Transcriptional Characteristics Showed That miR-144-y/FOXO3 Participates in Embryonic Skin and Feather Follicle Development in Zhedong White Goose
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Sample Collection
2.3. Hematoxylin and Eosin Staining
2.4. Masson Staining
2.5. Van Gieson Staining
2.6. RNA Isolation, Library Creation and Sequencing
2.7. MicroRNA Library Creation and Sequencing
2.8. PCA, Quantification, and Analysis of DEGs and Clustering Analysis
2.9. GO Enrichment Analysis and Pathway Enrichment Analysis
2.10. MicroRNA Target Genes Prediction
2.11. MicroRNA Target Network Construction
2.12. RNA Isolation
2.13. Quantitative Real-Time PCR (RT-qPCR) Validation of Sequencing Data
2.14. Dual-Luciferase Reporter Gene Assay
2.15. In Situ Hybridization
2.16. Statistical Analysis
3. Results
3.1. Histological Structure of Skin and Feather Follicles at Different Stages
3.2. Overview of RNA Sequencing Data
3.3. GO Enrichment and KEGG Pathway Analysis of the Differentially Expressed Genes
3.4. Trend Analysis of DEGs among the Developmental Stages
3.5. Validation of RNA and miRNA Expression Results by qRT-PCR
3.6. In Situ Hybridization Assay
3.7. Construction Analysis of miRNA and mRNA Network
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yu, M.; Wu, P.; Widelitz, R.B.; Chuong, C.M. The morphogenesis of feathers. Nature 2002, 420, 308–312. [Google Scholar] [CrossRef] [PubMed]
- Benton, M.J.; Dhouailly, D.; Jiang, B.; McNamara, M. The Early Origin of Feathers. Trends Ecol. Evol. 2019, 34, 856–869. [Google Scholar] [CrossRef]
- Xu, R.F.; Wu, W.; Xu, H. Molecular, Cellular, and Developmental BIiology Investigation of Feather Follicle Development in Embryonic Geese. Poult. Sci. 2007, 86, 2000–2007. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.J.; Wideliz, R.B.; Yue, Z.; Li, A.; Wu, X.; Jiang, T.X.; Wu, P.; Chuong, C.M. Feather regeneration as a model for organogenesis. Dev. Growth Differ. 2013, 55, 139–148. [Google Scholar] [CrossRef]
- Lin, C.M.; Jiang, T.X.; Widelitz, R.B.; Chuong, C.M. Molecular signaling in feather morphogenesis. Curr. Opin. Cell Biol. 2006, 18, 730–741. [Google Scholar] [CrossRef]
- Chen, C.F.; Foley, J.; Tang, P.C.; Li, A.; Jiang, T.X.; Wu, P.; Chuong, C.M. Development, Regeneration, and Evolution of Feathers. Annu. Rev. Anim. Biosci. 2015, 3, 169–195. [Google Scholar] [CrossRef] [PubMed]
- Kaoru, K.; Mahsa, S.D.; Aristidis, M. TGF-β Family Signaling in Epithelial Differentiation and Epithelial–Mesenchymal Transition. Cold Spring Harb. Perspect. Biol. 2018, 10, a022194. [Google Scholar] [CrossRef]
- Sennett, R.; Rendl, M. Mesenchymal-epithelial interactions during hair follicle morphogenesis and cycling. Semin. Cell Dev. Biol. 2012, 23, 917–927. [Google Scholar] [CrossRef]
- Yue, Z.; Jiang, T.X.; Widelitz, R.B.; Cheng, M.C. Mapping stem cell activities in the feather follicle. Nature 2005, 438, 1026–1029. [Google Scholar] [CrossRef]
- Biggs, L.C.; Mikkola, M.L. Early inductive events in ectodermal appendage morphogenesis. Semin. Cell Dev. Biol. 2014, 25–26, 11–21. [Google Scholar] [CrossRef]
