Development and Application of a High-Resolution Melting Analysis with Unlabeled Probes for the Screening of Short-Tailed Sheep TBXT Heterozygotes
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Materials
2.3. Methods
2.3.1. Genomic DNA Extraction
2.3.2. PCR Amplification and Sequence Alignment
2.3.3. HRM Reaction
2.3.4. Acquisition of X-ray Images of Sheep Caudal Vertebrae
2.3.5. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
6. Patents
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Mincer, S.T.; Russo, G.A. Substrate use drives the macroevolution of mammalian tail length diversity. Proc. Boil. Sci. 2020, 287, 20192885. [Google Scholar] [CrossRef] [Scilit]
- Hickman, G.C. The mammalian tail: A review of functions. Mammal Rev. 1979, 9, 143–157. [Google Scholar] [CrossRef] [Scilit]
- Zhu, C.; Cheng, H.; Li, N.; Liu, T.; Ma, Y. Isobaric tags for relative and absolute quantification-based proteomics reveals candidate proteins of fat deposition in chinese indigenous sheep with morphologically different tails. Front. Genet. 2021, 12, 710449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abied, A.; Bagadi, A.; Bordbar, F.; Pu, Y.; Augustino, S.M.; Xue, X.; Xing, F.; Gebreselassie, G.; Han, J.-L.; Mwacharo, J.-L.H.J.M.; et al. Genomic diversity, population structure, and signature of selection in five chinese native sheep breeds adapted to extreme environments. Genes 2020, 11, 494. [Google Scholar] [CrossRef] [Scilit]
- Moradi, M.H.; Nejati-Javaremi, A.; Moradi-Shahrbabak, M.; Dodds, K.G.; McEwan, J.C. Genomic scan of selective sweeps in thin and fat tail sheep breeds for identifying of candidate regions associated with fat deposition. BMC Genet. 2012, 13, 10. [Google Scholar] [CrossRef] [Scilit]
- Rocha, J.; Chen, S.; Beja-Pereira, A. Molecular evidence for fat-tailed sheep domestication. Trop. Anim. Health Prod. 2011, 43, 1237–1243. [Google Scholar] [CrossRef] [Scilit]
- Zhu, C.; Li, N.; Cheng, H.; Ma, Y. Genome wide association study for the identification of genes associated with tail fat deposition in Chinese sheep breeds. Biol. Open 2021, 10, bio054932. [Google Scholar] [CrossRef] [Scilit]
- Xu, S.-S.; Ren, X.; Yang, G.-L.; Xie, X.-L.; Zhao, Y.-X.; Zhang, M.; Shen, Z.-Q.; Ren, Y.-L.; Gao, L.; Shen, M.; et al. Genome-wide association analysis identifies the genetic basis of fat deposition in the tails of sheep (Ovis aries). Anim. Genet. 2017, 48, 560–569. [Google Scholar] [CrossRef] [Scilit]
- Kalds, P.; Luo, Q.; Sun, K.; Zhou, S.; Chen, Y.; Wang, X. Trends towards revealing the genetic architecture of sheep tail patterning: Promising genes and investigatory pathways. Anim. Genet. 2021, 52, 799–812. [Google Scholar] [CrossRef] [Scilit]
- Ben Ettoumia, R.; Vernet, J.; Ortigues-Marty, I.; Kraiem, K.; Majdoub-Mathlouthi, L. Effects of metabolizable energy intake on post weaning lamb growth performance, carcass tissue composition and internal fat depend on animal characteristics: A meta-analysis. Meat Sci. 2021, 185, 108719. [Google Scholar] [CrossRef] [Scilit]
