Effects of Polymeric Media-Coated Gynosaponin on Microbial Abundance, Rumen Fermentation Properties and Methanogenesis in Xinjiang Goats
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Goat Trials
2.2. Analytical Procedures
2.2.1. Feed Intake and Methane Measurement
2.2.2. Sample Collection and Chemical Analyses
2.2.3. Protozoa Counting, total DNA Extraction and Real-Time Quantitative PCR
2.3. Statistical Analysis
3. Results and Discussion
3.1. Effects on Feed Intake and Methane Emission
3.2. Effects on Fermentation Properties
3.3. Effects on Rumen Microbial Population
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Baral, K.R.; Jégo, G.; Amon, B.; Bol, R.; Chantigny, M.H.; Olesen, J.E.; Petersen, S.O. Greenhouse gas emissions during storage of manure and digestates: Key role of methane for prediction and mitigation. Agric. Syst. 2018, 166, 26–35. [Google Scholar] [CrossRef]
- Eldesouky, A.; Mesias, F.J.; Elghannam, A.; Escribano, M. Can extensification compensate livestock greenhouse gas emissions? A study of the carbon footprint in Spanish agroforestry systems. J. Clean. Prod. 2018, 200, 28–38. [Google Scholar] [CrossRef]
- Kebreab, E.; Clark, K.; Wagner-Riddle, C.; France, J. Methane and nitrous oxide emissions from Canadian animal agriculture: A review. Can. J. Anim. Sci. 2006, 86, 135–157. [Google Scholar] [CrossRef]
- Choi, Y.; Lee, S.J.; Kim, H.S.; Eom, J.S.; Jo, S.U.; Guan, L.L.; Lee, S.S. Effects of seaweed extracts on in vitro rumen fermentation characteristics, methane production, and microbial abundance. Sci. Rep. 2021, 11, 24092. [Google Scholar]
- Moss, A.R.; Jouany, J.P.; Newbold, J. Methane production by ruminants: Its contribution to global warming. In Annales de Zootechnie; EDP Sciences: Ulis, France, 2000; Volume 49, pp. 231–253. [Google Scholar] [CrossRef] [Green Version]
- Ahmed, E.; Yano, R.; Fujimori, M.; Kand, D.; Hanada, M.; Nishida, T.; Fukuma, N. Impacts of Mootral on methane production, rumen fermentation, and microbial community in an In Vitro study. Front. Vet. Sci. 2021, 7, 623817. [Google Scholar] [CrossRef]
- Benchaar, C.; Petit, H.V.; Berthiaume, R.; Ouellet, D.R.; Chiquette, J.; Chouinard, P.Y. Effects of essential oils on digestion, ruminal fermentation, rumen microbial populations, milk production, and milk composition in dairy cows fed alfalfa silage or corn silage. J. Dairy Sci. 2007, 90, 886–897. [Google Scholar] [CrossRef] [Green Version]
- Black, J.L.; Davison, T.M.; Box, I. Methane emissions from ruminants in Australia: Mitigation potential and applicability of mitigation strategies. Animals 2021, 11, 951. [Google Scholar] [CrossRef]
- Wang, C.J.; Wang, S.P.; Zhou, H. Influences of flavomycin, ropadiar, and saponin on nutrient digestibility, rumen fermentation, and methane emission from sheep. Anim. Feed Sci. Technol. 2009, 148, 157–166. [Google Scholar] [CrossRef]
- Benchaar, C.; Calsamiglia, S.; Chaves, A.V.; Fraser, G.R.; Colombatto, D.; McAllister, T.A.; Beauchemin, K.A. A review of plant-derived essential oils in ruminant nutrition and production. Anim. Feed Sci. Technol. 2008, 145, 209–228. [Google Scholar] [CrossRef]
