Multi-Thoracolumbar Variations and NR6A1 Gene Polymorphisms Potentially Associated with Body Size and Carcass Traits of Dezhou Donkey
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Moral Statement
2.2. Animal and Data Collection
2.3. DNA Extraction
2.4. PCR Amplification and Sequencing
2.5. Statistical Analysis
3. Results
3.1. Variation in Vertebral Number of Dezhou Donkey
3.2. Effect of Vertebral Number on Body Size
3.3. Genetic Polymorphism of NR6A1 Gene in Dezhou Donkey
3.4. Association Analysis of Donkey Body Size Traits and Single Loci Polymorphisms
3.5. Association Analysis of Donkey Body Size Traits and Haplotypes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Polidori, P.; Pucciarelli, S.; Ariani, A.; Polzonetti, V.; Vincenzetti, S. A comparison of the carcass and meat quality of Martina Franca donkey foals aged 8 or 12 months. Meat Sci. 2015, 106, 6–10. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Li, H.; Guo, Y.; Huang, J.; Sun, Y.; Min, J.; Wang, J.; Fang, X.; Zhao, Z.; Wang, S.; et al. Donkey genomes provide new insights into domestication and selection for coat color. Nat. Commun. 2020, 11, 6014. [Google Scholar] [CrossRef] [PubMed]
- Denham, T.; Iriarte, J.; Vrydaghs, L. Rethinking Agriculture: Archaeological and Ethnoarchaeological Perspectives. J. Anthropol. Res. 2009, 51, 378–380. [Google Scholar]
- Wellik, D.M. Hox patterning of the vertebrate axial skeleton. Dev. Dyn. 2007, 236, 2454–2463. [Google Scholar] [CrossRef] [Green Version]
- Kaiser, J.T.; Reddy, V.; Lugo-Pico, J.G. Anatomy, Head and Neck, Cervical Vertebrae. In StatPearls; StatPearls Publishing LLC.: Treasure Island, FL, USA, 2022. [Google Scholar]
- Galis, F. Why do almost all mammals have seven cervical vertebrae? Developmental constraints, Hox genes, and cancer. J. Exp. Zool. 1999, 285, 19–26. [Google Scholar]
- Faraz, A.; Tirink, C.; Eyduran, E.; Waheed, A.; Tauqir, N.A.; Nabeel, M.S.; Tariq, M.M. Prediction of live body weight based on body measurements in Thalli sheep under tropical conditions of Pakistan using cart and mars. Trop. Anim. Health Prod. 2021, 53, 301. [Google Scholar] [CrossRef]
- Fredeen, H.T.; Newman, J.A. Rib and Vertebral Numbers in Swine. Can. J. Anim. Sci. 1962, 42, 232–239. [Google Scholar] [CrossRef] [Green Version]
- Liu, Q.; Yue, J.; Niu, N.; Liu, X.; Yan, H.; Zhao, F.; Hou, X.; Gao, H.; Shi, L.; Wang, L.; et al. Genome-Wide Association Analysis Identified BMPR1A as a Novel Candidate Gene Affecting the Number of Thoracic Vertebrae in a Large White x Minzhu Intercross Pig Population. Animals 2020, 10, 2186. [Google Scholar] [CrossRef]
- Ijiri, M.; Lai, Y.C.; Kawaguchi, H.; Fujimoto, Y.; Miura, N.; Matsuo, T.; Tanimoto, A. NR6A1 Allelic Frequencies as an Index for both Miniaturizing and Increasing Pig Body Size. In Vivo 2021, 35, 163–167. [Google Scholar] [CrossRef]