- Soriano, V.; Phillips, C.; Taconeli, C.; Fragoso, A.; Molento, C. Mind the Gap: Animal Protection Law and Opinion of Sheep Farmers and Lay Citizens Regarding Animal Maltreatment in Sheep Farming in Southern Brazil. Animals 2021, 11, 1903. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McCracken, L.; Waran, N.; Mitchinson, S.; Johnson, C.B. Effect of age at castration on behavioural response to subsequent tail docking in lambs. Vet. Anaesth. Analg. 2010, 37, 375–381. [Google Scholar] [CrossRef] [Scilit]
- Small, A.; Fisher, A.; Lee, C.; Colditz, I. Analgesia for Sheep in Commercial Production: Where to Next? Animals 2021, 11, 1127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Phillips, C.J.C.; Wojciechowska, J.; Meng, J.; Cross, N. Perceptions of the importance of different welfare issues in livestock production. Animals 2009, 3, 1152–1166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdullah, A.Y.; Kridli, R.T.; Shaker, M.M.; Obeidat, M.D. Investigation of growth and carcass characteristics of pure and crossbred Awassi lambs. Small Rumin. Res. 2010, 94, 167–175. [Google Scholar] [CrossRef] [Scilit]
- Han, J.; Yang, M.; Guo, T.; Niu, C.; Liu, J.; Yue, Y.; Yuan, C.; Yang, B. Two linked TBXT (brachyury) gene polymorphisms are associated with the tailless phenotype in fat-rumped sheep. Anim. Genet. 2019, 50, 772–777. [Google Scholar] [CrossRef] [Scilit]
- Zhi, D.; Da, L.; Liu, M.; Cheng, C.; Zhang, Y.; Wang, X.; Li, X.; Tian, Z.; Yang, Y.; He, T.; et al. Whole genome sequencing of hulunbuir short-tailed sheep for identifying candidate genes related to the short-tail phenotype. G3 Genes Genomes Genet. 2018, 8, 377–383. [Google Scholar] [CrossRef] [Scilit]
- Ahbara, A.; Bahbahani, H.; Almathen, F.; Al Abri, M.; Agoub, M.O.; Abeba, A.; Kebede, A.; Musa, H.H.; Mastrangelo, S.; Pilla, F.; et al. Genome-Wide Variation, Candidate Regions and Genes Associated with Fat Deposition and Tail Morphology in Ethiopian Indigenous Sheep. Front. Genet. 2019, 9, 699. [Google Scholar] [CrossRef] [Scilit]
- Dong, K.; Yang, M.; Han, J.; Ma, Q.; Han, J.; Song, Z.; Luosang, C.; Gorkhali, N.A.; Yang, B.; He, X.; et al. Genomic analysis of worldwide sheep breeds reveals PDGFD as a major target of fat-tail selection in sheep. BMC Genom. 2020, 21, 800. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Yang, J.; Shen, M.; Xie, X.-L.; Liu, G.-J.; Xu, Y.-X.; Lv, F.-H.; Yang, H.; Yang, Y.-L.; Liu, C.-B.; et al. Whole-genome resequencing of wild and domestic sheep identifies genes associated with morphological and agronomic traits. Nat. Commun. 2020, 11, 2815. [Google Scholar] [CrossRef] [Scilit]
- Herrmann, B.G.; Labeit, S.; Poustka, A.; King, T.R.; Lehrach, H. Cloning of the T gene required in mesoderm formation in the mouse. Nature 1990, 343, 617–622. [Google Scholar] [CrossRef] [Scilit]
- Lolas, M.; Valenzuela, P.D.T.; Tjian, R.; Liu, Z. Charting Brachyury-mediated developmental pathways during early mouse embryogenesis. Proc. Natl. Acad. Sci. USA 2014, 111, 4478–4483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schifferl, D.; Scholze-Wittler, M.; Wittler, L.; Veenvliet, J.V.; Koch, F.; Herrmann, B.G. A 37 kb region upstream of brachyury comprising a notochord enhancer is essential for notochord and tail development. Development 2021, 148, 173–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Technau, U. Brachyury, the blastopore and the evolution of the mesoderm. Bioessays 2001, 23, 788–794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, B.; Shao, Y.; Chen, B.; Liu, C.; Xue, Z.; Wu, P.; Li, H. Identification of a novel mouse brachyury (T) allele causing a short tail mutation in mice. Cell Biochem. Biophys. 2010, 58, 129–135. [Google Scholar] [CrossRef] [Scilit]
