Effects of Glutamine on Rumen Digestive Enzymes and the Barrier Function of the Ruminal Epithelium in Hu Lambs Fed a High-Concentrate Finishing Diet
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Glutamine
2.2. Lamb, Management, Experimental Diets, and Experimental Design
2.3. Sample Collection
2.4. Blood Cytokine Analysis
2.5. Analysis of pH, Digestive Enzyme Activity, and SCFA Concentrations
2.6. RNA Extraction and qRT-PCR Analysis of Ruminal Wall Samples
2.7. Statistical Analysis
2.8. Ethical Standards
3. Results
3.1. Ruminal Digestive Enzyme Activity
3.2. Ruminal Fermentation Parameters
3.3. The Concentration of Cytokines in the Plasma
3.4. The mRNA Expression of Cytokine Gene in Rumen Epithelium
3.5. The mRNA Expression of Tight Junction Protein Genes in the Ruminal Epithelium
4. Discussion
4.1. Effect of Dietary Gln on the Activity of Ruminal Digestive Enzymes of Lambs Fed a High-Concentrate Finishing Diet
4.2. Effect of Dietary Gln on the Ruminal Fermentation Parameters of High-Concentrate Finishing Lambs
4.3. Effects of Dietary Gln on the Concentration and mRNA Expression of Cytokines in Lambs Fed a High-Concentrate Finishing Diet
4.4. Effects of Dietary Gln on the mRNA Expression of Tight Junction Protein Genes in the Ruminal Epithelium of Lambs Fed a High-Concentrate Finishing Diet
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Herd, R.M.; Arthur, P.F. Physiological basis for residual feed intake. J. Anim. Sci. 2009, 87, E64–E71. [Google Scholar] [CrossRef]
- Penner, G.B.; Beauchemin, K.A. Variation in the susceptibility to ruminal acidosis: Challenge or opportunity? In Proceedings of the Western Canadian Dairy Seminar, Red Deer, AB, Canada, 9–12 March 2010; pp. 173–187. [Google Scholar]
- Kong, R.S.G.; Liang, G.X.; Chen, Y.H.; Stothard, P.; Guan, L.L. Transcriptome profiling of the rumen epithelium of beef cattle differing in residual feed intake. BMC Genom. 2016, 17, 592–700. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, J.H.; Xu, T.T.; Liu, Y.J.; Zhu, W.Y.; Mao, S.Y. A high-grain diet causes massive disruption of ruminal epithelial tight junctions in goats. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2013, 305, 232–241. [Google Scholar] [CrossRef] [PubMed]
- Plaizier, J.C.; Krause, D.O.; Gozho, G.N.; McBride, B.W. Subacute ruminal acidosis in dairy cows: The physiological causes, incidence and consequences. Vet. J. 2008, 176, 21–31. [Google Scholar] [CrossRef]
- Liang, Y.S.; Li, G.Z.; Li, X.Y.; Lü, J.Y.; Li, F.D.; Tang, D.F.; Li, F.; Deng, Y.; Zhang, H.; Wang, Z.L.; et al. Growth performance, rumen fermentation, bacteria composition, and gene expressions involved in intracellular pH regulation of rumen epithelium in finishing Hu lambs differing in residual feed intake phenotype. J. Anim. Sci. 2017, 95, 1727–1738. [Google Scholar]
