The Effect of Background Color on Skin Color Variation of Juvenile Plectropomus leopardus
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Approval and Consent to Participate
2.2. Fish
2.3. Experimental Tanks
2.4. Experiment
2.5. Fish Sampling and Tissue Preparation
2.6. Determination of Pigments, MSH Content, and Tyrosinase Activity
2.7. RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction
2.8. Statistical Analysis
3. Results
3.1. Effects of Background Color on Skin Color
3.2. Slice Microstructure Observations of the Skin
3.3. Effects of Background Color on the L*, a*, and b* Values
3.4. Pigment Content and Tyrosinase Activity in Fish Skin
3.5. Serum Tyrosinase Activity and α-MSH Level
3.6. Expression of Fish Skin Color-Related Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Johnson, S.L.; Africa, D.; Walker, C.; Weston, J.A. Genetic control of adult pigment stripe development in zebrafish. Dev. Biol. 1995, 167, 27–33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hubbard, J.K.; Uy, J.A.C.; Hauber, M.E.; Hoekstra, H.E.; Safran, R.J. Vertebrate pigmentation: From underlying genes to adaptive function. Trends Genet. 2010, 26, 231–239. [Google Scholar] [CrossRef] [PubMed]
- Haque, M.R.; Islam, M.A.; Wahab, M.A.; Hoq, M.E.; Rahman, M.M.; Azim, M.E. Evaluation of production performance and profitability of hybrid red tilapia and genetically improved farmed tilapia (GIFT) strains in the carbon/nitrogen controlled periphyton-based (C/N-CP) on-farm prawn culture system in Bangladesh. Aquac. Rep. 2016, 4, 101–111. [Google Scholar] [CrossRef] [Green Version]
- Nüsslein-Volhard, C.; Singh, A.P. How fish color their skin: A paradigm for development and evolution of adult patterns: Multipotency, plasticity, and cell competition regulate proliferation and spreading of pigment cells in Zebrafish coloration. BioEssays 2017, 39, 201600231. [Google Scholar] [CrossRef] [Green Version]
- Cal, L.; Suarez-Bregua, P.; Cerdá-Reverter, J.M.; Braasch, I.; Rotllant, J. Fish pigmentation and the melanocortin system. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2017, 211, 26–33. [Google Scholar] [CrossRef] [Green Version]
- Takahashi, A.; Mizusawa, K.; Amano, M. Multifunctional roles of melanocyte-stimulating hormone and melanin-concentrating hormone in fish: Evolution from classical body color change. Aqua-BioSci. Monogr. 2014, 7, 1–46. [Google Scholar] [CrossRef]
- Mizusawa, K.; Kobayashi, Y.; Yamanome, T.; Saito, Y.; Takahashi, A. Interrelation between melanocyte-stimulating hormone and melanin-concentrating hormone in physiological body color change: Roles emerging from barfin flounder Verasper moseri. Gen. Comp. Endocrinol. 2013, 181, 229–234. [Google Scholar] [CrossRef]
- Sugimoto, M. Morphological color changes in fish: Regulation of pigment cell density and morphology. Microsc. Res. Tech. 2002, 58, 496–503. [Google Scholar] [CrossRef]
- Braasch, I.; Schart, M.; Volff, J.N. Evolution of pigment synthesis pathways by gene and genome duplication in fish. BMC Evol. Biol. 2007, 7, 74. [Google Scholar] [CrossRef] [Green Version]
- Fujii, R. The regulation of motile activity of fish chromatophores. Pigment Cell Res. 2000, 13, 300–319. [Google Scholar] [CrossRef]