- Mikkola, M.L. Genetic basis of skin appendage development. Semin. Cell Dev. Biol. 2007, 18, 225–236. [Google Scholar] [CrossRef] [PubMed]
- Sennett, R.; Wang, Z.; Rezza, A.; Grisanti, L.; Roitershtein, N.; Sicchio, C.; Mok, K.M.; Heitman, N.J.; Clavel, C.; Ma’ayan, A.; et al. An Integrated Transcriptome Atlas of Embryonic Hair Follicle Progenitors, Their Niche, and the Developing Skin. Dev. Cell. 2015, 34, 577–591. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Nan, W.; Wang, S.; Zhang, T.; Si, H.; Wang, D.; Yang, F.; Li, G. Epidermal growth factor promotes proliferation of dermal papilla cells via Notch signaling pathway. Biochimie 2016, 127, 10–18. [Google Scholar] [CrossRef]
- Hu, X.; Zhang, X.; Liu, Z.; Li, S.; Zheng, X.; Nie, Y.; Tao, Y.; Zhou, X.; Wu, W.; Yang, G.; et al. Exploration of key regulators driving primary feather follicle induction in goose skin. Gene 2020, 731, 144338. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Sello, C.T.; Sui, Y.; Hu, J.; Chen, S.; Msuthwana, P.; Zhou, Y.; Wachiebine, S.K.; Sun, Y.; Jing, L.J.; et al. Characterization of embryonic skin transcriptome in Anser cygnoides at three feather follicles developmental stages. G3 Genes Genomes Genet. 2020, 10, 443–454. [Google Scholar] [CrossRef]
- Sello, C.T.; Liu, C.; Sun, Y.; Msuthwana, P.; Hu, J.; Sui, Y.; Chen, S.; Zhou, Y.; Lu, H.; Xu, C.; et al. De novo assembly and comparative transcriptome profiling of Anser anser and Anser cygnoides geese species’ embryonic skin feather follicles. Genes 2019, 10, 351. [Google Scholar] [CrossRef]
- Liu, C.; Sello, C.T.; Sun, Y.; Zhou, Y.; Lu, H.; Sui, Y.; Hu, J.; Xu, C.; Sun, Y.; Liu, J.; et al. De novo transcriptome sequencing analysis of goose (Anser anser) embryonic skin and the identification of genes related to feather follicle morphogenesis at three stages of development. Int. J. Mol. Sci. 2018, 19, 3170. [Google Scholar] [CrossRef]
- Bhattacharjee, M.J.; Yu, C.P.; Lin, J.J.; Ng, C.S.; Wang, T.Y.; Lin, H.H.; Li, W.H. Regulatory Divergence among Beta-Keratin Genes during Bird Evolution. Mol. Biol. Evol. 2016, 33, 2769–2780. [Google Scholar] [CrossRef]
- Ji, G.G.; Zhang, M.; Liu, Y.F.; Shan, Y.J.; Tu, Y.J.; Ju, X.J.; Zou, J.M.; Shu, J.T.; Wu, J.F.; Xie, J.F. A gene co-expression network analysis of the candidate genes and molecular pathways associated with feather follicle traits of chicken skin. J. Anim. Breed Genet. 2020, 138, 122–134. [Google Scholar] [CrossRef]
- Bao, W.; Greenwold, M.J.; Sawyer, R.H. Expressed miRNAs target feather related mRNAs involved in cell signaling, cell adhesion and structure during chicken epidermal development. Gene 2016, 591, 393–402. [Google Scholar] [CrossRef]
- Stettenheim, P.R. The integumentary morphology of modern birds. Overv. Am. Zooligest 2000, 40, 461–477. [Google Scholar]