- Plaizier, J.C.; Khafipour, E.; Li, S.; Gozho, G.N.; Krause, D.O. Subacute ruminal acidosis (SARA), endotoxins and health consequences. Anim. Feed Sci. Tech. 2012, 172, 9–21. [Google Scholar] [CrossRef]
- Penner, G.B.; Steele, M.A.; Aschenbach, J.R.; McBride, B.W. Ruminant Nutrition Symposium: Molecular adaptation of ruminal epithelia to highly fermentable diets. J. Anim. Sci. 2011, 89, 1108–1109. [Google Scholar] [CrossRef] [Green Version]
- Sutton, J.D.; Dhanoa, M.S.; Morant, S.V.; France, J.; Napper, D.J.; Schuller, E. Rates of production of acetic, propionate, and butyrate in the rumen of lactating dairy cows given normal and low-roughage diets. J. Dairy Sci. 2003, 86, 3620–3633. [Google Scholar] [CrossRef] [Green Version]
- Penner, G.B.; Taniguchi, M.; Guan, L.L.; Beauchemin, K.A.; Oba, M. Effect of dietary forage to concentrate ratio on volatile fatty acid absorption and the expression of genes related to volatile fatty acid absorption and metabolism in ruminal tissue. J. Dairy Sci. 2009, 92, 2767–2781. [Google Scholar] [CrossRef] [Green Version]
- Penner, G.B.; Beauchemin, K.A.; Mutsvangwa, T. Severity of ruminal acidosis in primiparous Holstein cows during the periparturient period. J. Dairy Sci. 2007, 90, 365–375. [Google Scholar] [CrossRef] [PubMed]
- Gozho, G.N.; Krause, D.O.; Plaizier, J.C. Rumen lipopolysaccharide and inflammation during grain adaptation and subacute ruminal acidosis in steers. J. Dairy Sci. 2006, 89, 4404–4413. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.Y.; Cheng, M.; Xu, M.; Song, L.W.; Hu, H.L. The effects of subacute ruminal acidosis on rumen epithelium barrier function in dairy goats. Small Rumin. Res. 2018, 169, 1–7. [Google Scholar] [CrossRef]
- Zhang, K.; Meng, M.J.; Gao, L.P.; Tu, Y.L.; Bai, Y.F. Rumen-derived lipopolysaccharide induced ruminal epithelium barrier damage in goats fed a high-concentrate diet. Microb. Pathog. 2019, 131, 81–86. [Google Scholar] [CrossRef] [PubMed]
- Rao, R.K.; Samak, G. Role of glutamine in protection of intestine epithelial tight junctions. J. Epithel. Biol. Pharmacol. 2012, 5, 47–54. [Google Scholar]
- Wu, Q.J.; Zhu, D.D.; Wang, D.D.; Zhang, B.B.; Ren, A.; Zhang, Z.B. Effects of dietary supplementation with glutamine on the lymphocyte proliferation and intestinal immune gene expression in broiler chickens infected with Salmonella Enteritidis. Res. Vet. Sci. 2021, 139, 18–24. [Google Scholar] [CrossRef]
- Remond, D.; Ortigues, I.; Jouany, J.P. Energy substrates for the rumen epithelium. P Nutr. Soc. 1995, 54, 95–105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, S.Z.; Gao, F.J.; Yang, Y.Y.; Jiang, N.; Zhao, Y.N.; Yang, H.M.; Ji, H. Effects of Glutamine and L-carnitine on Ruminal Cellulolytic Bacteria of Sheep under Low Temperatures. Chin. J. Anim. Nutr. 2011, 23, 499–506. