Correlation and Influence of Seasonal Variation of Diet with Gut Microbiota Diversity and Metabolism Profile of Chipmunk
Abstract
:Simple Summary
Abstract
1. Introduction
2. Material and Methods
2.1. Field Sampling
2.2. Moral Statement
2.3. DNA Extraction
2.4. DNA Amplification and Sequencing
2.5. Sequence Analysis and Taxon Assignation
2.6. Metabolic Activity of the Bacterial Communities
2.7. Statistical Analysis
3. Results
3.1. Diet
3.2. Microbiota
3.3. Predicted Gut Microflora Function Using PICRUSt
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kartzinel, T.R.; Pringle, R.M. Molecular detection of invertebrate prey in vertebrate diets: Trophic ecology of C aribbean island lizards. Mol. Ecol. Resour. 2015, 15, 903–914. [Google Scholar] [CrossRef]
- Iwanowicz, D.D.; Vandergast, A.G.; Cornman, R.S.; Adams, C.R.; Kohn, J.R.; Fisher, R.N.; Brehme, C. Metabarcoding of fecal samples to determine herbivore diets: A case study of the endangered Pacific pocket mouse. PLoS ONE 2016, 11, e0165366. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, J.M.; Clare, E.L.; Hayden, B.; Brett, M.T.; Kratina, P. Diet tracing in ecology: Method comparison and selection. Methods Ecol. Evol. 2018, 9, 278–291. [Google Scholar] [CrossRef]
- McCann, K.S.; Rasmussen, J.; Umbanhowar, J. The dynamics of spatially coupled food webs. Ecol. Lett. 2005, 8, 513–523. [Google Scholar] [CrossRef]
- Bernays, E.A. Evolution of feeding behavior in insect herbivores. Bioscience 1998, 48, 35–44. [Google Scholar] [CrossRef]
- Williams, T.M.; Estes, J.A.; Doak, D.F.; Springer, A.M. Killer appetites: Assessing the role of predators in ecological communities. Ecology 2004, 85, 3373–3384. [Google Scholar] [CrossRef]
- Kratina, P.; LeCraw, R.M.; Ingram, T.; Anholt, B.R. Stability and persistence of food webs with omnivory: Is there a general pattern? Ecosphere 2012, 3, 1–18. [Google Scholar] [CrossRef]
- Yi, X.; Steele, M.A.; Zhang, Z. Acorn pericarp removal as a cache management strategy of the Siberian chipmunk, Tamias sibiricus. Ethology 2012, 118, 87–94. [Google Scholar] [CrossRef]
- Mori, E.; Zozzoli, R.; Menchetti, M. Global distribution and status of introduced Siberian chipmunks Eutamias sibiricus. Mammal Rev. 2018, 48, 139–152. [Google Scholar] [CrossRef]
- Batsaikhan, N.; Avirmed, D.; Tinnin, D.; Tsytsulina, K. Dipus Sagitta—The IUCN Red List of Threatened Species. 2016. Available online: https://www.iucnredlist.org/species/6705/115083487 (accessed on 18 September 2022).
- Bergmann, G.T.; Craine, J.M.; Robeson, I.I.M.S.; Fierer, N. Seasonal shifts in diet and gut microbiota of the American bison (Bison bison). PLoS ONE 2015, 10, e0142409. [Google Scholar] [CrossRef] [PubMed]
- Dittmer, J.; Lesobre, J.; Raimond, R.; Zimmer, M.; Bouchon, D. Influence of changing plant food sources on the gut microbiota of saltmarsh detritivores. Microb. Ecol. 2012, 64, 814–825. [Google Scholar] [CrossRef] [PubMed]
- Kohl, K.D.; Dearing, M. Experience matters: Prior exposure to plant toxins enhances diversity of gut microbes in herbivores. Ecol. Lett. 2012, 15, 1008–1015. [Google Scholar] [CrossRef] [PubMed]
- McCann, J.C.; Wickersham, T.A.; Loor, J.J. High-throughput methods redefine the rumen microbiome and its relationship with nutrition and metabolism. Bioinform. Biol. Insights 2014, 8, S15389. [Google Scholar] [CrossRef] [PubMed]
- Hooper, L.V.; Littman, D.R.; Macpherson, A.J. Interactions between the microbiota and the immune system. Science 2012, 336, 1268–1273. [Google Scholar] [CrossRef] [PubMed]