- Ng, C.S.; Li, W.H. Genetic and Molecular Basis of Feather Diversity in Birds. Genome Biol. Evol. 2018, 10, 2572–2586. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Zhu, Y.; Liu, H.; Liu, G.; Li, F. Wnt10b promotes hair follicles growth and dermal papilla cells proliferation via Wnt/beta-Catenin signaling pathway in Rex Rabbits. Biosci. Rep. 2020, 40, BSR20191248. [Google Scholar] [CrossRef]
- Xie, W.Y.; Chen, M.J.; Jiang, S.G.; Yan, H.C.; Wang, X.Q.; Gao, C.Q. Investigation of feather follicle morphogenesis and the expression of the Wnt/β-catenin signaling pathway in yellow-feathered broiler chick embryos. Br. Poult. Sci. 2020, 61, 557–565. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Ge, K.; Wang, M.; Zhang, C.; Geng, Z. Integrative analysis of the Pekin duck (Anas anas) MicroRNAome during feather follicle development. BMC Dev. Biol. 2017, 17, 12. [Google Scholar] [CrossRef]
- Tao, Y.; Zhou, X.; Liu, Z.; Zhang, X.; Nie, Y.; Zheng, X.; Mou, X.C. Expression patterns of three JAK–STAT pathway genes in feather follicle development during chicken embryogenesis. Gene Expr. Patterns 2020, 35, 119078. [Google Scholar] [CrossRef]
- Nie, Y.; Li, S.; Zheng, X.T.; Chen, W.; Li, X.; Liu, Z.; Mou, C. Transcriptome reveals long non-coding RNAs and mRNAs involved in primary wool follicle induction in carpet sheep fetal skin. Front. Physiol. 2018, 9, 446. [Google Scholar] [CrossRef]
- Hai, E.; Han, W.; Wu, Z.; Ma, R.; Shang, F.; Wang, M.; Zhang, Y. Chi-miR-370-3p regulates hair follicle morphogenesis of Inner Mongolian cashmere goats. G3 Genes Genomes Genet. 2021, 11, jkab091. [Google Scholar] [CrossRef]
- Lv, X.; Chen, W.; Wang, S.; Cao, X.; Yuan, Z.; Getachew, T.; Sun, W. Integrated Hair Follicle Profiles of microRNAs and mRNAs to Reveal the Pattern Formation of Hu Sheep Lambskin. Genes 2022, 13, 342. [Google Scholar] [CrossRef]
- Ahmed, M.I.; Alam, M.; Emelianov, V.U.; Poterlowicz, K.; Patel, A.; Sharov, A.A.; Mardaryev, A.N.; Botchkareva, N.V. MicroRNA-214 controls skin and hairfollicle development by modulating the activity of the Wnt pathway. J. Cell Biol. 2014, 207, 549–567. [Google Scholar] [CrossRef]
- Gong, H.; Wang, H.; Wang, Y.; Bai, X.; Liu, B.; He, J.; Zhang, W. Skin transcriptome reveals the dynamic changes in the Wnt pathway during integument morphogenesis of chick embryos. PLoS ONE 2018, 13, e190933. [Google Scholar] [CrossRef]
- Rosso, F.; Giordano, A.; Barbarisi, M.; Barbarisi, A. From Cell–ECM interactions to tissue engineering. J. Cell. Physiol. 2004, 199, 174–180. [Google Scholar] [CrossRef] [PubMed]
- Watt, F.M.; Fujiwara, H. Cell-extracellular matrix interactions in normal and diseased skin. Cold Spring Harb. Perspect. Biol. 2011, 3, a005124. [Google Scholar] [CrossRef] [PubMed]
- Zhu, B.; Xu, T.; Yuan, J.; Guo, X.; Liu, D. Transcriptome Sequencing Reveals Differences between Primary and Secondary Hair Follicle-derived Dermal Papilla Cells of the Cashmere Goat (Capra hircus). PLoS ONE 2013, 8, e76282. [Google Scholar] [CrossRef]
- Gao, Y.; Wang, X.; Yan, H.; Zeng, J.; Ma, S.; Niu, Y.; Zhou, G.; Jiang, Y.; Chen, Y. Comparative Transcriptome Analysis of Fetal Skin Reveals Key Genes Related to Hair Follicle Morphogenesis in Cashmere Goats. PLoS ONE 2016, 11, e0151118. [Google Scholar] [CrossRef]