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Huang, X.D.; Tan, H.Y.; Long, R.J.; Liang, J.B.; Wright, A.G. Comparison of methanogen diversity of yak (Bos grunniens) and cattle (Bos taurus) from the Qinghai-Tibetan plateau, China. BMC Microbiol. 2012, 237, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Jia, J.L.; Liang, C.N.; Wu, X.Y.; Xiong, L.; Bao, P.J.; Chen, Q.; Yan, P. Effect of high proportion concentrate dietary on Yak jejunal structure, physiological function and protein composition during cold season. Sci. Rep. 2021, 11, 5502. [Google Scholar] [CrossRef]
- Nassiri, M.H.; Alizadeh-Ghamsari, A.H. Improved performance and small intestinal development of broiler chickens by dietary L-glutamine supplementation. J. Appl. Anim. Res. 2013, 41, 1–7. [Google Scholar] [CrossRef]
- Penner, G.B.; Oba, M.; Gabel, G.; Aschenbach, J.R. A single mild episode of subacute ruminal acidosis does not affect ruminal barrier function in the short term. J. Dairy Sci. 2010, 93, 4838–4845. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, J.; Paul, W.E. Peripheral CD4+T-cell differentiation regulated by networks of cytokines and transcription factors. Immunol. Rev. 2010, 238, 247–262. [Google Scholar] [CrossRef] [PubMed]
- Suna, X.; Gaob, R.L.; Xiong, Y.K.; Huang, Q.C.; Xu, M. Antitumor and immunomodulatory effects of a water-soluble polysaccharide from Lilii Bulbus in mice. Carbohydr. Polymers 2014, 102, 543–549. [Google Scholar]
- Alexander, A.F.; Kelsey, I.; Forbes, H.; Miller-Jensen, K. Single-cell secretion analysis reveals a dual role for IL-10 in restraining and resolving the TLR4-induced inflammatory response. Cell Rep. 2021, 36, 109728. [Google Scholar] [CrossRef]
- Parveen, Y.; Philip, C.C. Glutamine Requirement of Proliferating T Lymphocytes. Nutrition 1997, 13, 646–651. [Google Scholar]
- Yaqoob, P.; Calder, P.C. Cytokine production by human peripheral blood mononuclear cells: Differential sensitivity to glutamine availability. Cytokine 1998, 10, 790–794. [Google Scholar] [CrossRef]
- Caroprese, M.; Albenzio, M.; Marino, R.; Santillo, A.; Sevi, A. Immune response and milk production of dairy cows fed graded levels of rumen-protected glutamine. Res. Vet. Sci. 2012, 93, 202–209. [Google Scholar] [CrossRef]
- Caroprese, M.; Albenzio, M.; Marino, R.; Santillo, A.; Sevi, A. Dietary glutamine enhances immune responses of dairy cows under high ambient temperature. J. Dairy Sci. 2013, 96, 3002–3011. [Google Scholar] [CrossRef]
- Doepel, L.; Lessard, M.; Gagnon, N.; Lobley, G.E.; Bernier, J.F.; Dubreuil, P.; Lapierre, H. Effect of postruminal glutamine supplementation on immune response and milk production in dairy cows. J. Dairy Sci. 2006, 89, 3107–3121. [Google Scholar] [CrossRef] [Green Version]