- Mackie, R.I. Mutualistic fermentative digestion in the gastrointestinal tract: Diversity and evolution. Integr. Comp. Biol. 2002, 42, 319–326. [Google Scholar] [CrossRef]
- Amato, K.R.; Leigh, S.R.; Kent, A.; Mackie, R.I.; Yeoman, C.J.; Stumpf, R.M.; Wilson, B.A.; Nelson, K.E.; White, B.A.; Garber, P.A. The gut microbiota appears to compensate for seasonal diet variation in the wild black howler monkey (Alouatta pigra). Microb. Ecol. 2015, 69, 434–443. [Google Scholar] [CrossRef]
- Koren, O.; Goodrich, J.K.; Cullender, T.C.; Spor, A.; Laitinen, K.; Bäckhed, H.K.; Gonzalez, A.; Werner, J.J.; Angenent, L.T.; Knight, R.; et al. Host remodeling of the gut microbiome and metabolic changes during pregnancy. Cell 2012, 150, 470–480. [Google Scholar] [CrossRef] [PubMed]
- Pompanon, F.; Deagle, B.E.; Symondson, W.O.; Brown, D.S.; Jarman, S.N.; Taberlet, P. Who is eating what: Diet assessment using next generation sequencing. Mol. Ecol. 2012, 21, 1931–1950. [Google Scholar] [CrossRef] [PubMed]
- Stuart-Smith, R.D.; Bates, A.E.; Lefcheck, J.; Duffy, J.E.; Baker, S.C.; Thomson, R.J.; Stuart-Smith, J.F.; Hill, N.A.; Kininmonth, S.J.; Airoldi, L.; et al. Integrating abundance and functional traits reveals new global hotspots of fish diversity. Nature 2013, 501, 539. [Google Scholar] [CrossRef] [PubMed]
- Vander Zanden, H.B.; Soto, D.X.; Bowen, G.J.; Hobson, K.A. Expanding the isotopic toolbox: Applications of hydrogen and oxygen stable isotope ratios to food web studies. Front. Ecol. Evol. 2016, 4, 20. [Google Scholar] [CrossRef] [Green Version]
- Fogel, M.L.; Griffin, P.L.; Newsome, S.D. Hydrogen isotopes in individual amino acids reflect differentiated pools of hydrogen from food and water in Escherichia coli. Proc. Natl. Acad. Sci. USA 2016, 113, E4648–E4653. [Google Scholar] [CrossRef]
- Symondson, W. Molecular identification of prey in predator diets. Mol. Ecol. 2002, 11, 627–641. [Google Scholar] [CrossRef] [PubMed]
- Behmer, S.T.; Joern, A. Coexisting generalist herbivores occupy unique nutritional feeding niches. Proc. Natl. Acad. Sci. USA 2008, 105, 1977–1982. [Google Scholar] [CrossRef] [PubMed]
- King, R.; Read, D.; Traugott, M.; Symondson, W. Invited Review: Molecular analysis of predation: A review of best practice for DNA-based approaches. Mol. Ecol. 2008, 17, 947–963. [Google Scholar] [CrossRef]
- Heise, W.; Babik, W.; Kubisz, D.; Kajtoch, Ł. A three-marker DNA barcoding approach for ecological studies of xerothermic plants and herbivorous insects from central Europe. Bot. J. Linn. Soc. 2015, 177, 576–592. [Google Scholar] [CrossRef]
- Valentini, A.; Miquel, C.; Nawaz, M.A.; Bellemain, E.; Coissac, E.; Pompanon, F.; Gielly, L.; Cruaud, C.; Nascetti, G.; Wincker, P.; et al. New perspectives in diet analysis based on DNA barcoding and parallel pyrosequencing: The trnL approach. Mol. Ecol. Resour. 2009, 9, 51–60. [Google Scholar] [CrossRef] [PubMed]
- Symondson, W.O.; Harwood, J.D. Special issue on molecular detection of trophic interactions: Unpicking the tangled bank. Mol Ecol. 2014, 23, 3601–3604. [Google Scholar] [CrossRef] [PubMed]
- Piñol, J.; San Andrés, V.; Clare, E.; Mir, G.; Symondson, W. A pragmatic approach to the analysis of diets of generalist predators: The use of next-generation sequencing with no blocking probes. Mol. Ecol. Resour. 2014, 14, 18–26. [Google Scholar] [CrossRef] [PubMed]
- Cole, R.J. Postdispersal seed fate of tropical montane trees in an agricultural landscape, southern Costa Rica. Biotropica 2009, 41, 319–327. [Google Scholar] [CrossRef]
