Sex Identification of Feather Color in Geese and the Expression of Melanin in Embryonic Dorsal Skin Feather Follicles
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Sampling
2.2. Experiment Methods
2.2.1. Gender Identification of Whole Blood
2.2.2. Preparation of Paraffin Sections
2.2.3. HE Staining
2.2.4. Silver Staining with Masson-Fontana
2.2.5. Nile Blue Staining
2.2.6. Total RNA Extraction, Reverse Transcription, and Quantitative PCR
2.2.7. Primer DESIGN
2.2.8. Enzyme-Linked Immunosorbent Assay (ELISA)
2.2.9. Protein Extraction and Protein Degeneration
2.2.10. Western Blotting Analysis
2.3. Feather Follicles Morphology and Structure Observation
2.4. Statistical Analysis
2.5. Ethics Statement
3. Results
3.1. Microvolume Whole Blood PCR for Sex Determination
3.2. Dorsal Skin Feather Follicle Development and Melanin Distribution in Feather Follicles during Embryonic Period
3.2.1. Visual Observation of Dorsal Skin Feather Development of Geese Embryos
3.2.2. Histological Structure of Feather Follicles at Different Stages
3.3. Melanin Content in Embryonic Dorsal Skin Feather Follicles of Holdobaggy Geese
3.4. The mRNA Expression Levels of ASIP and TYRP1 Genes in the Embryonic Holdobaggy Geese Skin Feather Follicles
3.5. Protein Expression Levels of TYRP1 in the Embryonic Dorsal Skin Feather Follicles of Holdobaggy Geese
3.6. The Sex Differences in Postnatal Dorsal Coat Coloration in Holdobaggy Geese
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Li, H.F.; Zhu, W.Q.; Chen, K.W.; Xu, W.J.; Song, W. Two maternal origins of Chinese domestic goose. Poult. Sci. 2011, 90, 2705–2710. [Google Scholar] [CrossRef] [PubMed]
- Romanov, M.N.; Weigend, S. Analysis of genetic relationships between various populations of domestic and jungle fowl using microsatellite markers. Poult. Sci. 2001, 80, 1057–1063. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.W.; Wang, J.W.; Zeng, F.T.; Qiu, X.P. Mitochondrial DNA cleavage patterns distinguish independent origin of Chinese domestic geese and Western domestic geese. Biochem. Genet. 2006, 44, 237–245. [Google Scholar] [CrossRef] [PubMed]
- Brameld, J.M.; Parr, T. Improving efficiency in meat production. Proc. Nutr. Soc. 2016, 75, 242–246. [Google Scholar] [CrossRef] [PubMed]
- Harz, M.; Krause, M.; Bartels, T.; Cramer, K.; Rösch, P.; Popp, J. Minimal invasive gender determination of birds by means of UV-resonance Raman spectroscopy. Anal. Chem. 2008, 80, 1080–1086. [Google Scholar] [CrossRef] [PubMed]
- D’Alba, L.; Kieffer, L.; Shawkey, M.D. Relative contributions of pigments and biophotonic nanostructures to natural color production: A case study in budgerigar (Melopsittacus undulatus) feathers. J. Exp. Biol. 2012, 215, 1272–1277. [Google Scholar] [CrossRef]
- Ito, S.; Wakamatsu, K. Quantitative analysis of eumelanin and pheomelanin in humans, mice, and other animals: A comparative review. Pigment Cell Res. 2003, 16, 523–531. [Google Scholar] [CrossRef]
- Cappai, M.G.; Lunesu, M.G.A.; Accioni, F.; Liscia, M.; Pusceddu, M.; Burrai, L.; Nieddu, M.; Dimauro, C.; Boatto, G.; Pinna, W. Blood serum retinol levels in Asinara white donkeys reflect albinism-induced metabolic adaptation to photoperiod at Mediterranean latitudes. Ecol. Evol. 2017, 7, 390–398. [Google Scholar] [CrossRef]
- Galván, I.; Solano, F. Bird Integumentary Melanins: Biosynthesis, Forms, Function and Evolution. Int. J. Mol. Sci. 2016, 17, 520. [Google Scholar] [CrossRef]
- D’Mello, S.A.N.; Finlay, G.J.; Baguley, B.C.; Askarian-Amiri, M.E. Signaling Pathways in Melanogenesis. Int. J. Mol. Sci. 2016, 17, 1144. [Google Scholar] [CrossRef]