- Buckingham, K.J.; McMillin, M.J.; Brassil, M.M.; Shively, K.M.; Magnaye, K.M.; Cortes, A.; Weinmann, A.S.; Lyons, L.A.; Bamshad, M.J. Multiple mutant T alleles cause haploinsufficiency of Brachyury and short tails in Manx cats. Mamm. Genome 2013, 24, 400–408. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Sun, X.; Hu, X.-S.; Zhuang, Y.; Liu, Y.-C.; Meng, H.; Miao, L.; Yu, H.; Luo, S.-J. Whole Genome Sequencing Identifies a Missense Mutation in HES7 Associated with Short Tails in Asian Domestic Cats. Sci. Rep. 2016, 6, 31583. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.; Gao, H.; Sahana, G.; Zan, Y.; Fan, H.; Liu, J.; Shi, L.; Wang, H.; Du, L.; Wang, L.; et al. Genome-wide association studies revealed candidate genes for tail fat deposition and body size in the Hulun Buir sheep. J. Anim. Breed. Genet. 2019, 136, 362–370. [Google Scholar] [CrossRef] [Scilit]
- Fan, H.; Hou, Y.; Sahana, G.; Gao, H.; Zhu, C.; Du, L.; Zhao, F.; Wang, L. A transcriptomic study of the tail fat deposition in two types of hulun buir sheep according to tail size and sex. Animals 2019, 9, 655. [Google Scholar] [CrossRef] [Scilit]
- Smołucha, G.; Piórkowska, K.; Ropka-Molik, K.; Sikora, J. Use of the HRM method in quick identification of FecXO mutation in highly prolific olkuska sheep. Animals 2020, 10, 844. [Google Scholar] [CrossRef] [Scilit]
- Wittwer, C.T. High-resolution DNA melting analysis: Advancements and limitations. Hum. Mutat. 2009, 30, 857–859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vossen, R.H.; Aten, E.; Roos, A.; Den Dunnen, J.T. High-Resolution Melting Analysis (HRMA)-More than just sequence variant screening. Hum. Mutat. 2009, 30, 860–866. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simko, I. High-resolution DNA melting analysis in plant research. Trends Plant Sci. 2016, 21, 528–537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- England, A.; Kheravii, S.; Musigwa, S.; Kumar, A.; Daneshmand, A.; Sharma, N.; Gharib-Naseri, K.; Wu, S. Sexing chickens (Gallus gallus domesticus) with high-resolution melting analysis using feather crude DNA. Poult. Sci. 2021, 100, 100924. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keikha, M.; Karbalaei, M. High resolution melting assay as a reliable method for diagnosing drug-resistant TB cases: A systematic review and meta-analysis. BMC Infect. Dis. 2021, 21, 989. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, T.; Geng, C.X.; Lang, X.Z.; Chu, M.X.; Cao, G.L.; Di, R.; Fang, L.; Chen, H.Q.; Liu, X.L.; Li, N. Polymorphisms of caprine GDF9 gene and their association with litter size in Jining Grey goats. Mol. Biol. Rep. 2010, 38, 5189–5197. [Google Scholar] [CrossRef] [Scilit]
- Alkafajy, A.; Al-Karagoly, H.; Brujeni, G.N. Comparison of cattle BoLA-DRB3 typing by PCR-RFLP, direct sequencing, and high-resolution DNA melting curve analysis. Vet. Res. Forum 2020, 11, 21–26. [Google Scholar]
