The Prevalence of Salmonella and Campylobacter on Broiler Meat at Different Stages of Commercial Poultry Processing
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. Sample Collection
2.3. Salmonella Isolation
2.4. Salmonella DNA Extraction and PCR Confirmation
2.5. Electrophoresis of the PCR Products
2.6. Serotyping
2.7. Campylobacter Isolation
2.8. Campylobacter DNA Extraction and PCR
2.9. Electrophoresis of the PCR Products
2.10. Statistical Analysis
3. Results
3.1. Salmonella Prevalence
3.2. Campylobacter Prevalence
4. Discussion
4.1. Salmonella Contamination
4.2. Campylobacter Contamination
4.3. MDM Contamination
4.4. Peracetic Acid Interventions
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- US Department of Agriculture, National Agriculture Statistics Service. Broilers: Production and Value of Production by Year, US (Last Reviewed 29 April 2021). Available online: https://www.nass.usda.gov/Charts_and_Maps/Poultry/brprvl.php (accessed on 14 May 2021).
- Akil, L.; Ahmad, H.A. Quantitative Risk Assessment Model of Human Salmonellosis Resulting from Consumption of Broiler Chicken. Diseases 2019, 7, 19. [Google Scholar] [CrossRef] [PubMed]
- Thames, H.T.; Sukumaran, A.T. A Review of Salmonella and Campylobacter in Broiler Meat: Emerging Challenges and Food Safety Measures. Foods 2020, 9, 776. [Google Scholar] [CrossRef] [PubMed]
- Batz, M.B.; Hoffman, S.; Morris, J.G. Ranking the Risks: The 10 Pathogen-Food Combinations with the Greatest Burden on Public Health. Emerging Pathogens Institute. Available online: http://www.epi.ufl.edu/sites/www.epi.ufl.edu/files/RankingTheRisksREPORT.pdf (accessed on 20 March 2022).
- Wideman, N.; Bailey, M.; Bilgili, S.F.; Thippareddi, H.; Wang, L.; Bratcher, C.; Sanchez-Plata, M.; Singh, M. Evaluating best practices for Campylobacter and Salmonella reduction in poultry processing plants. Poult. Sci. 2016, 95, 306–315. [Google Scholar] [CrossRef] [PubMed]
- Antunes, P.; Mourão, J.; Campos, J.; Peixe, L. Salmonellosis: The role of poultry meat. Clin. Microbiol. Infect. 2016, 22, 110–121. [Google Scholar] [CrossRef]
- Centers for Disease Control and Prevention (CDC). Salmonella Homepage (Last Reviewed 23 February 2021). Available online: https://www.cdc.gov/salmonella/index.html) (accessed on 7 March 2021).
- Food Safety and Inspection Service. Data Collection and Reports 2016. Available online: https://www.fsis.usda.gov/wps/portal/fsis/topics/data-collection-and-reports/microbiology/annual-serotyping-reports (accessed on 7 March 2021).