- Li, C.; Li, M.; Li, X.; Ni, W.; Xu, Y.; Yao, R.; Wei, B.; Zhang, M.; Li, H.; Zhao, Y.; et al. Whole-Genome Resequencing Reveals Loci Associated With Thoracic Vertebrae Number in Sheep. Front. Genet. 2019, 10, 674. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Li, C.; Li, X.; Liu, Z.; Ni, W.; Cao, Y.; Yao, Y.; Islamov, E.; Wei, J.; Hou, X.; et al. Association analysis of polymorphism in the NR6A1 gene with the lumbar vertebrae number traits in sheep. Genes Genom. 2019, 41, 1165–1171. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Zhang, X.; Cao, Y.; Wei, J.; You, S.; Jiang, Y.; Cai, K.; Wumaier, W.; Guo, D.; Qi, J.; et al. Multi-vertebrae variation potentially contribute to carcass length and weight of Kazakh sheep. Small Rumin. Res. 2017, 150, 8–10. [Google Scholar] [CrossRef]
- Raza, S.H.A.; Khan, R.; Gui, L.; Schreurs, N.M.; Wang, X.; Mei, C.; Yang, X.; Gong, C.; Zan, L. Bioinformatics analysis and genetic polymorphisms in genomic region of the bovine SH2B2 gene and their associations with molecular breeding for body size traits in qinchuan beef cattle. Biosci. Rep. 2020, 40, BSR20192113. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- King, J.W.B.; Roberts, R.C. Carcass length in the bacon pig; its association with vertebrae numbers and prediction from radiographs of the young pig. Anim. Prod. 2010, 2, 59–65. [Google Scholar] [CrossRef]
- Stecher, R.M. Activity of Small Mammals as Recorded By a Photographic Device. J. Mammal. 1962, 43, 205–219. [Google Scholar] [CrossRef]
- Jamdar, M.N.; Ema, A.N. A Note on the Vertebral Formula of the Donkey. Br. Vet. J. 1982, 138, 209–211. [Google Scholar] [CrossRef]
- Mikawa, S.; Hayashi, T.; Nii, M.; Shimanuki, S.; Morozumi, T.; Awata, T. Two quantitative trait loci on Sus scrofa chromosomes 1 and 7 affecting the number of vertebrae. J. Anim. Sci. 2005, 83, 2247–2254. [Google Scholar] [CrossRef]
- Mikawa, S.; Morozumi, T.; Shimanuki, S.; Hayashi, T.; Uenishi, H.; Domukai, M.; Okumura, N.; Awata, T. Fine mapping of a swine quantitative trait locus for number of vertebrae and analysis of an orphan nuclear receptor, germ cell nuclear factor (NR6A1). Genome Res. 2007, 17, 586–593. [Google Scholar] [CrossRef] [Green Version]
- Mikawa, S.; Sato, S.; Nii, M.; Morozumi, T.; Yoshioka, G.; Imaeda, N.; Yamaguchi, T.; Hayashi, T.; Awata, T. Identification of a second gene associated with variation in vertebral number in domestic pigs. BMC Genet. 2011, 12, 5. [Google Scholar] [CrossRef] [Green Version]