- Klinger, R.; Rejmánek, M. The numerical and functional responses of a granivorous rodent and the fate of Neotropical tree seeds. Ecology 2009, 90, 1549–1563. [Google Scholar] [CrossRef]
- Moen, J.; Gardfjell, H.; Oksanen, L.; Ericson, L.; Ekerholm, P. Grazing by food-limited microtine rodents on a productive experimental plant community: Does the “green desert” exist? Oikos 1993, 68, 401–413. [Google Scholar] [CrossRef]
- Jędrzejewski, W.; Jędrzejewska, B. Rodent cycles in relation to biomass and productivity of ground vegetation and predation in the Palearctic. Acta Theriol. 1996, 41, 1–34. [Google Scholar] [CrossRef]
- Jones, C.G.; Ostfeld, R.S.; Richard, M.P.; Schauber, E.M.; Wolff, J.O. Chain reactions linking acorns to gypsy moth outbreaks and Lyme disease risk. Science 1998, 279, 1023–1026. [Google Scholar] [CrossRef] [PubMed]
- Brown, J.H.; Heske, E.J. Control of a desert-grassland transition by a keystone rodent guild. Science 1990, 250, 1705–1707. [Google Scholar] [CrossRef]
- Heske, E.J.; Brown, J.H.; Mistry, S. Long-term experimental study of a Chihuahuan Desert rodent community: 13 years of competition. Ecology 1994, 75, 438–445. [Google Scholar] [CrossRef]
- Ernest, S.M.; Brown, J.H.; Thibault, K.M.; White, E.P.; Goheen, J.R. Zero sum, the niche, and metacommunities: Long-term dynamics of community assembly. Am. Nat. 2008, 172, E257–E269. [Google Scholar] [CrossRef]
- Jansen, P.A.; Bongers, F.; Hemerik, L. Seed mass and mast seeding enhance dispersal by a neotropical scatter-hoarding rodent. Ecol. Monogr. 2004, 74, 569–589. [Google Scholar] [CrossRef]
- Schnurr, J.L.; Canham, C.D.; Ostfeld, R.S.; Inouye, R.S. Neighborhood analyses of small-mammal dynamics: Impacts on seed predation and seedling establishment. Ecology 2004, 85, 741–755. [Google Scholar] [CrossRef]
- Mendoza, E.; Dirzo, R. Seed-size variation determines interspecific differential predation by mammals in a neotropical rain forest. Oikos 2007, 116, 1841–1852. [Google Scholar] [CrossRef]
- Sikes, R.S.; Gannon, W.L.; Care, A. Mammalogists UCotASo. Guidelines of the American Society of Mammalogists for the use of wild mammals in research. J. Mammal. 2011, 92, 235–253. [Google Scholar] [CrossRef] [Green Version]
- Lauber, C.L.; Strickland, M.S.; Bradford, M.A.; Fierer, N. The influence of soil properties on the structure of bacterial and fungal communities across land-use types. Soil Biol. Biochem. 2008, 40, 2407–2415. [Google Scholar] [CrossRef]
- Donohoe, D.R.; Garge, N.; Zhang, X.; Sun, W.; O’Connell, T.M.; Bunger, M.K.; Bultman, S.J. The microbiome and butyrate regulate energy metabolism and autophagy in the mammalian colon. Cell Metab. 2011, 13, 517–526. [Google Scholar] [CrossRef]
- Taberlet, P.; Coissac, E.; Pompanon, F.; Gielly, L.; Miquel, C.; Valentini, A.; Vermat, T.; Corthier, G.; Brochmann, C.; Willerslev, E. Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Res. 2007, 3, 2007. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Lozupone, C.; Hamady, M.; Bushman, F.D.; Knight, R. Short pyrosequencing reads suffice for accurate microbial community analysis. Nucleic Acids Res. 2007, 35, e120. [Google Scholar] [CrossRef] [PubMed]
- Bergmann, G.T.; Bates, S.T.; Eilers, K.G.; Lauber, C.L.; Caporaso, J.G.; Walters, W.A.; Knight, R.; Fierer, N. The under-recognized dominance of Verrucomicrobia in soil bacterial communities. Soil Biol. Biochem. 2011, 43, 1450–1455. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Lauber, C.L.; Walters, W.A.; Berg-Lyons, D.; Lozupone, C.A.; Turnbaugh, P.J.; Fierer, N.; Knight, R. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proc. Natl. Acad. Sci. USA 2011, 108 (Suppl. 1), 4516–4522. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Gonzalez Peña, A.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335. [Google Scholar] [CrossRef]