- Obe, T.; Nannapaneni, R.; Schilling, W.; Zhang, L.; McDaniel, C.; Kiess, A. Prevalence of Salmonella enterica on poultry processing equipment after completion of sanitization procedures. Poult. Sci. 2020, 99, 4539–4548. [Google Scholar] [CrossRef]
- Tellez-Isaias, G.; Christine, N.V.; Brittany, D.G.; Callie, M.S.; Lucas, E.G.; Roberto, S.; Barros, T.L.; Beer, L.C.; Coles, M.E.; Forga, A.J.; et al. Developing probiotics, prebiotics, and organic acids to control Salmonella spp. in commercial turkeys at the University of Arkansas, USA. Ger. J. Vet. Res. 2021, 3, 7–12. [Google Scholar] [CrossRef]
- Mouttotou, N.; Ahmad, S.; Kamran, Z.; Koutoulis, K.C. Prevalence, risks and antibiotic resistance of Salmonella in poultry production chain. In Current Topics in Salmonella and Salmonellosis; InTechOpen: London, UK, 2017; pp. 215–234. [Google Scholar]
- Corry, J.E.L.; Allen, V.; Hudson, W.; Breslin, M.; Davies, R. Sources of salmonella on broiler carcasses during transportation and processing: Modes of contamination and methods of control. J. Appl. Microbiol. 2002, 92, 424–432. [Google Scholar] [CrossRef]
- Olsen, J.; Brown, D.; Madsen, M.; Bisgaard, M. Cross-contamination with Salmonella on a broiler slaughterhouse line demonstrated by use of epidemiological markers. J. Appl. Microbiol. 2003, 94, 826–835. [Google Scholar] [CrossRef]
- Berrang, M.E.; Bailey, J.S.; Altekruse, S.F.; Shaw, W.K., Jr.; Patel, B.L.; Meinersmann, R.J.; Fedorka-Cray, P.J. Prevalence, serotype, and antimicrobial resistance of Salmonella on broiler carcasses postpick and postchill in 20 US processing plants. J. Food Prot. 2009, 72, 1610–1615. [Google Scholar] [CrossRef]
- Finstad, S.; O’Bryan, C.A.; Marcy, J.A.; Crandall, P.G.; Ricke, S.C. Salmonella and broiler processing in the United States: Relationship to foodborne salmonellosis. Food Res. Int. 2012, 45, 789–794. [Google Scholar] [CrossRef]
- US Department of Agriculture, National Agriculture Statistics Service. Campylobacter (Last Reviewed 7 August 2013). Available online: https://www.fsis.usda.gov/food-safety/foodborne-illness-and-disease/pathogens/campylobacter (accessed on 7 May 2021).
- Centers for Disease Control and Prevention (CDC). Campylobacter (Campylobacteriosis) (Final Update). 2019. Available online: https://www.cdc.gov/campylobacter/index.html (accessed on 7 April 2020).
- Dogan, O.B.; Clarke, J.; Mattos, F.; Wang, B. A quantitative microbial risk assessment model of Campylobacter in broiler chickens: Evaluating processing interventions. Food Control 2019, 100, 97–110. [Google Scholar] [CrossRef]
- Keener, K.; Bashor, M.; Curtis, P.; Sheldon, B.; Kathariou, S. Comprehensive Review of Campylobacter and Poultry Processing. Compr. Rev. Food Sci. Food Saf. 2004, 3, 105–116. [Google Scholar] [CrossRef] [PubMed]
- Korsak, D.; Maćkiw, E.; Rożynek, E.; Żyłowska, M. Prevalence of Campylobacter spp. in Retail Chicken, Turkey, Pork, and Beef Meat in Poland between 2009 and 2013. J. Food Prot. 2015, 78, 1024–1028. [Google Scholar] [CrossRef]
- Han, F.; Lestari, S.I.; Pu, S.; Ge, B. Prevalence and Antimicrobial Resistance Among Campylobacter spp. in Louisiana Retail Chickens After the Enrofloxacin Ban. Foodborne Pathog. Dis. 2009, 6, 163–171. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.; Young, S.R.; Tong, E.; Abbott, J.W.; Womack, N.; Friedman, S.L.; McDermott, P.F. Antimicrobial Resistance of Campylobacter Isolates from Retail Meat in the United States between 2002 and 2007. Appl. Environ. Microbiol. 2010, 76, 7949–7956. [Google Scholar] [CrossRef]
- Whitehouse, C.A.; Young, S.; Li, C.; Hsu, C.H.; Martin, G.; Zhao, S. Use of whole-genome sequencing for Campylobacter surveillance from NARMS retail poultry in the United States in 2015. Food Microbiol. 2018, 73, 122–128. [Google Scholar] [CrossRef]
- Food and Drug Administration (FDA). NARMS Now. Rockville, MD: U.S. Department of Health and Human Services. 2019. Available online: https://www.fda.gov/animal-veterinary/national-antimicrobial-resistance-monitoring-system/narms-now-integrated-data (accessed on 7 April 2020).
