Prevalence and Genetic Diversity of Trueperella pyogenes Isolated from Infections in European Bison (Bison bonasus)
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Material Collection
2.2. T. pyogenes Isolation and Identification
2.3. Genomic DNA Isolation
2.4. Detection of Virulence Genes
2.5. RAPD-PCR Typing of T. pyogenes Strains
2.6. Statistical Analysis
3. Results
3.1. Prevalence of T. pyogenes Infections in European Bison
3.2. T. pyogenes Strains
3.3. Virulence Genes
3.4. RAPD Profiles and Relationships of T. pyogenes Strains
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Plumb, G.; Kowalczyk, R.; Hernandez-Blanco, J.A. Bison bonasus. The IUCN Red List of Threatened Species. 2020: e.T2814A45156279. 2020. Available online: https://doi.org/10.2305/IUCN.UK.2020-3.RLTS.T2814A45156279.en (accessed on 9 May 2022).
- Raczyński, J.; Bołbot, M. European Bison Pedigree Book 2021; Białowieża National Park: Białowieża, Poland, 2022. [Google Scholar]
- Druet, T.; Oleński, K.; Flori, L.; Bertrand, A.R.; Olech, W.; Tokarska, M.; Kaminski, S.; Gautier, M. Genomic Footprints of Recovery in the European Bison. J. Hered. 2020, 111, 194–203. [Google Scholar] [CrossRef] [PubMed]
- Olech, W.; Perzanowski, K. (Eds.) European Bison (Bison bonasus) Strategic Species Status Review 2020. IUCN SSC Bison Specialist Group and European Bison Specialist Group. 2022. Available online: https://www.iucn.org/commissions/ssc-groups/mammals/mammals-a-e/bison (accessed on 9 May 2022).
- Karbowiak, G.; Demiaszkiewicz, A.W.; Pyziel, A.M.; Wita, I.; Moskwa, B.; Werszko, J.; Bień, J.; Goździk, K.; Lachowicz, J.; Cabaj, W. The parasitic fauna of the European bison (Bison bonasus) (Linnaeus, 1758) and their impact on the conservation. Part 1. The summarising list of parasites noted. Acta Parasitol. 2014, 59, 363–371. [Google Scholar] [CrossRef] [PubMed]
- Larska, M.; Krzysiak, M.K. Infectious Disease Monitoring of European Bison (Bison bonasus). In Wildlife Population Monitoring; IntechOpen: London, UK, 2019; Available online: https://www.intechopen.com/chapters/65529 (accessed on 9 May 2022).
- Krzysiak, M.K.; Demiaszkiwicz, A.W.; Larska, M.; Tomana, J.; Anusz, K. Parasitological Monitoring of European Bison (Bison Bonasus) from Three Forests of North-eastern Poland between 2014 and 2016. J. Vet. Res. 2020, 64, 103–110. [Google Scholar] [CrossRef] [PubMed]
- Didkowska, A.; Klich, D.; Hapanowicz, A.; Orłowska, B.; Gałązka, M.; Rzewuska, M.; Olech, W.; Anusz, K. Pathogens with potential impact on reproduction in captive and free-ranging European bison (Bison bonasus) in Poland—A serological survey. BMC Vet. Res. 2021, 17, 345. [Google Scholar] [CrossRef]
- Didkowska, A.; Orłowska, B.; Krajewska-Wędzina, M.; Augustynowicz-Kopeć, E.; Brzezińska, S.; Żygowska, M.; Wiśniewski, J.; Kaczor, S.; Welz, M.; Olech, W.; et al. Microbiological and molecular monitoring for bovine tuberculosis in the Polish population of European bison (Bison bonasus). Ann. Agric. Environ. Med. 2021, 28, 575–578. [Google Scholar] [CrossRef]
- Didkowska, A.; Ptak, M.; Opałczyńska, K.; Wojciechowska, M.; Olech, W.; Anusz, K. A Serological Survey of Paratuberculosis in the Polish European Bison (Bison bonasus) Population in 2018–2021. Animals 2021, 11, 2094. [Google Scholar] [CrossRef]
