGCTTGCTGAT | [34] | 160 | 60 |
Initial Body Weight (g) | Final Body Weight (g) | Body Weight Gain (g) | Feed Intake (g) | Feed Conversion Ratio (FCR) | |
---|---|---|---|---|---|
MSD control | 412.15 ± 15.23 | 2101.28 ± 165.23 a | 1689.13 ± 161.32 a | 2785.26 ± 62.52 a | 1.65 ± 0.03 b |
HSD control | 419.96 ± 18.52 | 1558.23 ± 150.23 c | 1118.27 ± 149.25 c | 2099.35 ± 38.11 d | 1.88 ± 0.05 a |
HSD + curcumin 100 | 429.88 ± 20.14 | 1723.77 ± 193.42 b | 1293.89 ± 185.96 b | 2302.67 ± 26.33 c | 1.77 ± 0.06 ab |
HSD + curcumin 200 | 428.23 ± 23.18 | 1989.87 ± 201.78 ab | 1561.64 ± 198.23 ab | 2623.25 ± 27.27 b | 1.68 ± 0.04 b |
P-Tukey | 0.41 | <0.0001 | <0.0001 | <0.0001 | <0.0001 |
PCV (%) | Hb (g/dL) | RBCs (1012/L) | WBCs (109/L) | ESR (mm/h) | H/L Ratio (%) | |
---|---|---|---|---|---|---|
MSD control | 24.42 ± 0.27 a | 12.23 ± 0.04 a | 2.49 ± 0.01 a | 24.1 ± 0.26 | 3.15 ± 0.02 c | 0.263 ± 0.008 c |
HSD control | 17.35 ± 0.31 d | 8.35 ± 0.08 c | 1.92 ± 0.01 b | 24.5 ± 0.38 | 5.52 ± 0.05 a | 0.452 ± 0.007 a |
HSD + curcumin 100 | 20.61 ± 0.24 c | 10.87 ± 0.06 b | 2.11 ± 0.02 ab | 23.6 ± 0.32 | 4.17 ± 0.01 b | 0.329 ± 0.006 b |
HSD + curcumin 200 | 22.61 ± 0.22 ab | 11.87 ± 0.06 a | 2.31 ± 0.03 a | 24.2 ± 0.26 | 3.97 ± 0.01 c | 0.289 ± 0.006 c |
P-Tukey | <0.0001 | <0.0001 | <0.0001 | 0.51 | <0.0001 | <0.0001 |
IgA (g/L) | IgG (g/L) | IgM (g/L) | IL-2 (pg/mL) | IL-6 (pg/mL) | TNF-a (pg/mL) | |
---|---|---|---|---|---|---|
MSD control | 0.062 ± 0.002 a | 0.089 ± 0.003 a | 0.092 ± 0.005 a | 110.14 ± 5.41 d | 15.62 ± 0.87 d | 69.92 ± 3.54 c |
HSD control | 0.015 ± 0.003 b | 0.034 ± 0.008 c | 0.048 ± 0.009 d | 166.67 ± 8.11 a | 28.58 ± 2.74 a | 98.02 ± 7.22 a |
HSD + curcumin 100 | 0.048 ± 0.002 ab | 0.055 ± 0.006 bc | 0.066 ± 0.007 c | 141.67 ± 6.33 b | 22.54 ± 1.66 b | 77.37 ± 5.81 b |
HSD + curcumin 200 | 0.061 ± 0.003 a | 0.065 ± 0.006 b | 0.079 ± 0.007 b | 122.14 ± 7.27 c | 18.54 ± 0.96 c | 71.16 ± 4.54 c |
P-Tukey | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 |
Total Protein (mg/dL) | Albumin (mg/dL) | Total Cholesterol (mg/dL) | AST (U/L) | ALT (U/L) | |
---|---|---|---|---|---|
MSD control | 3.85 ± 0.25 | 2.205 ± 0.038 | 120.0 ± 4.8 d | 212.3 ± 16.3 d | 24.75 ± 5.04 b |
HSD control | 3.42 ± 0.31 | 2.045 ± 0.027 | 159.8 ± 9.04 a | 302.8 ± 19.3 a | 32.08 ± 4.22 a |
HSD + curcumin 100 | 3.65 ± 0.21 | 2.155 ± 0.029 | 139.8 ± 12.14 b | 242.3 ± 12.9 b | 29.57 ± 3.73 ab |
HSD + curcumin 200 | 3.81 ± 0.18 | 2.179 ± 0.038 | 126.8 ± 8.23 c | 226.7 ± 14.7 c | 25.75 ± 3.04 b |
P-Tukey | 0.27 | 0.12 | <0.0001 | <0.0001 | <0.0001 |
Hormonal Concentrations | Oxidant/Antioxidant Parameters | ||||||
---|---|---|---|---|---|---|---|
T3 (ng/mL) | T4 (ng/mL) | Corticosterone (ng/mL) | MDA (µmol/L) | SOD (U/mL) | GPx (U/L) | CAT (U/L) | |
MSD control | 3.57 ± 0.13 a | 55.99 ± 3.84 a | 2.95 ± 0.081 d | 1.45 ± 0.027 c | 2.93 ± 0.031 a | 109.57 ± 8.64 a | 69.57 ± 4.73 a |
HSD control | 2.03 ± 0.08 c | 29.74 ± 1.77 d | 5.74 ± 0.027 a | 3.02 ± 0.031 a | 1.77 ± 0.017 c | 62.22 ± 4.18 d | 32.08 ± 2.22 c |
HSD + curcumin 100 | 2.76 ± 0.11 b | 41.21 ± 2.03 c | 4.06 ± 0.065 b | 2.14 ± 0.021 b | 2.23 ± 0.029 b | 83.41 ± 5.04 c | 55.57 ± 3.34 b |
HSD + curcumin 200 | 3.17 ± 0.09 a | 49.65 ± 2.22 ab | 3.26 ± 0.082 c | 1.74 ± 0.021 c | 2.72 ± 0.031 a | 95.49 ± 4.19 b | 63.75 ± 3.84 ab |
P-Tukey | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hafez, M.H.; El-Kazaz, S.E.; Alharthi, B.; Ghamry, H.I.; Alshehri, M.A.; Sayed, S.; Shukry, M.; El-Sayed, Y.S. The Impact of Curcumin on Growth Performance, Growth-Related Gene Expression, Oxidative Stress, and Immunological Biomarkers in Broiler Chickens at Different Stocking Densities. Animals 2022, 12, 958. https://doi.org/10.3390/ani12080958
Hafez MH, El-Kazaz SE, Alharthi B, Ghamry HI, Alshehri MA, Sayed S, Shukry M, El-Sayed YS. The Impact of Curcumin on Growth Performance, Growth-Related Gene Expression, Oxidative Stress, and Immunological Biomarkers in Broiler Chickens at Different Stocking Densities. Animals. 2022; 12(8):958. https://doi.org/10.3390/ani12080958
Chicago/Turabian StyleHafez, Mona H., Sara E. El-Kazaz, Badr Alharthi, Heba I. Ghamry, Mohammed A. Alshehri, Samy Sayed, Mustafa Shukry, and Yasser S. El-Sayed. 2022. "The Impact of Curcumin on Growth Performance, Growth-Related Gene Expression, Oxidative Stress, and Immunological Biomarkers in Broiler Chickens at Different Stocking Densities" Animals 12, no. 8: 958. https://doi.org/10.3390/ani12080958