- Cieslak, A.; Zmora, P.; Stochmal, A.; Pecio, L.; Oleszek, W.; Pers-Kamczyc, E.; Szumacher-Strabel, M. Rumen antimethanogenic effect of Saponaria officinalis L. phytochemicals in vitro. J. Agric. Sci. 2014, 152, 981–993. [Google Scholar]
- Singh, R.K.; Dey, A.; Paul, S.S.; Singh, M.; Dahiya, S.S.; Punia, B.S. Associative effects of plant secondary metabolites in modulating in vitro methanogenesis, volatile fatty acids production and fermentation of feed in buffalo (Bubalus bubalis). Agrofor. Syst. 2020, 94, 1555–1566. [Google Scholar]
- Ku-Vera, J.C.; Jiménez-Ocampo, R.; Valencia-Salazar, S.S.; Montoya-Flores, M.D.; Molina-Botero, I.C.; Arango, J.; Solorio-Sánchez, F.J. Role of secondary plant metabolites on enteric methane mitigation in ruminants. Front. Vet. Sci. 2020, 7, 584. [Google Scholar] [CrossRef]
- Moses, T.; Papadopoulou, K.K.; Osbourn, A. Metabolic and functional diversity of saponins, biosynthetic intermediates and semi-synthetic derivatives. Crit. Rev. Biochem. Mol. Biol. 2014, 49, 439–462. [Google Scholar]
- Nguyen, L.T.; Farcas, A.C.; Socaci, S.A.; Tofana, M.; Diaconeasa, Z.M.; Pop, O.L.; Salanta, L.C. An overview of Saponins–a bioactive group. Bull. UASVM Food Sci. Technol. 2020, 77, 25–36. [Google Scholar]
- Jaapar, M.S.; Chung, E.L.T.; Nayan, N.; Kamalludin, M.H.; Saminathan, M.; Muniandy, K.V.; Hamdan, M.H.M.; Jusoh, S.; Jesse, F.F.A. Effects of different levels of Brachiaria decumbens diets on in vitro gas production and ruminal fermentation. J. Anim. Health Prod. 2022, 10, 245–251. [Google Scholar]
- Jayanegara, A.; Wina, E.; Takahashi, J. Meta-analysis on methane mitigating properties of saponin-rich sources in the rumen: Influence of addition levels and plant sources. Asian-Australas. J. Anim. Sci. 2014, 27, 1426. [Google Scholar]
- Wei, T.; Qu, Y.; Zou, Y.; Zhang, Y.; Yu, Q. Exploration of smart antibacterial coatings for practical applications. Curr. Opin. Chem. Eng. 2021, 34, 100727. [Google Scholar] [CrossRef]
- Muñoz-Bonilla, A.; Fernández-García, M. Polymeric materials with antimicrobial activity. Prog. Polym. Sci. 2012, 37, 281–339. [Google Scholar]
- Melo, M.; Da Silva, A.; Silva Filho, E.; Oliveira, R.; Silva Junior, J.; Oliveira, J.P.; Bezerra, L. Polymeric microparticles of calcium pectinate containing urea for slow release in ruminant diet. Polymers 2021, 13, 3776. [Google Scholar]
- Mao, H.L.; Wang, J.K.; Zhou, Y.Y.; Liu, J.X. Effects of addition of tea saponins and soybean oil on methane production, fermentation and microbial population in the rumen of growing lambs. Livest. Sci. 2010, 129, 56–62. [Google Scholar] [CrossRef]
- Ramírez-Restrepo, C.A.; Tan, C.; López-Villalobos, N.; Padmanabha, J.; Wang, J.; McSweeney, C.S. Methane production, fermentation characteristics, and microbial profiles in the rumen of tropical cattle fed tea seed saponin supplementation. Anim. Feed Sci. Technol. 2016, 216, 58–67. [Google Scholar] [CrossRef] [Green Version]
- Chang, C.C.; Pai, C.L.; Chen, W.C.; Jenekhe, S.A. Spin coating of conjugated polymers for electronic and optoelectronic applications. Thin Solid Film. 2005, 479, 254–260. [Google Scholar] [CrossRef]