- Yang, L.; Mo, C.; Shen, W.; Du, X.; Akbar Bhuiyan, A.; Li, L.; Li, N.; Gong, Y.; Li, S. The recessive C locus in the MITF gene plays a key regulatory role in the plumage colour pattern of duck (Anas platyrhynchos). Br. Poult. Sci. 2019, 60, 105–108. [Google Scholar] [CrossRef] [PubMed]
- Hu, S.; Zhai, P.; Chen, Y.; Zhao, B.; Yang, N.; Wang, M.; Xiao, Y.; Bao, G.; Wu, X. Morphological Characterization and Gene Expression Patterns for Melanin Pigmentation in Rex Rabbit. Biochem. Genet. 2019, 57, 734–744. [Google Scholar] [CrossRef]
- Plonka, P.M.; Handjiski, B.; Michalczyk, D.; Popik, M.; Paus, R. Oral zinc sulphate causes murine hair hypopigmentation and is a potent inhibitor of eumelanogenesis in vivo. Br. J. Dermatol. 2006, 155, 39–49. [Google Scholar] [CrossRef] [PubMed]
- Nadeau, N.J.; Mundy, N.I.; Gourichon, D.; Minvielle, F. Association of a single-nucleotide substitution in TYRP1 with roux in Japanese quail (Coturnix japonica). Anim. Genet. 2007, 38, 609–613. [Google Scholar] [CrossRef]
- Manga, P.; Sato, K.; Ye, L.; Beermann, F.; Lamoreux, M.L.; Orlow, S.J. Mutational analysis of the modulation of tyrosinase by tyrosinase-related proteins 1 and 2 in vitro. Pigment Cell Res. 2000, 13, 364–374. [Google Scholar] [CrossRef]
- Wu, H.; Park, H.-Y. Protein kinase C-beta-mediated complex formation between tyrosinase and TRP-1. Biochem. Biophys. Res. Commun. 2003, 311, 948–953. [Google Scholar] [CrossRef] [PubMed]
- Feng, P.; Zeng, T.; Yang, H.; Chen, G.; Du, J.; Chen, L.; Shen, J.; Tao, Z.; Wang, P.; Yang, L.; et al. Whole-genome resequencing provides insights into the population structure and domestication signatures of ducks in eastern China. BMC Genom. 2021, 22, 401. [Google Scholar] [CrossRef]
- Gratten, J.; Beraldi, D.; Lowder, B.V.; McRae, A.F.; Visscher, P.M.; Pemberton, J.M.; Slate, J. Compelling evidence that a single nucleotide substitution in TYRP1 is responsible for coat-colour polymorphism in a free-living population of Soay sheep. Proc. Biol. Sci. 2007, 274, 619–626. [Google Scholar]
- Xu, Y.; Zhang, X.-H.; Pang, Y.-Z. Association of Tyrosinase (TYR) and Tyrosinase-related Protein 1 (TYRP1) with Melanic Plumage Color in Korean Quails (Coturnix coturnix). Asian-Australas J. Anim. Sci. 2013, 26, 1518–1522. [Google Scholar] [CrossRef]
- Ko, J.M.; Yang, J.-A.; Jeong, S.-Y.; Kim, H.-J. Mutation spectrum of the TYR and SLC45A2 genes in patients with oculocutaneous albinism. Mol. Med. Rep. 2012, 5, 943–948. [Google Scholar] [CrossRef]
- Li, S.; Wang, C.; Yu, W.; Zhao, S.; Gong, Y. Identification of genes related to white and black plumage formation by RNA-Seq from white and black feather bulbs in ducks. PLoS ONE 2012, 7, e36592. [Google Scholar] [CrossRef] [PubMed]
- Mohideen, A.K.S.; Arun, A. Bioinformatics Analysis of the Melanocortin 1 Receptor Gene (MC1R) in the Southern Platyfish Xiphophorus maculatus (Günther, 1866). Int. J. Bioautomation 2020, 24, 235–244. [Google Scholar] [CrossRef]
- Lin, S.J.; Foley, J.; Jiang, T.X.; Yeh, C.Y.; Wu, P.; Foley, A.; Yen, C.M.; Huang, Y.C.; Cheng, H.C.; Chen, C.F.; et al. Topology of feather melanocyte progenitor niche allows complex pigment patterns to emerge. Science 2013, 340, 1442–1445. [Google Scholar] [CrossRef] [PubMed]
- Su, R.; Fu, S.; Zhang, Y.; Wang, R.; Zhou, Y.; Li, J.; Zhang, W. Comparative genomic approach reveals novel conserved microRNAs in Inner Mongolia cashmere goat skin and longissimus dorsi. Mol. Biol. Rep. 2015, 42, 989–995. [Google Scholar] [CrossRef] [PubMed]