- Yang, G.; Ren, J.; Zhang, Z.; Huang, L. Genetic evidence for the introgression of Western NR6A1 haplotype into Chinese Licha breed associated with increased vertebral number. Anim. Genet. 2009, 40, 247–250. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, M.; Yuan, J.; Zhou, X.; Xu, S.; Liu, B. Association of polymorphisms in NR6A1, PLAG1 and VRTN with the number of vertebrae in Chinese Tongcheng x Large White crossbred pigs. Anim. Genet. 2018, 49, 353–354. [Google Scholar] [CrossRef] [PubMed]
- Maeda, S.; Koya, D.; Araki, S.I.; Babazono, T.; Umezono, T.; Toyoda, M.; Kawai, K.; Imanishi, M.; Uzu, T.; Suzuki, D.; et al. Association between single nucleotide polymorphisms within genes encoding sirtuin families and diabetic nephropathy in Japanese subjects with type 2 diabetes. Clin. Exp. Nephrol. 2011, 15, 381–390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Z.; Zhan, Y.; Han, Y.; Liu, Z.; Wang, Y.; Wang, C. Estimation of Liveweight from Body Measurements through Best Fitted Regression Model in Dezhou Donkey Breed. J. Equine Vet. Sci. 2021, 101, 103457. [Google Scholar] [CrossRef] [PubMed]
- Nei, M.; Roychoudhury, A.K. Sampling variances of heterozygosity and genetic distance. Genetics 1974, 76, 379–390. [Google Scholar] [CrossRef]
- Shi, Y.Y.; He, L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res. 2005, 15, 97–98. [Google Scholar] [CrossRef]
- Barrett, J.C.; Fry, B.; Maller, J.; Daly, M.J. Haploview: Analysis and visualization of LD and haplotype maps. Bioinformatics 2005, 21, 263–265. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Cai, H.; Luo, X.; Ai, Y.; Jiang, M.; Wen, Y. Insight into unique somitogenesis of yak (Bos grunniens) with one additional thoracic vertebra. BMC Genom. 2020, 21, 201. [Google Scholar] [CrossRef] [Green Version]
- Donaldson, C.L.; Lambe, N.R.; Maltin, C.A.; Knott, S.; Bunger, L. Between- and within-breed variations of spine characteristics in sheep. J. Anim. Sci. 2013, 91, 995–1004. [Google Scholar] [CrossRef]
- Zhang, Z.; Sun, Y.; Du, W.; He, S.; Liu, M.; Tian, C. Effects of vertebral number variations on carcass traits and genotyping of Vertnin candidate gene in Kazakh sheep. Asian-Australas J. Anim. Sci. 2017, 30, 1234–1238. [Google Scholar] [CrossRef] [Green Version]
- Stecher, R.M. Anatomical Variations of The Spine in The Horse. J. Mammal. 1962, 43, 205–219. [Google Scholar] [CrossRef]
- Yang, J.; Wen, Y.; Feng, Z.; Ke, m.; Gao, X.; An, D. Variation of Thoracic and Lumbar Vertebrae of Jinchuan Yak and its Correlation with Meat Production Performance. J. Livest. Ecol. 2015, 36, 26–30. [Google Scholar]
- van den Akker, E.; Forlani, S.; Chawengsaksophak, K.; de Graaff, W.; Beck, F.; Meyer, B.I.; Deschamps, J. Cdx1 and Cdx2 have overlapping functions in anteroposterior patterning and posterior axis elongation. Development 2002, 129, 2181–2193. [Google Scholar] [CrossRef]