- Zhu, W.Y.; Kingston-Smith, A.H.; Troncoso, D.; Merry, R.J.; Davies, D.R.; Pichard, G.; Theodorou, M.K. Evidence of a role for plant proteases in the degradation of herbage proteins in the rumen of grazing cattle. J. Dairy Sci. 1999, 82, 2651–2658. [Google Scholar] [CrossRef]
- Abubakr, A.; Alimon, A.R.; Yaakub, H.; Abdullah, N.; Ivan, M. Effect of feeding palm oil by-products based diets on total bacteria, cellulolytic bacteria and methanogenic archaea in the rumen of goats. PLoS ONE 2014, 9, e95713. [Google Scholar]
- Manatbay, B.; Cheng, Y.; Mao, S.; Zhu, W. Effect of gynosaponin on rumen in vitro methanogenesis under different forage-concentrate ratios. Asian-Australas. J. Anim. Sci. 2014, 27, 1088. [Google Scholar] [CrossRef] [Green Version]
- Hu, W.L.; Liu, J.X.; Ye, J.A.; Wu, Y.M.; Guo, Y.Q. Effect of tea saponin on rumen fermentation in vitro. Anim. Feed Sci. Technol. 2005, 120, 333–339. [Google Scholar] [CrossRef]
- Denman, S.E.; Tomkins, N.W.; McSweeney, C.S. Quantitation and diversity analysis of ruminal methanogenic populations in response to the antimethanogenic compound bromochloromethane. FEMS Microbiol. Ecol. 2007, 62, 313–322. [Google Scholar] [CrossRef] [Green Version]
- Denman, S.E.; McSweeney, C.S. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol. Ecol. 2006, 58, 572–582. [Google Scholar] [CrossRef]
- Beauchemin, K.A.; Kreuzer, M.; O’mara, F.; McAllister, T.A. Nutritional management for enteric methane abatement: A review. Aust. J. Exp. Agric. 2008, 48, 21–27. [Google Scholar]
- Patra, A.K.; Saxena, J. Dietary phytochemicals as rumen modifiers: A review of the effects on microbial populations. Antonie Van Leeuwenhoek 2009, 96, 363–375. [Google Scholar]
- Klita, P.T.; Mathison, G.W.; Fenton, T.W.; Hardin, R.T. Effects of alfalfa root saponins on digestive function in sheep. J. Anim. Sci. 1996, 74, 1144–1156. [Google Scholar] [CrossRef]
- Pen, B.; Takaura, K.; Yamaguchi, S.; Asa, R.; Takahashi, J. Effects of Yucca schidigera and Quillaja saponaria with or without β 1–4 galacto-oligosaccharides on ruminal fermentation, methane production and nitrogen utilization in sheep. Anim. Feed Sci. Technol. 2007, 138, 75–88. [Google Scholar] [CrossRef]
- Hess, H.D.; Beuret, R.A.; Lötscher, M.; Hindrichsen, I.K.; Machmüller, A.; Carulla, J.E.; Kreuzer, M. Ruminal fermentation, methanogenesis and nitrogen utilization of sheep receiving tropical grass hay-concentrate diets offered with Sapindus saponaria fruits and Cratylia argentea foliage. Anim. Sci. 2004, 79, 177–189. [Google Scholar]
- Molina-Botero, I.C.; Arroyave-Jaramillo, J.; Valencia-Salazar, S.; Barahona-Rosales, R.; Aguilar-Pérez, C.F.; Burgos, A.A.; Ku-Vera, J.C. Effects of tannins and saponins contained in foliage of Gliricidia sepium and pods of Enterolobium cyclocarpum on fermentation, methane emissions and rumen microbial population in crossbred heifers. Anim. Feed Sci. Technol. 2019, 251, 1–11. [Google Scholar] [CrossRef]