- Taberlet, P.; Coissac, E.; Pompanon, F.; Brochmann, C.; Willerslev, E. Towards next-generation biodiversity assessment using DNA metabarcoding. Mol. Ecol. 2012, 21, 2045–2050. [Google Scholar] [CrossRef]
- Meusnier, I.; Singer, G.A.; Landry, J.-F.; Hickey, D.A.; Hebert, P.D.; Hajibabaei, M. A universal DNA mini-barcode for biodiversity analysis. BMC Genom. 2008, 9, 214. [Google Scholar] [CrossRef]
- Op De Beeck, M.; Lievens, B.; Busschaert, P.; Declerck, S.; Vangronsveld, J. Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies. PLoS ONE 2014, 9, e97629. [Google Scholar] [CrossRef] [Green Version]
- Mori, H.; Maruyama, F.; Kato, H.; Toyoda, A.; Dozono, A.; Ohtsubo, Y.; Nagata, Y.; Fujiyama, A.; Tsuda, M.; Kurokawa, K. Design and experimental application of a novel non-degenerate universal primer set that amplifies prokaryotic 16S rRNA genes with a low possibility to amplify eukaryotic rRNA genes. DNA Res. 2013, 21, 217–227. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460–2461. [Google Scholar] [CrossRef] [PubMed]
- Tedersoo, L.; Nilsson, R.H.; Abarenkov, K.; Jairus, T.; Sadam, A.; Saar, I.; Bahram, M.; Bechem, E.; Chuyong, G.; Kõljalg, U. 454 Pyrosequencing and Sanger sequencing of tropical mycorrhizal fungi provide similar results but reveal substantial methodological biases. New Phytol. 2010, 188, 291–301. [Google Scholar] [CrossRef] [PubMed]
- Bokulich, N.A.; Subramanian, S.; Faith, J.J.; Gevers, D.; Gordon, J.I.; Knight, R.; Mills, D.A.; Caporaso, J.G. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat. Methods 2013, 10, 57. [Google Scholar] [CrossRef]
- DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E.L.; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 2006, 72, 5069–5072. [Google Scholar] [CrossRef]
- Cole, J.R.; Wang, Q.; Cardenas, E.; Fish, J.; Chai, B.; Farris, R.J.; Kulam-Syed-Mohideen, A.S.; McGarrell, D.M.; Marsh, T.; Garrity, G.M.; et al. The Ribosomal Database Project: Improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 2008, 37 (Suppl. 1), D141–D145. [Google Scholar] [CrossRef]
- Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glöckner, F.O. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 2012, 41, D590–D596. [Google Scholar] [CrossRef]
- Kõljalg, U.; Nilsson, R.H.; Abarenkov, K.; Tedersoo, L.; Taylor, A.F.S.; Bahram, M.; Bates, S.T.; Bruns, T.D.; Bengtsson-Palme, J.; Callaghan, T.M.; et al. Towards a unified paradigm for sequence-based identification of fungi. Mol. Ecol. 2013, 22, 5271–5277. [Google Scholar] [CrossRef]
- Langille, M.G.I.; Zaneveld, J.; Caporaso, J.G.; McDonald, D.; Knights, D.; Reyes, J.A.; Clemente, J.C.; Burkepile, D.E.; Vega Thurber, R.L.; Knight, R.; et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 2013, 31, 814. [Google Scholar] [CrossRef]
- Shannon, C.E. A mathematical theory of communication. Bell Syst. Tech. J. 1948, 27, 379–423. [Google Scholar] [CrossRef] [Green Version]
- Chao, A. Estimating the population size for capture-recapture data with unequal catchability. Biometrics 1987, 43, 783–791. [Google Scholar] [CrossRef] [PubMed]
- Clarke, K.R. Non-parametric multivariate analyses of changes in community structure. Aust. J. Ecol. 1993, 18, 117–143. [Google Scholar] [CrossRef]
- Hammer, Ø.; Harper, D.; Ryan, P. PAST-Palaeontological Statistics. Available online: http://www.uv.es/~pardomv/pe/2001_1/past/pastprog/past.pdf (accessed on 23 December 2017).