- Wang, L.M.; Luo, M.K.; Yin, H.R.; Zhu, W.B.; Fu, J.J.; Dong, Z.J. Effects of background adaptation on the skin color of Malaysian red tilapia. Aquaculture 2020, 521, 735061. [Google Scholar] [CrossRef]
- Mizusawa, K.; Kasagi, S.; Takahashi, K. Melanin-concentrating hormone is a major substance mediating light wavelength-dependent skin color change in larval zebrafish. Gen. Comp. Endocrinol. 2018, 269, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Sugimoto, M.; Oshima, N. Changes in adrenergic innervation to chromatophores during prolonged background adaptation in the medaka, Oryzias latipes. Pigment Cell Res. 1995, 8, 37–45. [Google Scholar] [CrossRef] [PubMed]
- Sugimoto, M.; Uchida, H.; Hayayama, M. Apoptosis in skin pigment cells of the medaka, Oryzias latipes (Teleostei), during long-term chromatic adaptation: The role of sympathetic innervation. Cell Tissue Res. 2000, 301, 205–216. [Google Scholar]
- Merighe, G.K.F.; Pereira-Da-Silva, E.M.; Negrão, J.A.; Ribeiro, S. Effect of background color on the social stress of nile tilapia (Oreochromis niloticus). Rev. Bras. Zootec. 2004, 33, 828–837. [Google Scholar] [CrossRef] [Green Version]
- Opiyo, M.A.; Ngugi, C.C.; Rasowo, J. Combined effects of stocking density and background colour on growth performance and survival of nile tilapia (Oreochromis niloticus, L.) fry reared in aquaria. J. Fish. Sci. 2014, 8, 228–237. [Google Scholar] [CrossRef]
- Boaventura, T.P.; Pedras, P.P.C.; Santos, F.A.C.; Ferreira, A.L.; Favero, G.C.; Palheta, G.D.A.; Melo, N.F.A.C.; Luz, R.K. Cultivation of juvenile Colossoma macropomum in different colored tanks in recirculating aquaculture system (RAS): Effects on performance, metabolism and skin pigmentation. Aquaculture 2021, 532, 736079. [Google Scholar] [CrossRef]
- Ninwichian, P.; Phuwan, N.; Limlek, P. Effects of tank color on the growth, survival rate, stress response, and skin color of juvenile hybrid catfish (Clarias macrocephalus × Clarias gariepinus). Aquaculture 2022, 554, 738129. [Google Scholar] [CrossRef]
- Banan, A.; Kalbassi, M.R.; Bahmani, M.; Sadati, M.A.Y. Effects of colored light and tank color on growth indices and some physiological parameters of juvenile beluga (Huso huso). J. Appl. Ichthyol. 2011, 27, 565–570. [Google Scholar] [CrossRef]
- Eslamloo, K.; Akhavan, S.R.; Eslamifar, A.; Henry, M.A. Effects of background colour on growth performance, skin pigmentation, physiological condition and innate immune responses of goldfish, Carassius auratus. Aquac. Res. 2013, 46, 202–215. [Google Scholar] [CrossRef]
- Ninwichian, P.; Phuwan, N.; Jakpim, K.; Sae-Lim, P. Effects of tank color on the growth, stress responses, and skin color of snakeskin gourami (Trichogaster pectoralis). Aquac. Int. 2018, 26, 659–672. [Google Scholar] [CrossRef]
- Mizusawa, K.; Kobayashi, Y.; Sunuma, T.; Asahida, T.; Saito, Y.; Takahashi, A. Inhibiting roles of melanin-concentrating hormone for skin pigment dispersion in barfin flounder, Verasper moseri. Gen. Comp. Endocrinol. 2011, 171, 75–81. [Google Scholar] [CrossRef] [PubMed]