- Santoso, B.; Mwenya, B.; Sar, C.; Gamo, Y.; Kobayashi, T.; Morikawa, R.; Takahashi, J. Effects of supplementing galacto-oligosaccharides, Yucca schidigera or nisin on rumen methanogenesis, nitrogen and energy metabolism in sheep. Livest. Prod. Sci. 2004, 91, 209–217. [Google Scholar] [CrossRef]
- Mansour, A.T.; Fayed, W.M.; Elkhayat, B.K.; Omar, E.A.; Zaki, M.A.; Nour, A.A.M.; Morshedy, S.A. Extract Dietary Supplementation Affects Growth Performance, Hematological and Physiological Status of European Seabass. Ann. Anim. Sci. 2021, 21, 1043–1060. [Google Scholar]
- Yuan, Z.P.; Zhang, C.M.; Zhou, L.; Zou, C.X.; Guo, Y.Q.; Li, W.T.; Wu, Y.M. Inhibition of methanogenesis by tea saponin and tea saponin plus disodium fumarate in sheep. J. Anim. Feed Sci. 2007, 16, 560–565. [Google Scholar]
- Guo, Y.Q.; Liu, J.X.; Lu, Y.; Zhu, W.Y.; Denman, S.E.; McSweeney, C.S. Effect of tea saponin on methanogenesis, microbial community structure and expression of mcrA gene, in cultures of rumen micro-organisms. Lett. Appl. Microbiol. 2008, 47, 421–426. [Google Scholar] [CrossRef]
- Xu, M.; Rinker, M.; McLeod, K.R.; Harmon, D.L. Yucca schidigera extract decreases in vitro methane production in a variety of forages and diets. Anim. Feed Sci. Technol. 2010, 159, 18–26. [Google Scholar] [CrossRef]
- Wang, Y.; McAllister, T.A.; Yanke, L.J.; Cheeke, P.R. Effect of steroidal saponin from Yucca schidigera extract on ruminal microbes. J. Appl. Microbiol. 2000, 88, 887–896. [Google Scholar] [CrossRef]
- Pen, B.; Sar, C.; Mwenya, B.; Takahashi, J. Effects of Quillaja saponaria extract alone or in combination with Yucca schidigera extract on ruminal fermentation and methanogenesis in vitro. Anim. Sci. J. 2008, 79, 193–199. [Google Scholar] [CrossRef]
- Kozłowska, M.; Cieślak, A.; Jóźwik, A.; El-Sherbiny, M.; Stochmal, A.; Oleszek, W.; Szumacher-Strabel, M. The effect of total and individual alfalfa saponins on rumen methane production. J. Sci. Food Agric. 2020, 100, 1922–1930. [Google Scholar] [CrossRef]
- Holtshausen, L.; Chaves, A.V.; Beauchemin, K.A.; McGinn, S.M.; McAllister, T.A.; Odongo, N.E.; Benchaar, C. Feeding saponin-containing Yucca schidigera and Quillaja saponaria to decrease enteric methane production in dairy cows. J. Dairy Sci. 2009, 92, 2809–2821. [Google Scholar] [CrossRef]
- Hess, H.D.; Monsalve, L.M.; Lascano, C.E.; Carulla, J.E.; Diaz, T.E.; Kreuzer, M. Supplementation of a tropical grass diet with forage legumes and Sapindus saponaria fruits: Effects on in vitro ruminal nitrogen turnover and methanogenesis. Aust. J. Agric. Res. 2003, 54, 703–713. [Google Scholar]
- Kamada, N.; Chen, G.Y.; Inohara, N.; Núñez, G. Control of pathogens and pathobionts by the gut microbiota. Nat. Immunol. 2013, 14, 685–690. [Google Scholar] [CrossRef]
- Chen, J.; Weimer, W. Competition among three predominant ruminal cellulolytic bacteria in the absence or presence of non-cellulolytic bacteria. Microbiol 2001, 147, 21–30. [Google Scholar]
- Wang, Y.; McAllister, T.A.; Yanke, L.J.; Cheeke, P.R.; Cheng, K.-J. Effect of steroidal saponins from Yucca schidigera extract on the growth of ruminal bacteria. In Proceedings of the 24th Bienn Conf on Rumen Function, Chicago, IL, USA, 1997; p. 24. [Google Scholar]