- Krzysiak, M.K.; Puchalska, M.; Olech, W.; Anusz, K. A Freedom of Coxiella burnetii Infection Survey in European Bison (Bison bonasus) in Poland. Animals 2021, 11, 651. [Google Scholar] [CrossRef]
- Hoby, S.; Jensen, T.K.; Brodard, I.; Gurtner, C.; Eicher, R.; Steiner, A.; Kuhnert, P.; Alsaaod, M. Detection of treponemes in digital dermatitis lesions of captive European bison (Bison bonasus). PLoS ONE 2021, 16, e0255921. [Google Scholar] [CrossRef]
- Kędrak-Jabłońska, A.; Budniak, S.; Szczawińska, A.; Reksa, M.; Krupa, M.; Krzysiak, M.; Szulowski, K. Isolation and identification of Pasteurella multocida from European bison in Poland. Postępy Mikrobiol. 2017, 56, 69–70. [Google Scholar]
- Adaszek, L.; Dzięgiel, B.; Krzysiak, M.; Skrzypczak, M.; Adaszek, M.; Staniec, M.; Wyłupek, D.; Winiarczyk, S. Detection of Borrelia burgdorferi sensu lato DNA in the blood of wild bison from Białowieza primeval forest in eastern Poland. Pol. J. Vet. Sci. 2014, 17, 713–715. [Google Scholar] [CrossRef]
- Lehnen, A.; Busse, H.J.; Frölich, K.; Krasinska, M.; Kämpfer, P.; Speck, S. Arcanobacterium bialowiezense sp. nov. and Arcanobacterium bonasi sp. nov., isolated from the prepuce of European bison bulls (Bison bonasus) suffering from balanoposthitis, and emended description of the genus Arcanobacterium Collins et al. 1983. Int. J. Syst. Evol. Microbiol. 2006, 56, 861–866. [Google Scholar] [CrossRef]
- Rzewuska, M.; Stefańska, I.; Osińska, B.; Kizerwetter-Świda, M.; Chrobak, D.; Kaba, J.; Bielecki, W. Phenotypic characteristics and virulence genotypes of Trueperella (Arcanobacterium) pyogenes strains isolated from European bison (Bison bonasus). Vet. Microbiol. 2012, 160, 69–76. [Google Scholar] [CrossRef] [PubMed]
- Silva, E.; Gaivão, M.; Leitão, S.; Jost, B.H.; Carneiro, C.; Vilela, C.L.; Lopes da Costa, L.; Mateus, L. Genomic characterization of Arcanobacterium pyogenes isolates recovered from the uterus of dairy cows with normal puerperium or clinical metritis. Vet. Microbiol. 2008, 132, 111–118. [Google Scholar] [CrossRef] [PubMed]
- Zastempowska, E.; Lassa, H. Genotypic characterization and evaluation of an antibiotic resistance of Trueperella pyogenes (Arcanobacterium pyogenes) isolated from milk of dairy cows with clinical mastitis. Vet. Microbiol. 2012, 161, 153–158. [Google Scholar] [CrossRef] [PubMed]
- Rzewuska, M.; Czopowicz, M.; Gawryś, M.; Markowska-Daniel, I.; Bielecki, W. Relationships between antimicrobial resistance, distribution of virulence factor genes and the origin of Trueperella pyogenes isolated from domestic animals and European bison (Bison bonasus). Microb. Pathog. 2016, 96, 35–41. [Google Scholar] [CrossRef]
- Galán-Relaño, Á.; Gómez-Gascón, L.; Luque, I.; Barrero-Domínguez, B.; Casamayor, A.; Cardoso-Toset, F.; Vela, A.I.; Fernández-Garayzábal, J.F.; Tarradas, C. Antimicrobial susceptibility and genetic characterization of Trueperella pyogenes isolates from pigs reared under intensive and extensive farming practices. Vet. Microbiol. 2019, 232, 89–95. [Google Scholar] [CrossRef]