- van Son, M.; Lopes, M.S.; Martell, H.J.; Derks, M.F.L.; Gangsei, L.E.; Kongsro, J.; Wass, M.N.; Grindflek, E.H.; Harlizius, B. A QTL for Number of Teats Shows Breed Specific Effects on Number of Vertebrae in Pigs: Bridging the Gap Between Molecular and Quantitative Genetics. Front. Genet. 2019, 10, 272. [Google Scholar] [CrossRef]
- Fang, X.; Lai, Z.; Liu, J.; Zhang, C.; Li, S.; Wu, F.; Zhou, Z.; Lei, C.; Dang, R. A Novel 13 bp Deletion within the NR6A1 Gene Is Significantly Associated with Growth Traits in Donkeys. Animals 2019, 9, 681. [Google Scholar] [CrossRef] [Green Version]


| Primer | Target SNV Site | Primer Sequence (5′–3′) | Tm (°C) | Product Size (bp) | Location |
|---|---|---|---|---|---|
| primer 1 | g.18093100G > T | F: CACCGTTAGAACGCCACA | 60 | 853 | intron 2 |
| R: GCCTCCACTTACCACCCT | |||||
| primer 2 | g.18094587C > G | F: GCCCTCACCTTTTGAGGCAA | 61 | 725 | intron 2 |
| R: CTGCAGTTCATTCCCCAGTCA | |||||
| primer 3 | g.18106043A > C | F: GCTCCATTTCTGCCGGATCT | 62 | 448 | intron 6 |
| R: CCAGGACACATTCCAGAAAATCA | |||||
| primer 4 | g.18108764A > G | F: TAGGCTAGGGCTCCTTTGCT | 63 | 385 | intron 6 |
| R: GGGCTGAGGTTATGCACAGT | |||||
| primer 5 | g.18110615G > C | F: GGGGTGCGCAAAAACTTACA | 64 | 643 | intron 7 |
| R: AGTTCACGTGCTCTGCTTCA | |||||
| primer 6 | g.18112000T > G | F: CACACAGACCACGTGTGAGTA | 65 | 341 | intron 7 |
| R: ACATGTCACAACAGGGGACC | |||||
| primer 7 | g.18114954C > T | F: CCGATGCATTTCCTTGCAGT | 66 | 596 | intron 9 |
| R: GAGCTGGTAGGCAAGTCTCA |
| Type | N | BL | CHC | CW | TL | LL | TLL |
|---|---|---|---|---|---|---|---|
| (Mean ± SE, cm) | (Mean ± SE, cm) | (Mean ± SE, kg) | (Mean ± SE, cm) | (Mean ± SE, cm) | (Mean ± SE, cm) | ||
| 17 | 65 | 131.33 ± 0.6 | 141.74 ± 2.29 | 148.9 ± 1.71 | 68.86 ± 0.35 | 26.27 ± 0.24 | 95.13 ± 0.47 |
| 18 | 385 | 132.66 ± 0.32 | 144.66 ± 0.28 | 152.36 ± 0.86 | 73.65 ± 0.17 | 23.78 ± 0.1 | 97.43 ± 0.23 |
| 19 | 5 | 132.2 ± 3.85 | 144.4 ± 2.5 | 151.5 ± 6.26 | 75.2 ± 1.59 | 23.2 ± 0.37 | 98.4 ± 1.75 |
| Pearson correlation | 0.070 | 0.113 ** | 0.049 | 0.099 ** | −0.171 *** | 0.012 | |
| p value | 0.137 | 0.016 | 0.297 | 0.035 | 0.000 | 0.796 | |
| 5 | 361 | 132.28 ± 0.33 | 144.54 ± 0.29 | 151.89 ± 0.91 | 73.53 ± 0.18 | 23.31 ± 0.08 | 96.86 ± 0.23 |
| 6 | 94 | 133.2 ± 0.56 | 143.1 ± 1.59 | 151.74 ± 1.41 | 70.9 ± 0.39 | 27.23 ± 0.14 | 98.05 ± 0.48 |
| Pearson correlation | 0.060 | −0.068 | 0.040 | −0.024 | 0.312 *** | 0.060 | |
| p value | 0.199 | 0.148 | 0.390 | 0.603 | 0.000 | 0.200 | |
| 22 | 11 | 128.64 ± 1.44 | 141.18 ± 1.41 | 142.3 ± 3.6 | 68.55 ± 0.79 | 23.05 ± 0.38 | 91.59 ± 0.96 |
| 23 | 399 | 132.32 ± 0.31 | 144.27 ± 0.45 | 151.92 ± 0.85 | 73.03 ± 0.18 | 23.82 ± 0.1 | 96.86 ± 0.21 |
| 24 | 45 | 134.67 ± 0.92 | 144.73 ± 0.57 | 153.52 ± 1.99 | 73.65 ± 0.5 | 27.09 ± 0.31 | 100.66 ± 0.66 |