- Wina, E.; Muetzel, S.; Hoffmann, E.; Makkar, H.P.S.; Becker, K. Saponins containing methanol extract of Sapindus rarak affect microbial fermentation, microbial activity and microbial community structure in vitro. Anim. Feed Sci. Technol. 2005, 121, 159–174. [Google Scholar] [CrossRef]
- Patra, A.K.; Kamra, D.N.; Agarwal, N. Effects of extracts of spices on rumen methanogenesis, enzyme activities and fermentation of feeds in vitro. J. Sci. Food Agric. 2010, 90, 511–520. [Google Scholar] [CrossRef]
- Supapong, C.; Cherdthong, A.; Seankamsorn, A.; Khonkhaeng, B.; Wanapat, M.; Uriyapongson, S.; Polyorach, S. In vitro fermentation, digestibility and methane production as influenced by Delonix regia seed meal containing tannins and saponins. J. Anim. Feed Sci. 2017, 26, 123–130. [Google Scholar] [CrossRef]
- del Hierro, J.N.; Herrera, T.; Fornari, T.; Reglero, G.; Martin, D. The gastrointestinal behavior of saponins and its significance for their bioavailability and bioactivities. J. Funct. Foods 2018, 40, 484–497. [Google Scholar] [CrossRef]
- Busquet, M.; Calsamiglia, S.; Ferret, A.; Carro, M.D.; Kamel, C. Effect of garlic oil and four of its compounds on rumen microbial fermentation. J. Dairy Sci. 2005, 88, 4393–4404. [Google Scholar] [CrossRef] [Green Version]
- Miller, T.L. Ecology of methane production and hydrogen sinks in the rumen. In Proceedings of the Society of Nutrition Physiology; DLG: Frankfurt, Germany, 1994. [Google Scholar]
- Bhatta, R.; Uyeno, Y.; Tajima, K.; Takenaka, A.; Yabumoto, Y.; Nonaka, I.; Kurihara, M. Difference in the nature of tannins on in vitro ruminal methane and volatile fatty acid production and on methanogenic archaea and protozoal populations. J. Dairy Sci. 2009, 92, 5512–5522. [Google Scholar] [CrossRef] [Green Version]
- Wanapat, M.; Cherdthong, A. Use of real-time PCR technique in studying rumen cellulolytic bacteria population as affected by level of roughage in swamp buffalo. Curr. Microbiol. 2009, 58, 294–299. [Google Scholar]
- Wright, A.D.G.; Ma, X.; Obispo, N.E. Methanobrevibacter phylotypes are the dominant methanogens in sheep from Venezuela. Microb. Ecol. 2008, 56, 390–394. [Google Scholar]
- Finlay, B.J.; Esteban, G.; Clarke, K.J.; Williams, A.G.; Embley, T.M.; Hirt, R.P. Some rumen ciliates have endosymbiotic methanogens. FEMS Microbiol. Lett. 1994, 117, 157–161. [Google Scholar] [CrossRef]
- Wang, X.F.; Mao, S.Y.; Liu, J.H.; Zhang, L.L.; Cheng, Y.F.; Jin, W.; Zhu, W.Y. Effect of the gynosaponin on methane production and microbe numbers in a fungus-methanogen co-culture. J Anim Feed Sci 2011, 20, 272–284. [Google Scholar] [CrossRef]
- Goel, G.; Makkar, H.P.S.; Becker, K. Changes in microbial community structure, methanogenesis and rumen fermentation in response to saponin-rich fractions from different plant materials. J. Appl. Microbiol. 2008, 105, 770–777. [Google Scholar] [CrossRef]