- Paul, N.C.; Sullivan, T.S.; Shah, D.H. Differences in antimicrobial activity of chlorine against twelve most prevalent poultry-associated Salmonella serotypes. Food Microbiol. 2017, 64, 202–209. [Google Scholar] [CrossRef]
- USDA-FSIS. Safe and Suitable Ingredients in the Production of Meat, Poultry, and Egg Products. FSIS Directive 7120.1 Revision 15. 2019. Available online: https://www.fsis.usda.gov/wps/wcm/connect/bab10e09-aefa-483b8be8809a1f051d4c/7120.1.pdf?MOD=AJPERES (accessed on 7 March 2021).
- Thames, H.T.; Fancher, C.A.; Colvin, M.G.; McAnally, M.; Tucker, E.; Zhang, L.; Kiess, A.S.; Dinh, T.T.N.; Sukumaran, A.T. Spoilage Bacteria Counts on Broiler Meat at Different Stages of Commercial Poultry Processing Plants That Use Peracetic Acid. Animals 2022, 12, 1439. [Google Scholar] [CrossRef]
- U.S. Department of Agriculture, Food Safety and Inspection Service. Isolation and identification of Salmonella from Meat, Poultry, Pasteurized Egg and Siluriformes (Fish) Products and Carcass and Environmental Sponges. MLG 4.10. Effective 2 January 2019. Available online: https://s27415.pcdn.co/wp-content/uploads/2020/01/64ER20-7/Microbial/5-USDA-FSIS-4.10-Isolation-and-Identification-of-Salmonella.pdf (accessed on 7 March 2021).
- Rahn, K.; De Grandis, S.A.; Clarke, R.C.; McEwen, S.A.; Galan, J.E.; Ginocchio, C.; Curtis, R., III; Gyles, C.L. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol. Cell. Probes 1992, 6, 271–279. [Google Scholar] [CrossRef]
- Wang, G.; Clark, C.G.; Taylor, T.M.; Pucknell, C.; Barton, C.; Price, L.; Woodward, D.L.; Rodgers, F.G. Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J. Clin. Microbiol. 2002, 40, 4744–4747. [Google Scholar] [CrossRef]
- McKee, S.R. Salmonella and Campylobacter control during poultry processing. In Proceedings of the International Poultry Scientific Forum; Atlanta, GA, USA, 24 January 2011. [Google Scholar]
- Nagel, G.; Bauermeister, L.; Bratcher, C.; Singh, M.; McKee, S. Salmonella and Campylobacter reduction and quality characteristics of poultry carcasses treated with various antimicrobials in a post-chill immersion tank. Int. J. Food Microbiol. 2013, 165, 281–286. [Google Scholar] [CrossRef]
- Bailey, M.; Taylor, R.; Brar, J.; Corkran, S.; Velásquez, C.; Novoa-Rama, E.; Oliver, H.F.; Singh, M. Prevalence and Antimicrobial Resistance of Salmonella from Antibiotic-Free Broilers During Organic and Conventional Processing. J. Food Prot. 2020, 83, 491–496. [Google Scholar] [CrossRef]
- Kumar, S.; Singh, M.; Cosby, D.; Cox, N.; Thippareddi, H. Efficacy of peroxy acetic acid in reducing Salmonella and Campylobacter spp. populations on chicken breast fillets. Poult. Sci. 2020, 99, 2655–2661. [Google Scholar] [CrossRef] [PubMed]
- Miller, R.G.; Tate, C.; Mallinson, E.; Scherrer, J. Xylose-Lysine-Tergitol 4: An Improved Selective Agar Medium for the Isolation of Salmonella. Poult. Sci. 1991, 70, 2429–2432. [Google Scholar] [CrossRef] [PubMed]