| Pearson correlation | 0.146 *** | 0.042 | 0.101 ** | 0.077 * | 0.184 *** | 0.084 * | |
| p value | 0.002 | 0.376 | 0.032 | 0.099 | 0.000 | 0.073 | |
| Position | Location | Sample | Genotype | Genotype Frequencies | Number | Allele Frequencies | HW | Genetic Parameters | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Wild | Mutant | Chi-Square | p Value | Obs-Het | Pred-Het | PIC | Ne | ||||||
| g.18093100G > T | Intron-2 | 455 | GG | 0.64 | 291 | 0.7915 | 0.2085 | 2.966 | 0.107 | 0.303 | 0.33 | 0.417 | 1.5 |
| GT | 0.303 | 138 | |||||||||||
| TT | 0.057 | 26 | |||||||||||
| g.18094587C > G | Intron-2 | 455 | CC | 0.477 | 217 | 0.688 | 0.312 | 0.118 | 0.774 | 0.422 | 0.429 | 0.495 | 1.75 |
| CG | 0.422 | 192 | |||||||||||
| GG | 0.101 | 46 | |||||||||||
| g.18106043A > C | Intron-6 | 455 | AA | 0.455 | 207 | 0.686 | 0.314 | 2.345 | 0.166 | 0.462 | 0.431 | 0.478 | 1.76 |
| AC | 0.462 | 210 | |||||||||||
| CC | 0.083 | 38 | |||||||||||
| g.18108764A > G | Intron-6 | 455 | AA | 0.358 | 163 | 0.6175 | 0.3825 | 4.465 | 0.048 | 0.519 | 0.472 | 0.506 | 1.9 |
| AG | 0.519 | 236 | |||||||||||
| GG | 0.123 | 56 | |||||||||||
| g.18110516G > C | Intron-7 | 455 | GG | 0.455 | 207 | 0.6715 | 0.3285 | 0.141 | 0.749 | 0.433 | 0.441 | 0.505 | 1.79 |
| GC | 0.433 | 197 | |||||||||||
| CC | 0.112 | 51 | |||||||||||
| g.18112000T > G | Intron-7 | 455 | TT | 0.101 | 46 | 0.6955 | 0.3045 | 0.682 | 0.444 | 0.407 | 0.423 | 0.494 | 1.74 |
| GT | 0.407 | 185 | |||||||||||
| GG | 0.492 | 224 | |||||||||||
| g.18114954C > T | downstream | 455 | CC | 0.444 | 202 | 0.3245 | 0.6755 | 1.603 | 0.264 | 0.464 | 0.438 | 0.488 | 1.78 |
| TC | 0.463 | 211 | |||||||||||
| TT | 0.093 | 42 | |||||||||||
| SNV Site | Genetype/ Number | BH | BL | CHC | SW | CW | TN | TL | STL | LN | LL | SLL | TLN | LTL | STLL |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| g.18093100G > T | GG/291 | 134.95 ± 0.31 a | 132.62 ± 0.37 | 144.44 ± 0.59 | 24.39 ± 0.23 b | 151.89 ± 0.98 | 17.87 ± 0.02 | 73.02 ± 0.22 | 4.09 ± 0.01 | 5.20 ± 0.02 | 24.14 ± 0.13 | 4.64 ± 0.02 a | 23.07 ± 0.02 | 97.17 ± 0.28 | 4.21 ± 0.01 |
| GT/138 | 134.65 ± 0.41 a | 132.65 ± 0.50 | 143.96 ± 0.44 | 25.51 ± 0.44 a | 152.88 ± 1.40 | 17.88 ± 0.03 | 73.09 ± 0.29 | 4.09 ± 0.02 | 5.22 ± 0.04 | 24.25 ± 0.17 | 4.65 ± 0.02 a | 23.09 ± 0.03 | 97.36 ± 0.35 | 4.21 ± 0.01 | |
| TT/26 | 131.77 ± 1.03 b | 129.77 ± 1.15 | 143.52 ± 0.99 | 23.82 ± 0.90 ab | 146.10 ± 2.51 | 17.85 ± 0.07 | 71.90 ± 0.67 | 4.03 ± 0.03 | 5.19 ± 0.08 | 23.38 ± 0.45 | 4.49 ± 0.05 b | 23.04 ± 0.07 | 95.10 ± 0.67 | 4.13 ± 0.03 | |
| p value | 0.011 | 0.072 | 0.789 | 0.028 | 0.171 | 0.915 | 0.299 | 0.285 | 0.925 | 0.185 | 0.032 | 0.663 | 0.065 | 0.079 | |