- Jadhav, R.V.; Kannan, A.; Bhar, R.; Sharma, O.P.; Gulati, A.; Rajkumar, K.; Verma, M.R. Effect of tea (Camellia sinensis) seed saponins on in vitro rumen fermentation, methane production and true digestibility at different forage to concentrate ratios. J. Appl. Anim. Res. 2018, 46, 118–124. [Google Scholar] [CrossRef] [Green Version]
- Muetzel, S. Supplementation of barley straw with Sesbania pachycarpa leaves in vitro: Effects on fermentation variables and rumen microbial population structure quantified by ribosomal RNA-targeted probes. Br. J. Nutr. 2003, 89, 445–453. [Google Scholar]
- Beauchemin, K.A.; McGinn, S.M.; Martinez, T.F.; McAllister, T.A. Use of condensed tannin extract from quebracho trees to reduce methane emissions from cattle. J. Anim. Sci. 2007, 85, 1990–1996. [Google Scholar] [CrossRef] [Green Version]
- Bodas, R.; López, S.; Fernandez, M.; García-González, R.; Rodríguez, A.B.; Wallace, R.J.; González, J.S. In vitro screening of the potential of numerous plant species as antimethanogenic feed additives for ruminants. Anim. Feed Sci. Technol. 2008, 145, 245–258. [Google Scholar] [CrossRef]
- Hristov, A.N.; McAllister, T.A.; Van Herk, F.H.; Cheng, K.J.; Newbold, C.J.; Cheeke, P.R. Effect of Yucca schidigera on ruminal fermentation and nutrient digestion in heifers. J. Anim. Sci. 1999, 77, 2554–2563. [Google Scholar] [CrossRef]
- Morgavi, D.P.; Jouany, J.P.; Martin, C. Changes in methane emission and rumen fermentation parameters induced by refaunation in sheep. Aust. J. Exp. Agric. 2008, 48, 69–72. [Google Scholar]
- Goel, G.; Makkar, H.P.; Becker, K. Effects of Sesbania sesban and Carduus pycnocephalus leaves and Fenugreek (Trigonella foenum-graecum L.) seeds and their extracts on partitioning of nutrients from roughage-and concentrate-based feeds to methane. Anim. Feed Sci. Technol. 2008, 147, 72–89. [Google Scholar] [CrossRef]
- Valdez, F.R.; Bush, L.J.; Goetsch, A.L.; Owens, F.N. Effect of steroidal sapogenins on ruminal fermentation and on production of lactating dairy cows. J. Dairy Sci. 1986, 69, 1568–1575. [Google Scholar] [CrossRef]

| Ingredient | Content |
|---|---|
| Alfalfa | 555 |
| Corn | 271 |
| Wheat bran | 89 |
| Soybean meal | 71 |
| Ca2HPO4 | 6 |
| Mineral Premix * | 8 |
| Nutritional level | |
| Dry matter | 962 |
| Organic matter | 842 |
| Neutral detergent fiber | 434 |
| Acid detergent fiber | 259 |
| Crude protein | 172 |
| Calcium | 5.8 |
| Phosphorus | 3.3 |
| Target Species | Forward/Reverse | Primer Sequence | Amplicon |
|---|---|---|---|
| Methanogens b | F | TTCGGTGGATCDCARAGRGC | 140 |
| R | GBARGTCGWAWCCGTAGAATCC | ||
| Total bacteria a | F | CGGCAACGAGCGCAACCC | 130 |
| R | CCATTGTAGCACGTGTGTAGCC | ||
| Total fungi a R. flavefaciens b F. succinogenes b | F R F R F R | GAGGAAGTAAAAGTCGTAACAAGGTTTC CAAATTCACAAAGGGTAGGATGATT CGAACGGAGATAATTTGAGTTTACTTAGG CGGTCTCTGTATGTTATGAGGTATTACC GTTCGGAATTACTGGGCGTAAA CGCCTGCCCCTGAACTATC | 120 132 121 |
| Item | Phase | Treatment | p-Value | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | SEM | Control | PMCG | SEM | P | T | P × T | |
| Dry matter intake (g/day) | 678 | 680.5 | 683.5 | 687.5 | 6.7 | 683 | 681.7 | 7.01 | 0.05 | 0.55 | 0.96 |
| Methane (g/kg DMI) | 23.95 | 23.95 | 24.85 | 24.80 | 0.28 | 24.8 | 23.9 | 0.37 | 0.02 | 0.01 | 0.41 |