- Luo, R.; Zhang, X.; Wang, L.; Zhang, L.; Li, G.; Zheng, Z. GLIS1, a potential candidate gene affect fat deposition in sheep tail. Mol. Biol. Rep. 2021, 48, 4925–4931. [Google Scholar] [CrossRef] [Scilit]
- Seipp, M.T.; Durtschi, J.D.; Liew, M.A.; Williams, J.; Damjanovich, K.; Pont-Kingdon, G.; Lyon, E.; Voelkerding, K.V.; Wittwer, C.T. Unlabeled oligonucleotides as internal temperature controls for genotyping by amplicon melting. J. Mol. Diagn. 2007, 9, 284–289. [Google Scholar] [CrossRef] [Scilit]
- Liew, M.; Seipp, M.; Durtschi, J.; Margraf, R.L.; Dames, S.; Erali, M.; Voelkerding, K.; Wittwer, C. Closed-tube SNP genotyping without labeled probes/a comparison between unlabeled probe and amplicon melting. Am. J. Clin. Pathol. 2007, 127, 341–348. [Google Scholar] [CrossRef]
- Erali, M.; Palais, R.; Wittwer, C. SNP Genotyping by unlabeled probe melting analysis. Methods Mol. Biol. 2008, 429, 199–206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rocha, J.L.; Godinho, R.; Brito, J.C.; Nielsen, R. Life in deserts: The genetic basis of mammalian desert adaptation. Trends Ecol. Evol. 2021, 36, 637–650. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, F.; Deng, T.; Shi, L.; Wang, W.; Zhang, Q.; Du, L.; Wang, L. Genomic scan for selection signature reveals fat deposition in chinese indigenous sheep with extreme tail types. Animals 2020, 10, 773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, X.; Wu, R.; Yun, Y.; Qin, X.; Chen, L.; Han, Y.; Wu, J.; Sha, L.; Borjigin, G. Transcriptome analysis of messenger RNA and long noncoding RNA related to different developmental stages of tail adipose tissues of sunite sheep. Food Sci. Nutr. 2021, 9, 5722–5734. [Google Scholar] [CrossRef] [Scilit]
- Small, A.; Fetiveau, M.; Smith, R.; Colditz, I. Three studies evaluating the potential for lidocaine, bupivacaine or procaine to reduce pain-related behaviors following ring castration and/or tail docking in lambs. Animals 2021, 11, 3583. [Google Scholar] [CrossRef] [Scilit]
- Yousefi, A.R.; Kohram, H.; Shahneh, A.Z.; Nik-Khah, A.; Campbell, A.W. Comparison of the meat quality and fatty acid composition of traditional fat-tailed (Chall) and tailed (Zel) Iranian sheep breeds. Meat Sci. 2012, 92, 417–422. [Google Scholar] [CrossRef] [Scilit]
- Small, A.; Marini, D.; Colditz, I. Local anesthetic delivered with a dual action ring and injection applicator reduces the acute pain response of lambs during tail docking. Animals 2021, 11, 2242. [Google Scholar] [CrossRef] [Scilit]
- Han, J.; Guo, T.; Yue, Y.; Lu, Z.; Liu, J.; Yuan, C.; Niu, C.; Yang, M.; Yang, B. Quantitative proteomic analysis identified differentially expressed proteins with tail/rump fat deposition in Chinese thin- and fat-tailed lambs. PLoS ONE 2021, 16, e0246279. [Google Scholar] [CrossRef] [Scilit]
- Obšteter, J.; Jenko, J.; Gorjanc, G. Genomic selection for any dairy breeding program via optimized investment in phenotyping and genotyping. Front. Genet. 2021, 12, 637017. [Google Scholar] [CrossRef] [Scilit]
- Słomka, M.; Sobalska-Kwapis, M.; Wachulec, M.; Bartosz, G.; Strapagiel, D. High Resolution Melting (HRM) for high-throughput genotyping—Limitations and caveats in practical case studies. Int. J. Mol. Sci. 2017, 18, 2316. [Google Scholar] [CrossRef] [Scilit]