- Kasagi, S.; Miura, M.; Okazaki, T.; Mizusawa, K.; Takahashi, A. Effects of tank color brightness on the body color, somatic growth, and endocrine systems of rainbow trout Oncorhynchus mykiss. Gen. Comp. Endocrinol. 2020, 298, 113581. [Google Scholar] [CrossRef]
- Cerdá-Reverter, J.M.; Canosa, L.F.; Peter, R.E. Regulation of the hypothalamic melanin-concentrating hormone neurons by sex steroids in the goldfish: Possible role in the modulation of luteinizing hormone secretion. Neuroendocrinology 2006, 84, 364–377. [Google Scholar] [CrossRef]
- Yang, T.; Kasagi, S.; Takahashi, A.; Mizusawa, K. Effects of background color and feeding status on the expression of genes associated with body color regulation in the goldfish Carassius auratus. Gen. Comp. Endocrinol. 2021, 312, 113860. [Google Scholar] [CrossRef]
- Padhi, N.; Jena, S.K.; Ail, S.K.S.; Ferosekhan, S.; Sahoo, S.N.; Udit, U.K.; Bairwa, M.K.; Swain, S.K. Does tank background colour influence the growth, survival, and carotenoid content in fishes? An illustration in filament barb, Dawkinsia filamentosa (Valenciennes, 1844). Aquaculture 2022, 560, 738536. [Google Scholar] [CrossRef]
- Sundvold, H.; Helgeland, H.; Baranski, M.; Omholt, S.W.; Våge, D.I. Characterisation of a novel paralog of scavenger receptor class B member I (SCARB1) in Atlantic salmon (Salmo salar). BMC Genet. 2011, 12, 52. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.; Zheng, H.P.; Zhang, H.K.; Deng, L.H.; Liu, W.H.; Wang, S.Q.; Meng, F.; Wang, Y.J.; Guo, Z.C.; Li, S.K.; et al. A de novo transcriptome of the noble scallop, Chlamys nobilis, focusing on mining transcripts for carotenoid-based coloration. BMC Genom. 2015, 16, 44. [Google Scholar] [CrossRef] [Green Version]
- Li, T.L.; Xu, G.L.; Xing, W.; Ma, Z.H.; Jiang, N.; Luo, L. Mechanisms underlying carotenoid-based coloration in fishes. J. Shanghai Ocean. Univ. 2018, 27, 206–212. [Google Scholar]
- Maoka, T.; Sato, W.; Nagai, H.; Takahashi, T. Carotenoids of red, brown, and black specimens of Plectropomus leopardus, the coral trout (Suziara in Japanese). Oleo Sci. 2017, 66, 579–584. [Google Scholar] [CrossRef] [Green Version]
- Song, F.B.; Gu, Y.; Chen, Y.M.; Zhang, K.X.; Shi, L.P.; Sun, J.L.; Zhang, Z.J.; Luo, J. Transcriptome analysis provides insights into differentially expressed long noncoding RNAs between the testis and ovary in golden pompano (Trachinotus blochii). Aquac. Rep. 2022, 22, 100971. [Google Scholar] [CrossRef]
- Hao, R.J.; Zhu, X.W.; Tian, C.X.; Jiang, M.Y.; Huang, Y.; Zhu, C.H. Integrated analysis of the role of miRNA-mRNA in determining different body colors of leopard coral grouper (Plectropomus leopardus). Aquaculture 2022, 548, 737575. [Google Scholar] [CrossRef]
- McLean, E. Fish tank color: An overview. Aquaculture 2021, 530, 735750. [Google Scholar] [CrossRef]
- Bjerkeng, B. Carotenoids in aquaculture: Fish and crustaceans. Carotenoids 2008, 4, 237–254. [Google Scholar]
- Vissio, P.G.; Darias, M.J.; Di Yorio, M.P.; Perez Sirkin, D.I.; Delgadin, T.H. Fish skin pigmentation in aquaculture: The influence of rearing conditions and its neuroendocrine regulation. Gen. Comp. Endocrinol. 2021, 301, 113662. [Google Scholar] [CrossRef]