- Zhao, K.; Tian, Y.; Yue, B.; Wang, H.; Zhang, X. Virulence determinants and biofilm production among Trueperella pyogenes recovered from abscesses of captive forest musk deer. Arch. Microbiol. 2013, 195, 203–209. [Google Scholar] [CrossRef]
- Nagib, S.; Glaeser, S.P.; Eisenberg, T.; Sammra, O.; Lämmler, C.; Kämpfer, P.; Schauerte, N.; Geiger, C.; Kaim, U.; Prenger-Berninghoff, E.; et al. Fatal infection in three Grey Slender Lorises (Loris lydekkerianus nordicus) caused by clonally related Trueperella pyogenes. BMC Vet. Res. 2017, 13, 273. [Google Scholar] [CrossRef]
- Cardoso-Toset, F.; Gómez-Laguna, J.; Gómez-Gascón, L.; Rodríguez-Gómez, I.M.; Galán-Relaño, A.; Carrasco, L.; Tarradas, C.; Vela, A.I.; Luque, I. Histopathological and microbiological study of porcine lymphadenitis: Contributions to diagnosis and control of the disease. Porc. Health Manag. 2020, 6, 36. [Google Scholar] [CrossRef]
- Ashrafi Tamai, I.; Mohammadzadeh, A.; Zahraei Salehi, T.; Mahmoodi, P.; Pakbin, B. Investigation of antimicrobial susceptibility and virulence factor genes in Trueperella pyogenes isolated from clinical mastitis cases of dairy cows. Food Sci. Nutr. 2021, 9, 4529–4538. [Google Scholar] [CrossRef]
- Stefańska, I.; Kwiecień, E.; Górzyńska, M.; Sałamaszyńska-Guz, A.; Rzewuska, M. RAPD-PCR-Based Fingerprinting Method as a Tool for Epidemiological Analysis of Trueperella pyogenes Infections. Pathogens 2022, 11, 562. [Google Scholar] [CrossRef] [PubMed]
- Hunter, P.R.; Gaston, M.A. Numerical index of the discriminatory ability of typing systems: An application of Simpson’s index of diversity. J. Clin. Microbiol. 1988, 26, 2465–2466. [Google Scholar] [CrossRef] [PubMed]
- Olech, W.; Klich, D.; Perzanowski, K. Development of a new Action Plan for the European bison. Oryx 2019, 53, 214. [Google Scholar] [CrossRef]
- Belser, E.H.; Cohen, B.S.; Keeler, S.P.; Killmaster, C.H.; Bowers, J.W.; Miller, K.V. Epethelial presence of Trueperella pyogenes predicts site-level presence of cranial abscess disease in white-tailed deer (Odocoileus virginianus). PLoS ONE 2015, 10, e0120028. [Google Scholar] [CrossRef]
- Krzysiak, M.K.; Dackiewicz, J.; Kęsik-Maliszewska, J.; Larska, M. Post-Mortem Evaluation of Pathological Lesions in European Bison (Bison Bonasus) in the Białowieża Primeval Forest between 2008 and 2013. J. Vet. Res. 2014, 58, 421–431. [Google Scholar] [CrossRef]
- Piusiński, W.; Malicka, E.; Bielecki, W.; Osińska, B.; Lenartowicz-Kubrat, Z. Pathomorphological lesions in bison in the Białowieża forest. Med. Wet. 1996, 52, 386–388. [Google Scholar]
- Rzewuska, M.; Osińska, B.; Bielecki, W.; Skrzypczak, M.; Stefańska, I.; Binek, M. Microflora of urogenital tract in European bison (Bison bonasus). In Health Threats for the European Bison Particularly in Free-Roaming Populations in Poland; Kita, J., Anusz, K., Eds.; Warsaw University of Life Sciences: Warsaw, Poland, 2006; pp. 27–28. [Google Scholar]
- Paiano, R.B.; Bonilla, J.; Moreno, A.M.; Baruselli, P.S. Clinical endometritis with Trueperella pyogenes reduces reproductive performance and milk production in dairy cows. Reprod. Domest. Anim. 2021, 56, 1536–1542. [Google Scholar] [CrossRef]