| g.18094587C > G | CC/217 | 134.01 ± 0.35 b | 132.06 ± 0.42 | 144.26 ± 0.35 a | 24.81 ± 0.32 | 151.45 ± 1.12 | 17.86 ± 0.02 | 72.82 ± 0.25 | 4.08 ± 0.01 | 5.19 ± 0.03 | 23.90 ± 0.13 | 4.62 ± 0.02 | 23.05 ± 0.02 | 96.70 ± 0.29 | 4.20 ± 0.01 |
| CG/192 | 135.40 ± 0.36 a | 133.05 ± 0.43 | 144.89 ± 0.40 a | 24.55 ± 0.31 | 152.78 ± 1.22 | 17.87 ± 0.03 | 73.08 ± 0.25 | 4.09 ± 0.01 | 5.23 ± 0.03 | 24.40 ± 0.17 | 4.66 ± 0.02 | 23.10 ± 0.03 | 97.51 ± 0.31 | 4.22 ± 0.01 | |
| GG/46 | 134.85 ± 0.81 ab | 131.96 ± 1.03 | 141.41 ± 3.23 b | 24.75 ± 0.52 | 149.89 ± 2.23 | 17.91 ± 0.06 | 73.29 ± 0.64 | 4.09 ± 0.03 | 5.20 ± 0.06 | 24.07 ± 0.38 | 4.62 ± 0.05 | 23.11 ± 0.06 | 97.38 ± 0.85 | 4.21 ± 0.03 | |
| p value | 0.025 | 0.222 | 0.048 | 0.836 | 0.497 | 0.647 | 0.64 | 0.701 | 0.595 | 0.071 | 0.243 | 0.233 | 0.179 | 0.414 | |
| g.18106043A > C | AA/207 | 134.15 ± 0.35 | 132.43 ± 0.43 | 144.33 ± 0.36 a | 24.83 ± 0.32 | 152.38 ± 1.15 | 17.84 ± 0.03 | 72.69 ± 0.25 | 4.07 ± 0.01 | 5.24 ± 0.03 | 24.16 ± 0.15 | 4.62 ± 0.02 | 23.08 ± 0.02 | 96.81 ± 0.29 | 4.20 ± 0.01 |
| AC/210 | 135.31 ± 0.37 | 132.65 ± 0.44 | 144.95 ± 0.39 a | 24.67 ± 0.31 | 151.48 ± 1.19 | 17.90 ± 0.02 | 73.33 ± 0.26 | 4.10 ± 0.01 | 5.16 ± 0.03 | 24.06 ± 0.15 | 4.66 ± 0.02 | 23.06 ± 0.02 | 97.42 ± 0.32 | 4.22 ± 0.01 | |
| CC/38 | 134.05 ± 0.74 | 131.71 ± 0.93 | 139.87 ± 3.83 b | 24.12 ± 0.38 | 151.21 ± 1.93 | 17.87 ± 0.07 | 72.55 ± 0.55 | 4.06 ± 0.03 | 5.26 ± 0.07 | 24.38 ± 0.44 | 4.62 ± 0.04 | 23.13 ± 0.08 | 96.98 ± 0.81 | 4.19 ± 0.03 | |
| p value | 0.052 | 0.687 | 0.003 | 0.653 | 0.829 | 0.208 | 0.155 | 0.334 | 0.089 | 0.705 | 0.264 | 0.511 | 0.377 | 0.231 | |
| g.18108764A > G | AA/163 | 133.91 ± 0.39 | 132.12 ± 0.47 | 143.74 ± 0.4 ab | 24.78 ± 0.39 | 150.93 ± 1.28 | 17.82 ± 0.03 | 72.45 ± 0.29 | 4.07 ± 0.01 | 5.25 ± 0.03 | 24.07 ± 0.17 | 4.60 ± 0.02 | 23.06 ± 0.02 | 96.48 ± 0.34 | 4.18 ± 0.01 |
| AG/236 | 135.16 ± 0.34 | 132.79 ± 0.40 | 145.11 ± 0.36 a | 24.62 ± 0.27 | 152.59 ± 1.10 | 17.90 ± 0.02 | 73.25 ± 0.22 | 4.09 ± 0.01 | 5.19 ± 0.03 | 24.17 ± 0.14 | 4.66 ± 0.02 | 23.08 ± 0.02 | 97.44 ± 0.28 | 4.22 ± 0.01 | |
| GG/56 | 134.91 ± 0.71 | 132.13 ± 0.89 | 142.04 ± 2.67 b | 24.78 ± 0.46 | 151.40 ± 2.04 | 17.89 ± 0.06 | 73.33 ± 0.58 | 4.10 ± 0.03 | 5.18 ± 0.05 | 24.13 ± 0.33 | 4.65 ± 0.04 | 23.07 ± 0.06 | 97.51 ± 0.76 | 4.23 ± 0.03 | |
| p value | 0.056 | 0.517 | 0.036 | 0.926 | 0.605 | 0.079 | 0.071 | 0.247 | 0.31 | 0.895 | 0.094 | 0.798 | 0.088 | 0.117 | |
| g.18110615G > C | GG/207 | 134.00 ± 0.36 b | 132.17 ± 0.43 | 144.16 ± 0.36 | 24.90 ± 0.33 | 151.41 ± 1.16 | 17.86 ± 0.02 | 72.75 ± 0.25 | 4.07 ± 0.01 | 5.20 ± 0.03 | 23.94 ± 0.14 | 4.61 ± 0.02 | 23.06 ± 0.02 | 96.67 ± 0.30 | 4.19 ± 0.01 |