- Gast, R.K.; Mitchell, B.W.; Holt, P.S. Evaluation of Culture Media for Detecting Airborne Salmonella Enteritidis Collected with an Electrostatic Sampling Device from the Environment of Experimentally Infected Laying Hens. Poult. Sci. 2004, 83, 1106–1111. [Google Scholar] [CrossRef] [PubMed]
- McCrea, B.A.; Tonooka, K.H.; VanWorth, C.; Atwill, E.R.; Schrader, J.S.; Boggs, C.L. Prevalence of Campylobacter and Salmonella Species on Farm, After Transport, and at Processing in Specialty Market Poultry. Poult. Sci. 2006, 85, 136–143. [Google Scholar] [CrossRef]
- Guerin, M.T.; Sir, C.; Sargeant, J.M.; Waddell, L.; O’Connor, A.; Wills, R.W.; Bailey, R.H.; Byrd, J.A. The change in prevalence of Campylobacter on chicken carcasses during processing: A systematic review. Poult. Sci. 2010, 89, 1070–1084. [Google Scholar] [CrossRef]
- Food Safety and Inspection Service. Pathogen Reduction—Salmonella and Campylobacter Performance Standards Verification Testing. 2019. Available online: https://www.fsis.usda.gov/wps/wcm/connect/b0790997-2e74-48bf-9799-85814bac9ceb/28_IM_PR_Sal_Campy.pdf?MOD=AJPERES (accessed on 7 April 2020).
- Bijker, P.; van Logtestijn, J.; Mossel, D. Bacteriological quality assurance (BQA) of mechanically deboned meat (MDM). Meat Sci. 1987, 20, 237–252. [Google Scholar] [CrossRef]
- Yuste, J.; Mor-Mur, M.; Capellas, M.; Guamis, B.; Pla, R. Microbiological quality of mechanically recovered poultry meat treated with high hydrostatic pressure and nisin. Food Microbiol. 1998, 15, 407–414. [Google Scholar] [CrossRef]
- Rouger, A.; Tresse, O.; Zagorec, M. Bacterial Contaminants of Poultry Meat: Sources, Species, and Dynamics. Microorganisms 2017, 5, 50. [Google Scholar] [CrossRef]
- Akramzadeh, N.; Ramezani, Z.; Ferdousi, R.; Akbari-Adergani, B.; Mohammadi, A.; Karimian-Khosroshahi, N.; Famenin, B.K.; Pilevar, Z.; Hosseini, H. Effect of chicken raw materials on physicochemical and microbiological properties of mechanically deboned chicken meat. In Veterinary Research Forum; Faculty of Veterinary Medicine, Urmia University: Urmia, Iran, 2020; Volume 11, p. 153. [Google Scholar]
- Perez, S.M. Evaluating the Impact of Cetylpyridinium Chloride and Peroxyacetic Acid When Applied to Broiler Frames on Salmonella spp. and the Quality and Sensory Attributes of Mechanically Deboned Chicken Meat; Mississippi State University: Mississippi State, MS, USA, 2016. [Google Scholar]
- Bashor, M.P.; Curtis, P.A.; Keener, K.M.; Sheldon, B.W.; Kathariou, S.; Osborne, J.A. Effects of Carcass Washers on Campylobacter Contamination in Large Broiler Processing Plants. Poult. Sci. 2004, 83, 1232–1239. [Google Scholar] [CrossRef] [PubMed]
- Beers, K.; Rheingans, J.; Chinault, K.; Cook, P.; Smith, B.; Waldroup, A. Microbial efficacy of commercial application of Cecure® CPC antimicrobial to ingesta-contaminated pre-chill broiler carcasses. Int. J. Poult. Sci. 2006, 5, 698–703. [Google Scholar]