| Item * | Phase | Treatment | p-Value | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | SEM | Control | PMCG | SEM | P | T | P × T | |
| pH value | 6.29 | 6.27 | 6.33 | 6.36 | 0.03 | 6.32 | 6.31 | 0.01 | <0.01 | 0.77 | 0.63 |
| MCP (mg/mL) | 1.03 | 1.01 | 1.02 | 0.89 | 0.02 | 0.98 | 0.99 | 0.03 | <0.01 | 0.40 | 0.03 |
| NH3-N (mM) | 7.93 | 7.96 | 7.84 | 7.76 | 0.27 | 8.01 | 7.74 | 0.16 | 0.27 | 0.05 | 0.42 |
| VFA proportion (mM) | |||||||||||
| Acetate | 72.01 | 72.00 | 71.67 | 72.86 | 0.56 | 72.57 | 71.75 | 0.78 | <0.01 | 0.01 | 0.25 |
| Propionate | 17.34 | 17.48 | 17.38 | 16.89 | 0.25 | 16.93 | 17.83 | 0.22 | 0.01 | 0.15 | 0.85 |
| Butyrate | 7.10 | 7.02 | 7.59 | 7.66 | 0.16 | 7.28 | 7.44 | 0.10 | <0.01 | 0.19 | 0.45 |
| Valeric acid | 0.41 | 0.44 | 0.47 | 0.44 | 0.01 | 0.44 | 0.45 | 0.01 | <0.01 | 0.17 | 0.70 |
| Isobutyrate | 2.01 | 2.26 | 1.57 | 1.14 | 0.04 | 1.81 | 1.65 | 0.09 | <0.01 | 0.04 | 0.88 |
| Isovaleric | 1.10 | 0.77 | 1.19 | 0.99 | 0.05 | 0.99 | 1.03 | 0.04 | <0.01 | 0.47 | 0.63 |
| TVFA (mM concentration) | 62.51 | 63.08 | 67.30 | 67.60 | 0.07 | 66.03 | 64.22 | 0.96 | <0.01 | 0.01 | 0.47 |
| A/P ratio | 4.12 | 4.16 | 4.18 | 4.36 | 0.05 | 4.33 | 4.08 | 0.07 | 0.01 | <0.01 | 0.11 |
| Item | Phase | Treatment | p-Value | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | SEM | Control | PMCG | SEM | P | T | P × T | |
| Methanogens × 108 (copies/mL) | 1.82 | 1.84 | 2.34 | 2.22 | 0.46 | 2.25 | 1.85 | 0.39 | 0.61 | 0.21 | 0.95 |
| Protozoa × 105 (counts/mL) | 3.96 | 4.01 | 4.77 | 4.47 | 0.19 | 4.49 | 4.11 | 0.28 | 0.01 | 0.08 | 0.68 |
| Fungi × 106 (copies/mL) | 2.63 | 2.19 | 1.27 | 1.71 | 0.60 | 1.77 | 2.13 | 0.43 | 0.07 | 0.27 | 1.00 |
| Bacteria × 1010 (copies/mL) | 6.52 | 6.62 | 7.02 | 7.50 | 0.79 | 7.29 | 6.54 | 1.14 | 0.78 | 0.46 | 0.99 |
| R. Flavefaciens × 108 (copies/mL) | 2.90 | 2.94 | 2.78 | 2.41 | 0.49 | 2.71 | 2.81 | 0.56 | 0.93 | 0.88 | 1.00 |
| S. Succinogens × 108 (copies/mL) | 2.22 | 2.08 | 2.49 | 3.00 | 0.50 | 2.57 | 2.32 | 0.43 | 0.28 | 0.37 | 1.00 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, P.; Mehmood, I.M.; Chen, W. Effects of Polymeric Media-Coated Gynosaponin on Microbial Abundance, Rumen Fermentation Properties and Methanogenesis in Xinjiang Goats. Animals 2022, 12, 2035. https://doi.org/10.3390/ani12162035
Li P, Mehmood IM, Chen W. Effects of Polymeric Media-Coated Gynosaponin on Microbial Abundance, Rumen Fermentation Properties and Methanogenesis in Xinjiang Goats. Animals. 2022; 12(16):2035. https://doi.org/10.3390/ani12162035
Chicago/Turabian StyleLi, Peng, Irum Mohd Mehmood, and Wei Chen. 2022. "Effects of Polymeric Media-Coated Gynosaponin on Microbial Abundance, Rumen Fermentation Properties and Methanogenesis in Xinjiang Goats" Animals 12, no. 16: 2035. https://doi.org/10.3390/ani12162035
APA StyleLi, P., Mehmood, I. M., & Chen, W. (2022). Effects of Polymeric Media-Coated Gynosaponin on Microbial Abundance, Rumen Fermentation Properties and Methanogenesis in Xinjiang Goats. Animals, 12(16), 2035. https://doi.org/10.3390/ani12162035