- Benassi, G.; Bertolino, S. Distribution and activity of the introduced Tamias sibiricus (Laxmann 1769) in an urban park in Rome, Italy. Mammalia 2011, 75, 87–90. [Google Scholar] [CrossRef]
- Peeters, T.M. Een prachtige exoot: De Siberische grondeekhoorn (Tamias sibiricus). Nat. Kaaistoep 2012, 107–114. [Google Scholar]
- Verkem, S.; de Maeseneer, J.; Vandendriessche, B.; Verbeylen, G. Zoogdieren in Vlaanderen. Ecologie en Verspreiding van 1987 tot 2002; Natuurpunt Study and JNM Mammal Working Group: Mechelen & Gent, Belgium, 2003; pp. 284–289. [Google Scholar]
- Ley, R.E.; Hamady, M.; Lozupone, C.; Turnbaugh, P.J.; Ramey, R.R.; Bircher, J.S.; Schlegel, M.L.; Tucker, T.A.; Schrenzel, M.D.; Knight, R.; et al. Evolution of mammals and their gut microbes. Science 2008, 320, 1647–1651. [Google Scholar] [CrossRef]
- Muegge, B.D.; Kuczynski, J.; Knights, D.; Clemente, J.C.; González, A.; Fontana, L.; Henrissat, B.; Knight, R.; Gordon, J.I. Diet drives convergence in gut microbiome functions across mammalian phylogeny and within humans. Science 2011, 332, 970–974. [Google Scholar] [CrossRef] [PubMed]
- Maurice, C.F.; Knowles, S.; Ladau, J.; Pollard, K.S.; Fenton, A.; Pedersen, A.; Turnbaugh, P.J. Marked seasonal variation in the wild mouse gut microbiota. ISME J. 2015, 9, 2423. [Google Scholar] [CrossRef]
- Ley, R.E.; Lozupone, C.A.; Hamady, M.; Knight, R.; Gordon, J.I. Worlds within worlds: Evolution of the vertebrate gut microbiota. Nat. Rev. Microbiol. 2008, 6, 776. [Google Scholar] [CrossRef]
- Turnbaugh, P.J.; Ley, R.E.; Mahowald, M.A.; Magrini, V.; Mardis, E.R.; Gordon, J.I. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature 2006, 444, 1027. [Google Scholar] [CrossRef]
- Ley, R.E.; Bäckhed, F.; Turnbaugh, P.; Lozupone, C.A.; Knight, R.D.; Gordon, J.I. Obesity alters gut microbial ecology. Proc. Natl. Acad. Sci. USA 2005, 102, 11070–11075. [Google Scholar] [CrossRef]
- Hildebrandt, M.A.; Hoffmann, C.; Sherrill–Mix, S.A.; Keilbaugh, S.A.; Hamady, M.; Chen, Y.-Y.; Knight, R.; Ahima, R.S.; Bushman, F.; Wu, G.D. High-fat diet determines the composition of the murine gut microbiome independently of obesity. Gastroenterology 2009, 137, 1716–1724.e2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turnbaugh, P.J.; Hamady, M.; Yatsunenko, T.; Cantarel, B.L.; Duncan, A.; Ley, R.E.; Sogin, M.L.; Jones, W.J.; Roe, B.A.; Affourtit, J.P.; et al. A core gut microbiome in obese and lean twins. Nature 2009, 457, 480. [Google Scholar] [CrossRef] [PubMed]
- Parks, B.W.; Nam, E.; Org, E.; Kostem, E.; Norheim, F.; Hui, S.T.; Pan, C.; Civelek, M.; Rau, C.D.; Bennett, B.J.; et al. Genetic control of obesity and gut microbiota composition in response to high-fat, high-sucrose diet in mice. Cell Metab. 2013, 17, 141–152. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Jiang, C.; Krausz, K.W.; Li, Y.; Albert, I.; Hao, H.; Fabre, K.M.; Mitchell, J.B.; Patterson, A.; Gonzalez, F.J. Microbiome remodelling leads to inhibition of intestinal farnesoid X receptor signalling and decreased obesity. Nat. Commun. 2013, 4, 2384. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.C.-H.; Hudson, J.W. Temperature regulation in normothermic and hibernating eastern chipmunk, Tamias striatus. Comp. Biochem. Physiol. Part A Physiol. 1971, 38, 59–90. [Google Scholar]