- Smith, B.L.; Lu, C.; Bremer, J.R.A. High-resolution melting analysis (HRMA): A highly sensitive inexpensive genotyping alternative for population studies. Mol. Ecol. Resour. 2010, 10, 193–196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Froehlich, T.; Geulen, O. Hybridization Probe Pairs and Single-Labeled Probes: An Alternative Approach for Genotyping and Quantification. Methods Mol. Biol. 2008, 429, 117–133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ririe, K.M.; Rasmussen, R.P.; Wittwer, C.T. Product Differentiation by Analysis of DNA Melting Curves during the Polymerase Chain Reaction. Anal. Biochem. 1997, 245, 154–160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, C.; Saint-Pierre, C.; Gasparutto, D.; Roupioz, Y.; Ravelet, C.; Peyrin, E.; Buhot, A. Melting Curve Analysis of Aptachains: Adenosine Detection with Internal Calibration. Biosensors 2021, 11, 112. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Name | Sequence (5′-3′) | Analysis Type | PCR Product Length |
|---|---|---|---|
| TBXT-F | TGCGCCCCTTCCTTTTCAG | HRM/PCR | 203 bp |
| TBXT-R | GGGGGAGTCGGGGTGGATGTAG | HRM/PCR | |
| TBXT-Probe | GCTTGCCCCAGGGCACCCA | HRM |
| Breed | Genotype (TBXT c.333G > C; c.334G > T) | X2 | p-Value | ||
|---|---|---|---|---|---|
| G-G/G-G | C-T/G-G | C-T/C-T | |||
| Barag sheep | 100% | 0 | 0 | 154.87 | 2.07 × 10−35 |
| Short-tailed sheep | 0 | 13.3% | 86.7% | ||
| Number of Caudal Vertebrae | Total | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | ||
| Number of short-tailed sheep | 2 | 4 | 1 | 6 | 1 | 0 | 0 | 0 | 0 | 14 |
| Number of Barag sheep | 0 | 0 | 0 | 0 | 0 | 6 | 8 | 0 | 2 | 16 |
| Number of Caudal Vertebrae | Total | X2 | p-Value | |||||
|---|---|---|---|---|---|---|---|---|
| 4 | 5 | 6 | 7 | 8 | ||||
| Number of homozygotes | 1 | 2 | 1 | 3 | 0 | 7 | 2.282045 | 1 |
| Number of heterozygotes | 1 | 2 | 0 | 3 | 1 | 7 | ||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, G.; Wang, C.; Su, H.; Wang, D.; Dou, A.; Chen, L.; Ma, T.; Liu, M.; Su, J.; Xu, X.; et al. Development and Application of a High-Resolution Melting Analysis with Unlabeled Probes for the Screening of Short-Tailed Sheep TBXT Heterozygotes. Animals 2022, 12, 792. https://doi.org/10.3390/ani12060792
Yang G, Wang C, Su H, Wang D, Dou A, Chen L, Ma T, Liu M, Su J, Xu X, et al. Development and Application of a High-Resolution Melting Analysis with Unlabeled Probes for the Screening of Short-Tailed Sheep TBXT Heterozygotes. Animals. 2022; 12(6):792. https://doi.org/10.3390/ani12060792
Chicago/Turabian StyleYang, Guang, Caiyun Wang, Hong Su, Daqing Wang, Aolie Dou, Lu Chen, Teng Ma, Moning Liu, Jie Su, Xiaojing Xu, and et al. 2022. "Development and Application of a High-Resolution Melting Analysis with Unlabeled Probes for the Screening of Short-Tailed Sheep TBXT Heterozygotes" Animals 12, no. 6: 792. https://doi.org/10.3390/ani12060792
APA StyleYang, G., Wang, C., Su, H., Wang, D., Dou, A., Chen, L., Ma, T., Liu, M., Su, J., Xu, X., Yang, Y., He, T., Li, X., Song, Y., & Cao, G. (2022). Development and Application of a High-Resolution Melting Analysis with Unlabeled Probes for the Screening of Short-Tailed Sheep TBXT Heterozygotes. Animals, 12(6), 792. https://doi.org/10.3390/ani12060792