- Allen, V.; Tinker, D.; Wathes, C.; Hinton, M. Dispersal of micro-organisms in commercial defeathering systems. Br. Poult. Sci. 2003, 44, 53–59. [Google Scholar] [CrossRef]
- Cason, J.A.; Hinton Jr, A.; Buhr, R.J. Impact of feathers and feather follicles on broiler carcass bacteria. Poult. Sci. 2004, 83, 1452–1455. [Google Scholar] [CrossRef] [PubMed]
- Buhr, R.J.; Bourassa, D.V.; Northcutt, J.K.; Hinton, A., Jr.; Ingram, K.D.; Cason, J.A. Bacteria recovery from genetically feathered and featherless broiler carcasses after immersion chilling. Poult. Sci. 2005, 84, 1499–1504. [Google Scholar] [CrossRef]
- Kataria, J.; Vaddu, S.; Rama, E.N.; Sidhu, G.; Thippareddi, H.; Singh, M. Evaluating the efficacy of peracetic acid on Salmonella and Campylobacter on chicken wings at various pH levels. Poult. Sci. 2020, 99, 5137–5142. [Google Scholar] [CrossRef]
- Bauermeister, L.J.; Bowers, J.W.J.; Townsend, J.C.; McKee, S.R. The Microbial and Quality Properties of Poultry Carcasses Treated with Peracetic Acid as an Antimicrobial Treatment. Poult. Sci. 2008, 87, 2390–2398. [Google Scholar] [CrossRef]




| Primer | Size (in bp) | Sequence (5′-3′) | GenBank Accession No. | Target Gene | Gene Location (bp) | 
|---|---|---|---|---|---|
| CJF | 323 | ACTTCTTTATTGCTTGCTGC | Z36940 | C. jejuni hipO | 1662–1681 | 
| CJR | GCCACAACAAGTAAAGAAGC | 1984–1965 | |||
| CCF | 126 | GTAAAACCAAAGCTTATCGTG | AF136494 | C. coli glyA | 337–357 | 
| CCR | TCCAGCAATGTGTGCAATG | 462–444 | |||
| CLF | 251 | TAGAGAGATAGCAAAAGAGA | AF136495 | C. lari glyA | 318–337 | 
| CLR | TACACATAATAATCCCACCC | 568–549 | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Thames, H.T.; Fancher, C.A.; Colvin, M.G.; McAnally, M.; Tucker, E.; Zhang, L.; Kiess, A.S.; Dinh, T.T.N.; Sukumaran, A.T. The Prevalence of Salmonella and Campylobacter on Broiler Meat at Different Stages of Commercial Poultry Processing. Animals 2022, 12, 2460. https://doi.org/10.3390/ani12182460
Thames HT, Fancher CA, Colvin MG, McAnally M, Tucker E, Zhang L, Kiess AS, Dinh TTN, Sukumaran AT. The Prevalence of Salmonella and Campylobacter on Broiler Meat at Different Stages of Commercial Poultry Processing. Animals. 2022; 12(18):2460. https://doi.org/10.3390/ani12182460
Chicago/Turabian StyleThames, Hudson T., Courtney A. Fancher, Mary G. Colvin, Mika McAnally, Emily Tucker, Li Zhang, Aaron S. Kiess, Thu T. N. Dinh, and Anuraj T. Sukumaran. 2022. "The Prevalence of Salmonella and Campylobacter on Broiler Meat at Different Stages of Commercial Poultry Processing" Animals 12, no. 18: 2460. https://doi.org/10.3390/ani12182460
APA StyleThames, H. T., Fancher, C. A., Colvin, M. G., McAnally, M., Tucker, E., Zhang, L., Kiess, A. S., Dinh, T. T. N., & Sukumaran, A. T. (2022). The Prevalence of Salmonella and Campylobacter on Broiler Meat at Different Stages of Commercial Poultry Processing. Animals, 12(18), 2460. https://doi.org/10.3390/ani12182460
 
        

 
       