- Suliman, T.; Novales Flamarique, I. Visual pigments and opsin expression in the juveniles of three species of fish (rainbow trout, zebrafish, and killifish) following prolonged exposure to thyroid hormone or retinoic acid: Opsin expression and nuclear receptor ligands. Comp. Neurol. 2014, 522, 98–117. [Google Scholar] [CrossRef]
- Dijkstra, P.D.; Maguire, S.M.; Harris, R.M.; Rodriguez, A.A.; DeAngelis, R.S.; Flores, S.A.; Hofmann, H.A. The melanocortin system regulates body pigmentation and social behaviour in a colour polymorphic cichlid fish. Proc. Biol. Sci. 2017, 284, 2016–2838. [Google Scholar] [CrossRef] [Green Version]
- Border, S.E.; Piefke, T.; Fialkowski, R.; Tryc, M.; Funnell, T.; DeOliveira, G.; Dijkstra, P.D. Color change and pigmentation in a color polymorphic cichlid fish. Hydrobiologia 2019, 832, 175–191. [Google Scholar] [CrossRef]
- Díaz-Jiménez, L.; Hernández-Vergara, M.P.; Pérez-Rostro, C.I.; Olvera-Novoa, M.Á. The effect of two carotenoid sources, background colour and light spectrum on the body pigmentation of the clownfish Amphiprion ocellaris. Aquac. Res. 2021, 52, 3052–3061. [Google Scholar] [CrossRef]
- Saunders, L.; Mishra, A.; Aman, A.J.; Lewis, V.M.; Toomey, M.B.; Packer, J.S.; Qiu, X.; Mcfalinefigueroa, J.L.; Corbo, J.C.; Trapnell, C.; et al. Thyroid hormone regulates distinct paths to maturation in pigment cell lineages. elife 2019, 8, e45181. [Google Scholar] [CrossRef]
- Shin, H.S.; Choi, C.Y. The stimulatory effect of LED light spectra on genes related to photoreceptors and skin pigmentation in goldfish (Carassius auratus). Fish Physiol. Biochem. 2014, 40, 1229–1238. [Google Scholar] [CrossRef] [PubMed]
- Yin, H.R.; Luo, M.K.; Wang, L.M.; Dong, Z.J.; Zhu, W.B.; Fu, J.J. Changes of pigment-related enzyme activity and gene expression at early developmental stage of koi carp. South China Fish. Sci. 2019, 15, 109–117. [Google Scholar]
- Deng, C.; Chen, S.L.; Ye, H.Z.; Qi, X.Z.; Luo, J. Analysis of pigment and enzyme levels of Plectropomus leopardus with body color difference. Life Sci. Res. 2020, 24, 15–20. [Google Scholar]
- Cheng, W.; Xu, G.; Zhang, L.; Han, M.; Chen, L.; Wei, Y. Effects of dietary inclusion of oxidized fish oil on melanin, melanin synthetic enzymes and hormones of Pelteobagrus fulvidraco. Acta Hydrobiol. Sin. 2017, 41, 1020–1026. [Google Scholar]
- Chatzifotis, S.; Pavlidis, M.; Jimeno, C.D.; Vardanis, G.; Sterioti, A.; Divanach, P. The effect of different carotenoid sources on skin coloration of cultured red porgy (Pagrus pagrus). Aquac. Res. 2005, 36, 1517–1525. [Google Scholar] [CrossRef]
- Fu, J.J.; Zhu, W.B.; Luo, W.T.; Wang, L.M.; Luo, M.K.; Dong, Z.J. Comparison of growth, tyrosinase activity, melanin content, and gene expression between common carps with different pigmentations. J. Fish. Sci. China 2021, 28, 939–947. [Google Scholar]
- Yamanome, T.; Chiba, H.; Takahashi, A. Melanocyte-stimulating hormone facilitates hypermelanosis on the non-eyed side of the barfin flounder, a pleuronectiform fish. Aquaculture 2007, 270, 505–511. [Google Scholar] [CrossRef]