- Wells, S.M.; Kew, S.; Yaqoob, P.; Wallace, F.A.; Calder, P.C. Dietary glutamine enhances cytokine production by murine macrophages. Nutrition 1999, 15, 881–884. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.J.; Jiao, C.; Liu, Z.H.; Li, S.W.; Zhu, D.D.; Ma, W.F.; Wang, Y.Q.; Wang, Y.; Wu, X.H. Effect of glutamine on the intestinal function and health of broilers challenged with Salmonella pullorum. Ind. J. Anim. Res. 2019, 53, 1210–1216. [Google Scholar]
- Liu, Z.H.; Wu, Q.J.; Jiao, C.; Cheng, B.Y.; Zhu, D.D.; Ma, Y.; Li, Y.X.; Li, W. Effects of glutamine on the mucosal structure and immune cells in the intestines of broiler chickens challenged with Salmonella Enteritidis. Braz. J. Poult. Sci. 2020, 22, eRBCA2020-1270. [Google Scholar] [CrossRef]
- De-Souza, D.A.; Greene, I.J. Intestinal permeability and systemic infections in critically ill patients: Effect of glutamine. Crit. Care Med. 2005, 33, 1125–1135. [Google Scholar] [CrossRef] [PubMed]
- Potsic, B.; Holliday, N.; Lewis, P.; Samuelson, D.; DeMarco, V.; Neu, J. Glutamine supplementation and deprivation: Effect on artificially reared rat small intestinal morphology. Pediatr. Res. 2002, 52, 430–436. [Google Scholar]
Ingredients | Content |
---|---|
Corn straw | 25.0 |
Alfalfa hay | 4.2 |
Corn | 40.5 |
Wheat | 18.0 |
Soybean meal | 5.0 |
Cottonseed meal | 3.45 |
Limestone | 1.05 |
NaCl | 0.5 |
Limestone | 0.3 |
NaHCO3 | 1.0 |
Premix a Concentrate/roughage ratio | 1.0 7:3 |
Total | 100.0 |
Nutrient levels | |
Net energy (MJ/kg) | 12.80 |
Crude protein | 13.25 |
Ether extract | 3.56 |
Crude fiber | 18.50 |
Acid detergent fiber | 13.9 |
Neutral detergent fiber | 25.75 |
Calcium | 0.96 |
Phosphorus | 0.61 |
Primer | Sequence (5′→ 3′) | Amplicon Size, bp |
---|---|---|
Claudin-1 | CACCCTTGGCATAGAGTGTA | 216 |
GACCATAGAAGGAAGCCTGA | ||
Claudin-4 | AAGGGTTACGACCTGCTGTC | 238 |
GACGTTGTATGCCGTCCGA | ||
Occludin | GTTCGACCAATGCTCTCTCAG | 200 |
CAGCTCCCATTAAGGTTCCA | ||
ZO-1 | CGACCGAATCCTCAGGTGAA | 163 |
AATCACCCACATCGGATTCT | ||
IL-2 | TAGGCCATTACGGCCATGTA | 186 |
TAGGCCGAGGCGGCCAAAGT | ||
IL-4 | TAGGCCATTACGGCCGGTCA | 228 |
ACATGGCGGACAATCCATCC | ||
IL-6 | CCAACTTGGGTCTAATACGG | 241 |
ACCCATCCGTTGTAGGCATG | ||
IL-10 | TTAATGGGTACCTGGGTTGC | 239 |
CCCTTCTTCGGAGCATATTGA | ||
IL-12 | CGCAGCCTCCTCCTCATA | 134 |
GCCCTCAGCAGGTTTTGG | ||
TNF-α | CAGATAAGAAGCCGGTGACC | 155 |
AGTAGAGCTAAAGCCCTGCA | ||
GAPDH | GGGTACTCATCTCTACGCCT | 180 |
GGTCTAAAGTCCCTACCCGA |
Items | Treatment 1 | SEM 2 | p-Value 3 | ||
---|---|---|---|---|---|
CON | Gln1 | Gln2 | |||
α-amylase (U/dL) | 48.67 | 50.95 | 51.68 | 0.62 | 0.075 |
Pepsin (U/mL) | 55.62 b | 32.34 a | 38.19 a | 10.64 | 0.011 |
Lipase (U/L) | 64.29 a | 82.67 b | 83.49 b | 9.85 | 0.035 |
Cellulase (U/mL) | 450.12 b | 310.13 a | 376.34 a | 60.15 | 0.027 |
Items | Treatment 1 | SEM 2 | p-Value 3 | ||
---|---|---|---|---|---|
CON | Gln1 | Gln2 | |||
pH | 6.13 a | 6.38 b | 6.39 b | 0.07 | 0.010 |
Lactic acid (mmol/L) | 1.27 | 1.20 | 1.22 | 0.08 | 0.012 |
Acetic acid (mmol/L) | 55.94 | 58.67 | 59.91 | 1.65 | 0.034 |