- Lavín, S.; Ruiz-Bascarán, M.; Marco, I.; Abarca, M.L.; Crespo, M.J.; Franch, J. Foot infections associated with Arcanobacterium pyogenes in free-living fallow deer (Dama dama). J. Wildl. Dis. 2004, 40, 607–611. [Google Scholar] [CrossRef][Green Version]
- Jost, B.H.; Billington, S.J. Arcanobacterium pyogenes: Molecular pathogenesis of an animal opportunist. Antonie Van Leeuwenhoek 2005, 88, 87–102. [Google Scholar] [CrossRef]
- Wickhorst, J.P.; Hassan, A.A.; Sheet, O.H.; Eisenberg, T.; Sammra, O.; Alssahen, M.; Lämmler, C.; Prenger-Berninghoff, E.; Zschöck, M.; Timke, M.; et al. Trueperella pyogenes isolated from a brain abscess of an adult roebuck (Capreolus capreolus). Folia Microbiol. 2018, 63, 17–22. [Google Scholar] [CrossRef]
- Rzewuska, M.; Kwiecień, E.; Chrobak-Chmiel, D.; Kizerwetter-Świda, M.; Stefańska, I.; Gieryńska, M. Pathogenicity and Virulence of Trueperella pyogenes: A Review. Int. J. Mol. Sci. 2019, 20, 2737. [Google Scholar] [CrossRef] [PubMed]
- Nagaraja, T.G.; Lechtenberg, K.F. Liver abscesses in feedlot cattle. Vet. Clin. N. Am. Food Anim. Pract. 2007, 23, 351–369. [Google Scholar] [CrossRef] [PubMed]
- Krasińska, M.; Krasiński, Z.A. European Bison—The Nature Monograph; Mammal Research Institute, Polish Academy of Sciences: Białowieża, Poland, 2007; pp. 141–191. [Google Scholar]
- Rzewuska, M.; Rodo, A.; Bielecki, W. Dermacentor reticulatus ticks as possible vectors of Trueperella pyogenes infection in European bison (Bison bonasus): Preliminary studies. J. Comp. Pathol. 2016, 154, 120. [Google Scholar] [CrossRef]
- Kwiecień, E.; Stefańska, I.; Chrobak-Chmiel, D.; Sałamaszyńska-Guz, A.; Rzewuska, M. New Determinants of Aminoglycoside Resistance and Their Association with the Class 1 Integron Gene Cassettes in Trueperella pyogenes. Int. J. Mol. Sci. 2020, 21, 4230. [Google Scholar] [CrossRef]
- Kwiecień, E.; Stefańska, I.; Chrobak-Chmiel, D.; Kizerwetter-Świda, M.; Moroz, A.; Olech, W.; Spinu, M.; Binek, M.; Rzewuska, M. Trueperella pyogenes Isolates from Livestock and European Bison (Bison bonasus) as a Reservoir of Tetracycline Resistance Determinants. Antibiotics 2021, 10, 380. [Google Scholar] [CrossRef]
- Risseti, R.M.; Zastempowska, E.; Twarużek, M.; Lassa, H.; Pantoja, J.C.F.; de Vargas, A.P.C.; Guerra, S.T.; Bolaños, C.A.D.; de Paula, C.L.; Alves, A.C.; et al. Virulence markers associated with Trueperella pyogenes infections in livestock and companion animals. Lett. Appl. Microbiol. 2017, 65, 125–132. [Google Scholar] [CrossRef]
- Rogovskyy, A.S.; Lawhon, S.; Kuczmanski, K.; Gillis, D.C.; Wu, J.; Hurley, H.; Rogovska, Y.V.; Konganti, K.; Yang, C.Y.; Duncan, K. Phenotypic and genotypic characteristics of Trueperella pyogenes isolated from ruminants. J. Vet. Diagn. Investig. 2018, 30, 348–353. [Google Scholar] [CrossRef]
- Cohen, B.S.; Belser, E.H.; Keeler, S.P.; Yabsley, M.J.; Miller, K.V. Isolation and genotypic characterization of Trueperella (Arcanobacterium) pyogenes recovered from active cranial abscess infections of male white-tailed deer (Odocoileus virginianus). J. Zoo Wildl. Med. 2015, 46, 62–67. [Google Scholar] [CrossRef]
- Cohen, B.S.; Belser, E.H.; Keeler, S.P.; Yabsley, M.J.; Miller, K.V. A headache from our past? Intracranial abscess disease, virulence factors of Trueperella pyogenes, and a legacy of translocating white-tailed deer (Odocoileus virginianus). J. Wildl. Dis. 2018, 54, 671–679. [Google Scholar] [CrossRef]