- Wang, L.M.; Jiang, B.J.; Zhu, W.B.; Fu, J.J.; Luo, M.K.; Liu, W.; Dong, Z.J. The role of melanocortin 1 receptor on melanogenesis pathway in skin color differentiation of red tilapia. Aquac. Rep. 2022, 22, 100946. [Google Scholar] [CrossRef]
Primer | Sequences (5′–3′) | |
---|---|---|
tyr | F | GGTCGCATAGACAGTGCTTCC |
R | GTCTTCAACATCCTCAGCGGT | |
mch | F | TGCTCTGTCAGTGGCGATAC |
R | GAGGGACAGTCCGTTGTGTT | |
pomc | F | AGTCAGTGCTGGGAACATCC |
R | GTCGAGATCTGACGGAGGAG | |
scarb1 | F | CACCGTGTCCTACAGGGAGT |
R | ACCAGTCCGCTGTCATAACC | |
β-actin | F | CACCACAGCCGAGAGGGA |
R | TCTGGGCAACGGAACCTCT |
Dorsal Skin | Ventral Skin | |||||
---|---|---|---|---|---|---|
L* | a* | b* | L* | a* | b* | |
Initial | 37.95 ± 1.22 Ae | 5.34 ± 0.20 d | 6.20 ± 0.37 Ad | 52.73 ± 0.50 Bd | 6.10 ± 0.37 c | 9.40 ± 0.46 Bd |
Blue | 29.10 ± 0.63 Ac | 1.92 ± 0.14 Ab | 3.57 ± 0.18 c | 42.93 ± 2.26 Bc | 3.85 ± 0.50 Bb | 3.78 ± 0.48 c |
Red | 25.90 ± 0.84 Ab | 0.80 ± 0.09 a | 2.27 ± 0.20 Ab | 37.00 ± 1.66 Bb | 1.13 ± 0.15 a | 3.32 ± 0.30 Bb |
Black | 22.62 ± 0.46 Aa | 0.70 ± 0.06 Aa | 1.32 ± 0.16 Aa | 31.62 ± 1.33 Ba | 1.63 ± 0.17 Ba | 2.67 ± 0.28 Ba |
White | 33.45 ± 0.88 Ad | 2.57 ± 0.25 c | 4.23 ± 0.24 c | 51.33 ± 2.23 Bd | 3.72 ± 0.27 b | 4.45 ± 0.11 d |
Transparent | 26.00 ± 0.85 Ab | 0.85 ± 0.08 Aa | 2.32 ± 0.18 b | 31.60 ± 1.24 Ba | 1.52 ± 0.16 Ba | 2.50 ± 0.23 a |
Head Skin | Caudal Peduncle Skin | |||||
---|---|---|---|---|---|---|
L* | a* | b* | L* | a* | b* | |
Initial | 46.45 ± 0.44 d | 7.44 ± 0.29 c | 8.75 ± 0.26 Ac | 43.49 ± 0.59 d | 6.39 ± 0.18 c | 6.37 ± 0.29 Bc |
Blue | 36.35 ± 1.13 b | 3.55 ± 0.42 b | 4.70 ± 0.38 b | 36.13 ± 0.56 c | 3.53 ± 0.37 b | 4.08 ± 0.21 b |
Red | 31.57 ± 0.87 a | 1.27 ± 0.15 a | 2.40 ± 0.28 a | 32.02 ± 0.93 b | 1.55 ± 0.20 a | 2.73 ± 0.22 a |
Black | 30.42 ± 0.83 a | 1.20 ± 0.13 a | 1.78 ± 0.07 a | 28.03 ± 0.99 a | 1.68 ± 0.19 a | 2.25 ± 0.18 a |
White | 40.35 ± 1.14 c | 3.92 ± 0.42 b | 5.13 ± 0.50 Ab | 42.48 ± 1.81 d | 3.70 ± 0.29 b | 3.73 ± 0.50 Bb |
Transparent | 30.88 ± 1.20 a | 1.23 ± 0.42 a | 1.94 ± 0.16 a | 27.58 ± 0.72 a | 1.62 ± 0.10 a | 2.30 ± 0.19 a |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, F.; Shi, L.; Yao, F.; Gu, Y.; Zheng, D.; Zhang, W.; Liang, Y.; Zhang, K.; Yang, M.; Wang, L.; et al. The Effect of Background Color on Skin Color Variation of Juvenile Plectropomus leopardus. Animals 2022, 12, 3349. https://doi.org/10.3390/ani12233349
Song F, Shi L, Yao F, Gu Y, Zheng D, Zhang W, Liang Y, Zhang K, Yang M, Wang L, et al. The Effect of Background Color on Skin Color Variation of Juvenile Plectropomus leopardus. Animals. 2022; 12(23):3349. https://doi.org/10.3390/ani12233349
Chicago/Turabian StyleSong, Feibiao, Liping Shi, Fucheng Yao, Yue Gu, Da Zheng, Weiwei Zhang, Yesong Liang, Kaixi Zhang, Min Yang, Lei Wang, and et al. 2022. "The Effect of Background Color on Skin Color Variation of Juvenile Plectropomus leopardus" Animals 12, no. 23: 3349. https://doi.org/10.3390/ani12233349
APA StyleSong, F., Shi, L., Yao, F., Gu, Y., Zheng, D., Zhang, W., Liang, Y., Zhang, K., Yang, M., Wang, L., Sun, J., & Luo, J. (2022). The Effect of Background Color on Skin Color Variation of Juvenile Plectropomus leopardus. Animals, 12(23), 3349. https://doi.org/10.3390/ani12233349