- Michalik, L.; Wahli, W. Peroxisome proliferator-activated receptors (PPARs) in skin health, repair and disease. Biochim. Biophys. Acta 2007, 1771, 991–998. [Google Scholar] [CrossRef]
- Donaldson, A.D.; Blow, J.J. The regulation of replication origin activation. Curr. Opin. Genet. Dev. 1999, 9, 62–68. [Google Scholar] [CrossRef]
- Su, Z.; Zheng, X.; Zhang, X.; Wang, Y.; Zhu, S.; Lu, F.; Hou, L. Sox10 regulates skin melanocyte proliferation by activating the DNA replication licensing factor MCM5. J. Dermatol. Sci. 2017, 85, 216–225. [Google Scholar] [CrossRef]
- Hardy, M.; Vielkind, U. Changing patterns of cell adhesion molecules during mouse pelage hair follicle development. Cells Tissues Organs 1996, 157, 169–182. [Google Scholar] [CrossRef]
- Abdoli, M.A.; Mohamadi, F.; Ghobadian, B.; Fayyazi, E. Effective parameters on biodiesel production from feather fat oil as a cost-effective feedstock. Int. J. Env. Res. 2014, 8, 139–148. [Google Scholar]
- Alibardi, L.; Holthaus, K.B.; Sukseree, S.; Hermann, M.; Tschachler, E.; Eckhart, L. Immunolocalization of a Histidine-Rich Epidermal Differentiation Protein in the Chicken Supports the Hypothesis of an Evolutionary Developmental Link between the Embryonic Subperiderm and Feather Barbs and Barbules. PLoS ONE 2016, 11, e0167789. [Google Scholar] [CrossRef]
- Lim, X.; Nusse, R. Wnt Signaling in Skin Development, Homeostasis, and Disease. Cold Spring Harb. Perspect. Biol. 2013, 5, a008029. [Google Scholar] [CrossRef]
- Lin, J.; Yue, Z. Coupling of apical-basal polarity and planar cell polarity to interpret the Wnt signaling gradient in feather development. Development 2018, 145, 162792. [Google Scholar] [CrossRef]
- Qiu, M.; Yang, C.; Du, H.; Li, Q.; Zhang, Z.; Xiong, X.; Jiang, X. Whole-genome resequencing reveals aberrant autosomal SNPs affect chicken feathering rate. Anim. Biotechnol. 2020, 1–13. [Google Scholar] [CrossRef]
- Hao, C.; Smallwood, P.M.; Williams, J.; Nathans, J. The spatio-temporal domains of Frizzled6 action in planar polarity control of hair follicle orientation. Dev. Biol. 2016, 409, 181–193. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.Y.L.; Yang, H.; Shi, G.Q.; Shen, M.; Yang, J.Q.; Yang, Y.L.; Liu, X.J. Expression profile analysis of microRNAs during hair follicle development in the sheep foetus. Biosci. Biotechnol. Biochem. 2019, 83, 1045–1061. [Google Scholar] [CrossRef]
- Bai, W.L.; Dang, Y.L.; Yin, R.H.; Jiang, W.Q.; Wang, Z.Y.; Zhu, Y.B.; Wang, S.Q.; Zhao, Y.Y.; Deng, L.; Luo, G.B.; et al. Differential expression of microRNAs and their regulatory networks in skin tissue of Liaoning cashmere goat during hair follicle cycles. Anim. Biotechnol. 2016, 27, 104–112. [Google Scholar] [CrossRef]
- Zhang, L.; Nie, Q.; Su, Y.; Xie, X.; Luo, W.; Jia, X.; Zhang, X. MicroRNA profile analysis on duck feather follicle and skin with high-throughput sequencing technology. Gene 2013, 519, 77–81. [Google Scholar] [CrossRef]