- Sviridov, S.M.; Malup, T.K.; Podoplelova, M.L. Genetic-biochemical analysis of the shuttle box behavior of 2 inbred strains of mice differing in their brain protein S-100 content. II. Genes determining the animals coat color and their learning. Genetika 1980, 16, 1652–1659. [Google Scholar]
- Roulin, A.; Ducrest, A.-L. Genetics of colouration in birds. Semin. Cell Dev. Biol. 2013, 24, 594–608. [Google Scholar] [CrossRef] [PubMed]
- Hiragaki, T.; Inoue-Murayama, M.; Miwa, M.; Fujiwara, A.; Mizutani, M.; Minvielle, F.; Ito, S.i. Recessive black is allelic to the yellow plumage locus in Japanese quail and associated with a frameshift deletion in the ASIP gene. Genetics 2008, 178, 771–775. [Google Scholar] [CrossRef]
- Zhang, X.H.; Pang, Y.Z.; Zhao, S.J.; Xu, H.W.; Li, Y.L.; Xu, Y.; Guo, Z.; Wang, D.D. The relationship of plumage colours with MC1R (Melanocortin 1 Receptor) and ASIP (Agouti Signaling Protein) in Japanese quail (Coturnix coturnix japonica). Br. Poult. Sci. 2013, 54, 306–311. [Google Scholar] [CrossRef]
- Klovins, J.; Schiöth, H.B. Agouti-related proteins (AGRPs) and agouti-signaling peptide (ASIP) in fish and chicken. Ann. N. Y. Acad. Sci. 2005, 1040, 363–367. [Google Scholar] [CrossRef]
- Abolins-Abols, M.; Kornobis, E.; Ribeca, P.; Wakamatsu, K.; Peterson, M.P.; Ketterson, E.D.; Milá, B. Differential gene regulation underlies variation in melanic plumage coloration in the dark-eyed junco (Junco hyemalis). Mol. Ecol. 2018, 27, 4501–4515. [Google Scholar] [CrossRef]
- Pearl, R.; Surface, F.M. Further data regarding the sex-limited inheritance of the barred color pattern in poultry. Science 1910, 32, 870–874. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Lin, R.L.; Chen, H.P.; Rouvier, R.; Poivey, J.P. Selection and crossbreeding in relation to plumage color inheritance in three chinese egg type duck breeds (anas platyrhynchos). Asian-Australas J. Anim. Sci. 2014, 27, 1069–1074. [Google Scholar] [CrossRef] [PubMed]
- Lauber, J.K. Sex-linked albinism in the Japanese quail. Science 1964, 146, 948–950. [Google Scholar] [CrossRef] [PubMed]








| Try, the Agent | Body, Product |
|---|---|
| 2× San Taq PCR Mix | 25 μL |
| Forward Primer | 2 μL |
| Reverse Primer | 2 μL |
| whole blood | 1 μL |
| ddH2O | Up to 50 μL |
| Gene Name | Primer Sequences (5′–3′) |
|---|---|
| CHD1 | F: GGTGGCTTAATGAGGTAGCA R: AGGATGGAAATGAGTGCA |
| ASIP | F: GCCAAATTAGCAGCACTTCC R: TTGCCACATTGCCATTCTTGG |
| TYRP1 | F: CGGCAATACAACATGGTGCC R: AAGCTTTCAGGGAGGAAGACA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, X.; Wang, S.; Feng, Z.; Song, Y.; Zhou, Y.; Mabrouk, I.; Cao, H.; Hu, X.; Li, H.; Sun, Y. Sex Identification of Feather Color in Geese and the Expression of Melanin in Embryonic Dorsal Skin Feather Follicles. Animals 2022, 12, 1427. https://doi.org/10.3390/ani12111427
Xu X, Wang S, Feng Z, Song Y, Zhou Y, Mabrouk I, Cao H, Hu X, Li H, Sun Y. Sex Identification of Feather Color in Geese and the Expression of Melanin in Embryonic Dorsal Skin Feather Follicles. Animals. 2022; 12(11):1427. https://doi.org/10.3390/ani12111427
Chicago/Turabian StyleXu, Xiaohui, Sihui Wang, Ziqiang Feng, Yupu Song, Yuxuan Zhou, Ichraf Mabrouk, Heng Cao, Xiangman Hu, Haojia Li, and Yongfeng Sun. 2022. "Sex Identification of Feather Color in Geese and the Expression of Melanin in Embryonic Dorsal Skin Feather Follicles" Animals 12, no. 11: 1427. https://doi.org/10.3390/ani12111427
APA StyleXu, X., Wang, S., Feng, Z., Song, Y., Zhou, Y., Mabrouk, I., Cao, H., Hu, X., Li, H., & Sun, Y. (2022). Sex Identification of Feather Color in Geese and the Expression of Melanin in Embryonic Dorsal Skin Feather Follicles. Animals, 12(11), 1427. https://doi.org/10.3390/ani12111427