- Thomas, D.W.; Dorais, M.; Bergeron, J.-M. Winter energy budgets and cost of arousals for hibernating little brown bats, Myotis lucifugus. J. Mammal 1990, 71, 475–479. [Google Scholar] [CrossRef]
- Fava, F.; Gitau, R.; Griffin, B.; Gibson, G.; Tuohy, K.; Lovegrove, J. The type and quantity of dietary fat and carbohydrate alter faecal microbiome and short-chain fatty acid excretion in a metabolic syndrome ‘at-risk’ population. Int. J. Obes. 2013, 37, 216. [Google Scholar] [CrossRef]
- Hatori, M.; Vollmers, C.; Zarrinpar, A.; DiTacchio, L.; Bushong, E.A.; Gill, S.; Leblanc, M.; Chaix, A.; Joens, M.; Fitzpatrick, J.A.; et al. Time-restricted feeding without reducing caloric intake prevents metabolic diseases in mice fed a high-fat diet. Cell Metab. 2012, 15, 848–860. [Google Scholar] [CrossRef]
- Wu, G.D.; Chen, J.; Hoffmann, C.; Bittinger, K.; Chen, Y.-Y.; Keilbaugh, S.A.; Bewtra, M.; Knights, D.; Walters, W.A.; Knight, R.; et al. Linking long-term dietary patterns with gut microbial enterotypes. Science 2011, 334, 105–108. [Google Scholar] [CrossRef]
- David, L.A.; Maurice, C.F.; Carmody, R.N.; Gootenberg, D.B.; Button, J.E.; Wolfe, B.E.; Ling, A.V.; Devlin, A.S.; Varma, Y.; Fischbach, M.A.; et al. Diet rapidly and reproducibly alters the human gut microbiome. Nature 2014, 505, 559. [Google Scholar] [CrossRef] [PubMed]
- Tuddenham, S.; Sears, C.L. The intestinal microbiome and health. Curr. Opin. Infect. Dis. 2015, 28, 464. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Study Area | Latitude | Longitude | Altitude |
---|---|---|---|
Site 1 (iron tower) | 47°10′59.58″ | 128°53′50.89″ | 405 m |
Site 2 (slope 2) | 47°10′55.12″ | 128°53′40.31″ | 416 m |
Site 3 (slope 1) | 47°10′54.54″ | 128°53′40.74″ | 374 m |
Site 4 (footpath) | 47°10′57.92″ | 128°53′42.02″ | 419 m |
Site 5 (log cabin) | 47°10′58.93″ | 128°53′47.21″ | 452 m |
DNA Marker | Target Group | Primer Name | Primer Sequences (5–3′) | Amplifying Base Pair | References |
---|---|---|---|---|---|
rbcL | Universal plant mini-barcode | Z1aF/hp2R | ATGTCACCACCAACAGAGACTAAAGC CGTCCTTTGTAACGATCAAG | 250 bp | [49] |
COI gene | Universal animal mini-barcode | mlCOIintF/REV | GGWACWGGWTGAACWGTWTAYCCYCC TANACYTCNGGRTGNCCRAARAAYCA | 360 bp | [50] |
ITS Primer Pairs | Fungi | ITS5F/ITS2R | GGAAGTAAAAGTCGTAACAAGG GCTGCGTTCTTCATCGATGC | 280 bp | [51] |
16S rRNA | microbiota | 338F/806R | ACTCCTACGGGAGGCAGCA GGACTACHVGGGTWTCTAAT | 500 bp | [52] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Teng, W.; Maqsood, I.; Wang, H.; Ma, J.; Rong, K. Correlation and Influence of Seasonal Variation of Diet with Gut Microbiota Diversity and Metabolism Profile of Chipmunk. Animals 2022, 12, 2586. https://doi.org/10.3390/ani12192586
Teng W, Maqsood I, Wang H, Ma J, Rong K. Correlation and Influence of Seasonal Variation of Diet with Gut Microbiota Diversity and Metabolism Profile of Chipmunk. Animals. 2022; 12(19):2586. https://doi.org/10.3390/ani12192586
Chicago/Turabian StyleTeng, Wei, Iram Maqsood, Huan Wang, Jianzhang Ma, and Ke Rong. 2022. "Correlation and Influence of Seasonal Variation of Diet with Gut Microbiota Diversity and Metabolism Profile of Chipmunk" Animals 12, no. 19: 2586. https://doi.org/10.3390/ani12192586
APA StyleTeng, W., Maqsood, I., Wang, H., Ma, J., & Rong, K. (2022). Correlation and Influence of Seasonal Variation of Diet with Gut Microbiota Diversity and Metabolism Profile of Chipmunk. Animals, 12(19), 2586. https://doi.org/10.3390/ani12192586