- Chen, Z.; Zhang, N.; Chu, H.Y.; Yu, Y.; Zhang, Z.K.; Zhang, G.; Zhang, B.T. Connective Tissue Growth Factor: From Molecular Understandings to Drug Discovery. Front. Cell Dev. Biol. 2020, 8, 593269. [Google Scholar] [CrossRef]
- Abreu, J.G.; Ketpura, N.I.; Reversade, B.; De Robertis, E.M. Connective-tissue growth factor (CTGF) modulates cell signaling by BMP and TGF. Nat. Cell Biol. 2002, 4, 599–604. [Google Scholar] [CrossRef]
- Mou, C.; Jackson, B.; Schneider, P.; Overbeek, P.A.; Headon, D.J. Generation of the primary hair follicle pattern. Proc. Natl. Acad. Sci. USA 2006, 103, 9075–9080. [Google Scholar] [CrossRef]
- Holtz, A.M.; Peterson, K.A.; Nishi, Y.; Morin, S.; Song, J.Y.; Charron, F.; McMahon, A.P.; Allen, B.L. Essential role for ligand-dependent feedback antagonism of vertebrate hedgehog signaling by PTCH1, PTCH2 and HHIP1 during neural patterning. Development 2013, 140, 3423–3434. [Google Scholar] [CrossRef]
- Ingham, P.W.; Nystedt, S.; Nakano, Y.; Brown, W.; Stark, D.; van den Heuvel, M.; Taylor, A.M. Patched represses the Hedgehog signalling pathway by promoting modification of the Smoothened protein. Curr. Biol. 2000, 10, 1315–1318. [Google Scholar] [CrossRef]
- McKinnell, I.W.; Turmaine, M.; Patel, K. Sonic Hedgehog functions by localizing the region of proliferation in early developing feather buds. Dev. Biol. 2004, 272, 76–88. [Google Scholar] [CrossRef]
- Richard, V., II; Kyle, J.V.; Clifford, J.T. Ptc1 and Ptc2 Transcripts Provide Distinct Readouts of Hedgehog Signaling Activity during Chick Embryogenesis. Dev. Biol. 2001, 239, 15–29. [Google Scholar] [CrossRef]
- Abe, Y.; Tanaka, N. Roles of the hedgehog signaling pathway in epidermal and hair follicle development, homeostasis, and cancer. J. Dev. Biol. 2017, 5, 12. [Google Scholar] [CrossRef]
- Yuan, X.; Guo, Q.; Hao, B.H.; Jiang, Y.; Zhang, Y.; Liang, W.; Wang, Z.; Xu, Q.; Chang, G.; Chen, G. Identification of key genes and pathways associated with duck (Anas platyrhynchos) embryonic skin development using weighted gene co-expression network analysis. Genome 2020, 63, 615–628. [Google Scholar] [CrossRef]
- Han, W.; Li, X.; Wang, L.; Wang, H.; Yang, K.; Wang, Z.; Li, J. Expression of fox-related genes in the skin follicles of Inner Mongolia cashmere goat. Asian Australas. J. Anim. Sci. 2018, 31, 316–326. [Google Scholar] [CrossRef]
- Maranke, I.K.; Dennis, R.R. Mechanisms regulating epithelial stratification. Annu. Rev. Cell Dev. Biol. 2007, 23, 93–113. [Google Scholar]
- Kitamura, T.; Kitamura, Y.I.; Funahashi, Y.; Shawber, C.J.; Castrillon, D.H.; Kollipara, R.; DePinho, R.A.; Kitajewski, J.; Accili, D. Foxo/Notch pathway controls myogenic differentiation and fiber type specification. J. Clin. Investig. 2007, 117, 2477–2485. [Google Scholar] [CrossRef]
- Kim, J.; Choi, H.; Cho, E.G.; Lee, T.R. FoxO3a is an antimelanogenic factor that mediates antioxidant-induced depigmentation. J. Investig. Dermatol. 2014, 134, 1378–1388. [Google Scholar] [CrossRef] [PubMed]