| GC/197 | 135.41 ± 0.36 a | 132.92 ± 0.43 | 144.97 ± 0.39 | 24.51 ± 0.30 | 152.57 ± 1.20 | 17.88 ± 0.03 | 73.18 ± 0.25 | 4.09 ± 0.01 | 5.21 ± 0.03 | 24.34 ± 0.16 | 4.67 ± 0.02 | 23.09 ± 0.03 | 97.54 ± 0.32 | 4.22 ± 0.01 | |
| CC/51 | 134.59 ± 0.74 ab | 131.94 ± 0.94 | 141.77 ± 2.92 | 24.63 ± 0.49 | 150.94 ± 2.10 | 17.88 ± 0.06 | 73.10 ± 0.59 | 4.09 ± 0.03 | 5.20 ± 0.06 | 24.07 ± 0.37 | 4.62 ± 0.05 | 23.08 ± 0.06 | 97.22 ± 0.79 | 4.21 ± 0.03 | |
| p value | 0.023 | 0.39 | 0.06 | 0.67 | 0.713 | 0.788 | 0.483 | 0.511 | 0.95 | 0.189 | 0.131 | 0.619 | 0.152 | 0.248 | |
| g.18112000T > G | TT/46 | 133.11 ± 0.79 b | 131.67 ± 0.85 | 142.7 ± 0.77 | 24.19 ± 0.83 | 146.05 ± 2.52 b | 17.85 ± 0.05 | 72.5 ± 0.53 | 4.06 ± 0.03 | 5.26 ± 0.07 | 24.05 ± 0.31 | 4.59 ± 0.04 | 23.11 ± 0.05 | 96.55 ± 0.61 | 4.18 ± 0.03 |
| GT/185 | 134.54 ± 0.40 ab | 132.56 ± 0.48 | 144.51 ± 0.39 | 25.15 ± 0.34 | 153.17 ± 1.31 a | 17.89 ± 0.03 | 73.06 ± 0.27 | 4.08 ± 0.01 | 5.16 ± 0.03 | 23.92 ± 0.15 | 4.63 ± 0.02 | 23.05 ± 0.02 | 96.99 ± 0.32 | 4.21 ± 0.01 | |
| GG/224 | 135.12 ± 0.33 a | 132.55 ± 0.40 | 144.34 ± 0.73 | 24.43 ± 0.26 | 151.99 ± 1.02 a | 17.86 ± 0.03 | 73.00 ± 0.24 | 4.09 ± 0.01 | 5.23 ± 0.03 | 24.32 ± 0.16 | 4.65 ± 0.02 | 23.09 ± 0.03 | 97.32 ± 0.31 | 4.21 ± 0.01 | |
| p value | 0.050 | 0.657 | 0.431 | 0.176 | 0.033 | 0.674 | 0.641 | 0.580 | 0.140 | 0.171 | 0.397 | 0.383 | 0.518 | 0.449 | |
| g.18114954C > T | CC/202 | 134.87 ± 0.34 | 132.16 ± 0.41 | 144.38 ± 0.81 | 24.43 ± 0.28 | 151.74 ± 1.07 a | 17.87 ± 0.03 | 72.93 ± 0.25 | 4.08 ± 0.01 | 5.15 ± 0.03 b | 23.94 ± 0.14 | 4.65 ± 0.02 | 23.01 ± 0.02 b | 96.87 ± 0.30 | 4.21 ± 0.01 |
| TC/211 | 134.75 ± 0.37 | 132.91 ± 0.45 | 144.41 ± 0.36 | 25.05 ± 0.31 | 153.3 ± 1.19 a | 17.88 ± 0.02 | 73.16 ± 0.26 | 4.09 ± 0.01 | 5.26 ± 0.03 a | 24.37 ± 0.16 | 4.63 ± 0.02 | 23.14 ± 0.03 a | 97.52 ± 0.32 | 4.21 ± 0.01 | |
| TT/42 | 133.40 ± 0.84 | 131.76 ± 0.88 | 142.73 ± 0.82 | 24.23 ± 0.90 | 145.25 ± 2.70 b | 17.83 ± 0.06 | 72.33 ± 0.56 | 4.05 ± 0.03 | 5.21 ± 0.06 ab | 23.91 ± 0.31 | 4.60 ± 0.04 | 23.05 ± 0.03 ab | 96.24 ± 0.65 | 4.18 ± 0.03 | |
| p value | 0.240 | 0.348 | 0.489 | 0.277 | 0.016 | 0.783 | 0.395 | 0.411 | 0.019 | 0.113 | 0.599 | 0.001 | 0.146 | 0.461 |
| n | BH | BL | CHC | SW | CW | TN | TL | STL | LN | LL | SLL | TLN | TLL | STLL | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Hap1Hap2 | 69 | 135.25 ± 0.57 | 132.44 ± 0.70 | 145.49 ± 0.71 | 24.11 ± 0.58 | 151.90 ± 2.13 | 17.87 ± 0.04 | 73.12 ± 0.35 AB | 4.09 ± 0.02 ab | 5.14 ± 0.04 | 24.08 ± 0.28 | 4.68 ± 0.05 | 23.01 ± 0.03 | 97.20 ± 0.50 | 4.22 ± 0.02 ab |
| Hap1Hap4 | 32 | 133.38 ± 0.91 | 132.06 ± 0.91 | 143.8 ± 0.94 | 25.69 ± 0.84 | 154.64 ± 2.87 | 17.69 ± 0.08 | 71.67 ± 0.57 AB | 4.05 ± 0.03 ab | 5.34 ± 0.09 | 24.36 ± 0.43 | 4.56 ± 0.03 | 23.03 ± 0.07 | 96.03 ± 0.65 | 4.17 ± 0.02 ab |