Propionic acid (mmol/L) | 19.62 b | 16.54 a | 16.30 a | 0.57 | 0.027 |
Butyrate acid (mmol/L) | 15.36 | 17.06 | 17.69 | 0.73 | 0.058 |
Isobutyrate acid (mmol/L) | 1.96 | 2.05 | 2.13 | 0.12 | 0.064 |
Valerate acid (mmol/L) | 1.63 | 1.75 | 1.81 | 0.08 | 0.059 |
Isovalerate acid (mmol/L) | 2.07 | 2.19 | 2.31 | 0.15 | 0.057 |
Total VFA (mmol/L) | 99.12 | 102.65 | 106.04 | 2.88 | 0.081 |
The ratio of acetic of propionate | 2.85 a | 3.54 b | 3.68 b | 0.10 | 0.039 |
Items | Treatment 1 | SEM 2 | p-Value 3 | ||
---|---|---|---|---|---|
CON | Gln1 | Gln2 | |||
IL-2 (pg/mL) | 245.62 | 327.82 | 339.51 | 18.71 | 0.589 |
IL-4 (pg/mL) | 9.82 | 10.94 | 10.88 | 0.14 | 0.061 |
IL-6 (pg/mL) | 157.72 | 138.83 | 140.18 | 10.79 | 0.512 |
IL-10 (pg/mL) | 86.34 a | 119.39 b | 128.64 b | 11.31 | 0.031 |
IL-12 (pg/mL) | 60.25 | 69.38 | 70.32 | 50.21 | 0.057 |
Items | Treatment 1 | SEM 2 | p-Value 3 | ||
---|---|---|---|---|---|
CON | Gln1 | Gln2 | |||
TNF-α | 1.08 b | 0.27 a | 0.24 a | 0.15 | 0.012 |
IL-2 | 1.04 a | 1.99 b | 2.14 b | 0.12 | 0.021 |
IL-4 | 1.02 | 1.28 | 1.39 | 0.16 | 0.051 |
IL-6 | 1.38 b | 0.88 ± 0.19 a | 0.80 a | 0.18 | 0.013 |
IL-10 | 1.10 a | 1.68 ± 0.22 b | 1.70 b | 0.20 | 0.028 |
IL-12 | 1.06 | 2.68 | 2.79 | 0.45 | 0.052 |
Items | Treatment 1 | SEM 2 | p-Value 3 | ||
---|---|---|---|---|---|
CON | Gln1 | Gln2 | |||
Claudin-1 | 1.25 a | 2.58 b | 2.62 b | 0.24 | 0.026 |
Claudin-4 | 1.21 | 1.35 | 1.39 | 0.18 | 0.058 |
Occludin | 1.17 | 1.05 | 1.14 | 0.21 | 0.054 |
ZO-1 | 1.12 b | 0.88 a | 0.81 ± 0.04 a | 0.03 | 0.013 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, Q.; Xing, Z.; Liao, J.; Zhu, L.; Zhang, R.; Wang, S.; Wang, C.; Ma, Y.; Wang, Y. Effects of Glutamine on Rumen Digestive Enzymes and the Barrier Function of the Ruminal Epithelium in Hu Lambs Fed a High-Concentrate Finishing Diet. Animals 2022, 12, 3418. https://doi.org/10.3390/ani12233418
Wu Q, Xing Z, Liao J, Zhu L, Zhang R, Wang S, Wang C, Ma Y, Wang Y. Effects of Glutamine on Rumen Digestive Enzymes and the Barrier Function of the Ruminal Epithelium in Hu Lambs Fed a High-Concentrate Finishing Diet. Animals. 2022; 12(23):3418. https://doi.org/10.3390/ani12233418
Chicago/Turabian StyleWu, Qiujue, Zhongying Xing, Jiahui Liao, Longlong Zhu, Rongkai Zhang, Saiqiao Wang, Cong Wang, Yan Ma, and Yuqin Wang. 2022. "Effects of Glutamine on Rumen Digestive Enzymes and the Barrier Function of the Ruminal Epithelium in Hu Lambs Fed a High-Concentrate Finishing Diet" Animals 12, no. 23: 3418. https://doi.org/10.3390/ani12233418
APA StyleWu, Q., Xing, Z., Liao, J., Zhu, L., Zhang, R., Wang, S., Wang, C., Ma, Y., & Wang, Y. (2022). Effects of Glutamine on Rumen Digestive Enzymes and the Barrier Function of the Ruminal Epithelium in Hu Lambs Fed a High-Concentrate Finishing Diet. Animals, 12(23), 3418. https://doi.org/10.3390/ani12233418