- Stefanetti, R.J.; Voisin, S.; Russell, A.; Lamon, S. Recent advances in understanding the role of FOXO3. F1000Research 2018, 7, 1372. [Google Scholar] [CrossRef] [PubMed]








| Gene | Primer Sequence | Application |
|---|---|---|
| let-7-y | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGAAG | RT-PCR |
| F: CGCGCGCTATACAGTCTACTGT | qPCR | |
| miR-103-y | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCATAG | RT-PCR |
| F: GCGAGCAGCATTGTACAGGG | qPCR | |
| miR-107-z | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCATAG | RT-PCR |
| F: GCGAGCAGCATTGTACAGGG | qPCR | |
| miR-181-y | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGTACA | RT-PCR |
| F: GCGACCATCGACCGTTGAT | qPCR | |
| miR-183-x | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGTGA | RT-PCR |
| F: CGCGTATGGCACTGGTAGAAT | qPCR | |
| U6 | F: CTCGCTTCGGCAGCACATATACTA R: CGAATTTGCGTGTCATCCTTGC | qPCR |
| 18S rRNA | F: GCATGGCCGTTCTTAGTTGG R: GAACGCCACTTGTCCCTCTA | qPCR |
| GAPDH | F: CGTGTGGTGGACTTGATGGT R: AAGGGAACAGAACTGGCCTC | qPCR |
| FOXO3 | F: ATCACGAAGTCTGGGGCTTG R: ACGAGGGCGAATTTTAGGCA | qPCR |
| CTGF | F: AGCGTGAAGACCTACAGAGC R: CATGATCTCCCCATCAGGGC | qPCR |
| PTCH1 | F: CCTGTGCCTCAGTTTCTCGT R: TGCACTTACCTGGCACCTTT | qPCR |
| NDRG1 | F: ACTCGCCTCCTACCAGACTT R: ACCGCAAAGTGCTGAGTGAT | qPCR |
| FGFBP1 | F: CAGCAAGTTCTGGTGCGAGT R: GAGGATGCTTCTGGGGTCCT | qPCR |
| TPRS1 | F: GCCTTATGAAGTCAATGCTGG R: ACATGCGTGCAAAGTTCCTC | qPCR |
| MFAP5 | F: TGTGGCTGCATGTGATTTACC R: GTCTTCATCGTGTTGCCCTC | qPCR |
| Target Gene | Sequence |
|---|---|
| CTGF | TCCTTGGGCTCGTCACAGACCCACTCCTCG |
| PTCH1 | GGTCGCAGCCCTTCCCTCACTTCCCGTTTG |
| FOXO3 | CAGCATGGGAGAAAGCGGAGCGTCATCGTC |
| miR-144-y | AGAGTACATCATCTATACTGTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mabrouk, I.; Zhou, Y.; Wang, S.; Song, Y.; Fu, X.; Xu, X.; Liu, T.; Wang, Y.; Feng, Z.; Fu, J.; et al. Transcriptional Characteristics Showed That miR-144-y/FOXO3 Participates in Embryonic Skin and Feather Follicle Development in Zhedong White Goose. Animals 2022, 12, 2099. https://doi.org/10.3390/ani12162099
Mabrouk I, Zhou Y, Wang S, Song Y, Fu X, Xu X, Liu T, Wang Y, Feng Z, Fu J, et al. Transcriptional Characteristics Showed That miR-144-y/FOXO3 Participates in Embryonic Skin and Feather Follicle Development in Zhedong White Goose. Animals. 2022; 12(16):2099. https://doi.org/10.3390/ani12162099
Chicago/Turabian StyleMabrouk, Ichraf, Yuxuan Zhou, Sihui Wang, Yupu Song, Xianou Fu, Xiaohui Xu, Tuoya Liu, Yudong Wang, Ziqiang Feng, Jinhong Fu, and et al. 2022. "Transcriptional Characteristics Showed That miR-144-y/FOXO3 Participates in Embryonic Skin and Feather Follicle Development in Zhedong White Goose" Animals 12, no. 16: 2099. https://doi.org/10.3390/ani12162099
APA StyleMabrouk, I., Zhou, Y., Wang, S., Song, Y., Fu, X., Xu, X., Liu, T., Wang, Y., Feng, Z., Fu, J., Ma, J., Zhuang, F., Cao, H., Jin, H., Wang, J., & Sun, Y. (2022). Transcriptional Characteristics Showed That miR-144-y/FOXO3 Participates in Embryonic Skin and Feather Follicle Development in Zhedong White Goose. Animals, 12(16), 2099. https://doi.org/10.3390/ani12162099