Target Gene | Primer Sequence (5′–3′) | Annealing Temperature (°C) * | Amplicon Size (bp) |
---|---|---|---|
plo | F–TCATCAACAATCCCACGAAGAG R–TTGCCTCCAGTTGACGCTTT | 60 | 150 |
nanH | F–CGCTAGTGCTGTAGCGTTGTTAAGT R–CCGAGGAGTTTTGACTGACTTTGT | 60 | 781 |
nanP | F–TTGAGCGTACGCAGCTCTTC R–CCACGAAATCGGCCTTATTG | 60 | 150 |
cbpA | F–GCAGGGTTGGTGAAAGAGTTTACT R–GCTTGATATAACCTTCAGAATTTGCA | 60 | 124 |
fimA | F–CACTACGCTCACCATTCACAAG R–GCTGTAATCCGCTTTGTCTGTG | 57 | 605 |
fimC | F–TGTCGAAGGTGACGTTCTTCG R–CAAGGTCACCGAGACTGCTGG | 60 | 843 |
fimE | F–GCCCAGGACCGAGAGCGAGGGC R–GCCTTCACAAATAACAGCAACC | 55 | 775 |
fimG | F–ACGCTTCAGAAGGTCACCAGG R–ATCTTGATCTGCCCCCATGCG | 57 | 929 |
Strain Designation | Sex of Bison | Location | Type of Infection | Virulence Genotype |
---|---|---|---|---|
1/2011 | Male | Białowieska Primeval Forest | balanoposthitis | plo/fimA/fimE |
2/2011 | Female | Białowieska Primeval Forest | abscess of umbilical region | plo/nanP/fimA/fimC/fimE |
3/2011 | Male | Białowieska Primeval Forest | balanoposthitis | plo/fimA/fimC/fimE |
4/2012 | Male | Białowieska Primeval Forest | abscesses of neck and forearm | plo/nanH/fimA |
5/2012 | Male | Białowieska Primeval Forest | purulent lesions of trachea | plo/cbpA/fimA/fimC/fimE/fimG |
6/2012 | Male | Pszczyna | purulent lesions of lungs | plo/nanH/nanP/fimA/fimC/fimE |
7/2012 | Female | Białowieska Primeval Forest | purulent lesions of trachea | plo/fimA/fimE |
8/2012 | Male | Białowieska Primeval Forest | purulent lesions of lungs | plo/cbpA/fimA/fimC/fimE/fimG |
9/2012 | Female | Białowieska Primeval Forest | purulent lesions of vagina | plo/cbpA/fimA/fimC/fimE/fimG |
10/2013 | Male | Białowieska Primeval Forest | balanoposthitis | plo/nanH/fimA/fimC/fimE/fimG |
11/2013 | Female | Białowieska Primeval Forest | vagina without clinical lesions | plo |
12/2013 | Female | Białowieska Primeval Forest | abscess of hoof | plo/fimA |
13/2013 | Male | Białowieska Primeval Forest | balanoposthitis | plo/fimA/fimE |
14/2013 | Male | Białowieska Primeval Forest | balanoposthitis | plo/fimA/fimE |
15/2014 | Male | Białowieska Primeval Forest | purulent lesions of groin skin | plo/fimA/fimE |
16/2014 | Male | Białowieska Primeval Forest | balanoposthitis | plo/nanH/fimA/fimC/fimE/fimG |
17/2014 | Male | Białowieska Primeval Forest | balanoposthitis | plo/fimA/fimC/fimE |
18/2018 | Female | Knyszyńska Forest | purulent discharge from uterus | plo/fimA/fimE |
19/2018 | Female | Knyszyńska Forest | purulent discharge from vagina | plo/fimA/fimE |
20/2018 | Female | Knyszyńska Forest | discharge from vagina | plo/fimA/fimE |
21/2018 | Female | Knyszyńska Forest | discharge from nose | plo/fimA/fimC/fimE |
22/2018 | Female | Borecka Forest | purulent lesions of vagina | plo/fimA/fimE |
23/2018 | Female | Knyszyńska Forest | purulent lesions of vagina | plo/fimA/fimC/fimE |
24/2018 | Male | Knyszyńska Forest | balanoposthitis | plo/nanH/fimA/fimC/fimE |
25/2018 | Female | Pszczyna | purulent lesions of vagina | plo/nanP/fimA/fimC/fimE/fimG |
26/2018 * | Male | Ustroń | discharge from nose | plo/nanH/nanP/fimA/fimC/fimE |
27/2018 * | Male | Ustroń | balanoposthitis | plo/nanH/nanP/fimA/fimC/fimE |
28/2019 | Male | Białowieska Primeval Forest | balanoposthitis | plo/fimA/fimC/fimE |
29/2019 | Male | Bieszczady Mountains (Muczne) | balanoposthitis | plo/nanH/nanP/fimA/fimC/fimE |
30/2019 | Male | Bieszczady Mountains (Muczne) | balanoposthitis | plo/nanH/nanP/fimA/fimC/fimE |
31/2019 | Male | Bieszczady Mountains (Muczne) | balanoposthitis | plo/nanH/nanP/fimA/fimC/fimE |
32/2019 | Female | Białowieska Primeval Forest | lung abscess | plo/fimA/fimC/fimE |
33/2020 ** | Female | Białowieska Primeval Forest | discharge from nose | plo/fimA/fimC/fimE |
34/2020 ** | Female | Białowieska Primeval Forest | lung abscess | plo/fimA/fimC/fimE |
35/2020 | Female | Białowieska Primeval Forest | purulent lesions of vagina | plo/fimA/fimC/fimE |
36/2020 | Female | Białowieska Primeval Forest | discharge from nose | plo/fimA/fimC/fimE |
37/2020 | Female | Białowieska Primeval Forest | purulent lesions of vagina | plo/fimA/fimC/fimE |
38/2021 | Female | Białowieska Primeval Forest | lung abscess | plo/fimA/fimC/fimE |
39/2021 | Female | Knyszyńska Forest | lung abscess | plo/nanP/fimA/fimC/fimE |
Virulence Gene | n (%) of T. pyogenes Strains Isolated From * | |||
---|---|---|---|---|
Balanoposthitis | Lesions in the Respiratory System | Lesions in the Reproductive System in Cow | Other Lesions | |
plo | 13 (100) | 12 (100) | 9 (100) | 4 (100) |
nanH | 7 (53.8) ** | 2 (16.7) | 0 (0) *** | 1 (25) |
nanP | 4 (30.8) | 3 (25) | 1 (9) | 1 (25) |
cbpA | 0 (0) | 2 (16.7) | 1 (9) | 0 (0) |
fimA | 13 (100) | 12 (100) | 9 (100) | 4 (100) |
fimC | 10 (76.9) | 11 (91.7) **** | 5 (55.6) | 1 (25) |
fimE | 13 (100) | 12 (100) | 9 (100) | 2 (50) |
fimG | 2 (15.4) | 2 (16.7) | 2 (22.2) | 0 (0) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kwiecień, E.; Stefańska, I.; Kizerwetter-Świda, M.; Chrobak-Chmiel, D.; Didkowska, A.; Bielecki, W.; Olech, W.; Anusz, K.; Rzewuska, M. Prevalence and Genetic Diversity of Trueperella pyogenes Isolated from Infections in European Bison (Bison bonasus). Animals 2022, 12, 1825. https://doi.org/10.3390/ani12141825
Kwiecień E, Stefańska I, Kizerwetter-Świda M, Chrobak-Chmiel D, Didkowska A, Bielecki W, Olech W, Anusz K, Rzewuska M. Prevalence and Genetic Diversity of Trueperella pyogenes Isolated from Infections in European Bison (Bison bonasus). Animals. 2022; 12(14):1825. https://doi.org/10.3390/ani12141825
Chicago/Turabian StyleKwiecień, Ewelina, Ilona Stefańska, Magdalena Kizerwetter-Świda, Dorota Chrobak-Chmiel, Anna Didkowska, Wojciech Bielecki, Wanda Olech, Krzysztof Anusz, and Magdalena Rzewuska. 2022. "Prevalence and Genetic Diversity of Trueperella pyogenes Isolated from Infections in European Bison (Bison bonasus)" Animals 12, no. 14: 1825. https://doi.org/10.3390/ani12141825
APA StyleKwiecień, E., Stefańska, I., Kizerwetter-Świda, M., Chrobak-Chmiel, D., Didkowska, A., Bielecki, W., Olech, W., Anusz, K., & Rzewuska, M. (2022). Prevalence and Genetic Diversity of Trueperella pyogenes Isolated from Infections in European Bison (Bison bonasus). Animals, 12(14), 1825. https://doi.org/10.3390/ani12141825