| Hap2Hap3 | 32 | 136.28 ± 0.97 | 134.00 ± 0.98 | 145.47 ± 0.97 | 25.57 ± 0.61 | 154.60 ± 2.98 | 17.84 ± 0.08 | 73.62 ± 0.70 AB | 4.13 ± 0.03 ab | 5.19 ± 0.07 | 24.41 ± 0.34 | 4.71 ± 0.05 | 23.03 ± 0.03 | 98.16 ± 0.69 | 4.26 ± 0.03 ab |
| Hap1Hap1 | 29 | 134.69 ± 0.90 | 132.24 ± 0.95 | 146.28 ± 0.87 | 25.01 ± 0.90 | 154.94 ± 2.27 | 17.76 ± 0.08 | 71.68 ± 0.67 AB | 4.04 ± 0.03 ab | 5.24 ± 0.08 | 24.30 ± 0.36 | 4.64 ± 0.04 | 23.00 ± 0.00 | 95.98 ± 0.67 | 4.17 ± 0.03 ab |
| Hap1Hap3 | 27 | 134.07 ± 1.03 | 132.54 ± 1.63 | 143.33 ± 1.16 | 24.34 ± 0.91 | 151.67 ± 4.26 | 17.96 ± 0.04 | 73.35 ± 0.77 AB | 4.08 ± 0.04 ab | 5.11 ± 0.06 | 23.4 ± 0.35 | 4.58 ± 0.05 | 23.07 ± 0.05 | 96.75 ± 0.95 | 4.19 ± 0.04 ab |
| Hap2Hap2 | 25 | 134.16 ± 1.02 | 131.32 ± 1.11 | 137.54 ± 5.77 | 23.65 ± 0.45 | 147.96 ± 2.08 | 17.92 ± 0.08 | 72.26 ± 0.71 AB | 4.03 ± 0.04 ab | 5.20 ± 0.08 | 23.85 ± 0.47 | 4.58 ± 0.05 | 23.12 ± 0.09 | 96.15 ± 0.95 | 4.16 ± 0.04 ab |
| Hap2Hap4 | 25 | 135.60 ± 1.15 | 133.16 ± 1.34 | 144.2 ± 1.17 | 25.28 ± 1.23 | 152.37 ± 3.67 | 17.92 ± 0.06 | 73.22 ± 0.77 AB | 4.09 ± 0.04 ab | 5.16 ± 0.07 | 24.45 ± 0.5 | 4.72 ± 0.06 | 23.08 ± 0.06 | 97.77 ± 1.03 | 4.23 ± 0.04 ab |
| Hap3Hap4 | 13 | 136.42 ± 1.39 | 134.92 ± 1.39 | 144.04 ± 1.57 | 27.72 ± 2.51 | 154.05 ± 5.20 | 17.77 ± 0.12 | 75.18 ± 1.14 AB | 4.22 ± 0.05 a | 5.23 ± 0.12 | 24.64 ± 0.34 | 4.77 ± 0.10 | 23.00 ± 0.00 | 99.82 ± 1.21 | 4.34 ± 0.05 ab |
| Hap2Hap7 | 9 | 137.33 ± 2.49 | 135.00 ± 3.71 | 148.67 ± 2.43 | 25.89 ± 1.18 | 153.78 ± 8.40 | 18.00 ± 0.17 | 76.11 ± 1.87 A | 4.23 ± 0.10 a | 5.00 ± 0.00 | 23.61 ± 0.87 | 4.72 ± 0.17 | 23.00 ± 0.17 | 99.72 ± 2.53 | 4.34 ± 0.11 a |
| Hap1Hap5 | 8 | 133.75 ± 1.25 | 130.25 ± 1.72 | 144.5 ± 1.13 | 24.26 ± 0.97 | 151.75 ± 3.51 | 18.00 ± 0.00 | 73.00 ± 1.07 AB | 4.06 ± 0.06 ab | 5.00 ± 0.00 | 23.75 ± 0.49 | 4.75 ± 0.10 | 23.00 ± 0.00 | 96.75 ± 1.44 | 4.21 ± 0.06 ab |
| Hap1Hap6 | 8 | 134.31 ± 1.33 | 131.5 ± 1.88 | 144.94 ± 2.35 | 24.04 ± 0.84 | 154.06 ± 7.23 | 17.75 ± 0.16 | 71.19 ± 1.09 B | 4.01 ± 0.05 ab | 5.38 ± 0.18 | 24.56 ± 0.43 | 4.59 ± 0.09 | 23.13 ± 0.13 | 95.75 ± 0.88 | 4.14 ± 0.05 ab |
| Hap3Hap3 | 8 | 132.56 ± 1.50 | 131.00 ± 1.66 | 141.81 ± 1.31 | 22.74 ± 0.81 | 141.31 ± 5.19 | 17.75 ± 0.16 | 69.88 ± 0.99 B | 3.94 ± 0.05 b | 5.38 ± 0.18 | 24.06 ± 0.91 | 4.48 ± 0.08 | 23.13 ± 0.13 | 93.94 ± 1.21 | 4.06 ± 0.05 b |
| Hap1Hap8 | 5 | 136.00 ± 2.86 | 131.80 ± 3.20 | 147.8 ± 1.93 | 24.46 ± 1.40 | 159.7 ± 5.85 | 17.80 ± 0.20 | 74.00 ± 2.28 AB | 4.15 ± 0.09 ab | 5.00 ± 0.00 | 23.18 ± 0.34 | 4.64 ± 0.07 | 22.80 ± 0.20 | 97.18 ± 2.59 | 4.26 ± 0.08 ab |
| Hap2Hap5 | 5 | 135.20 ± 2.13 | 134.80 ± 1.59 | 141.60 ± 3.08 | 23.50 ± 0.99 | 151.30 ± 7.65 | 18.20 ± 0.20 | 74.80 ± 0.41 AB | 4.11 ± 0.03 ab | 5.00 ± 0.00 | 22.80 ± 0.37 | 4.56 ± 0.07 | 23.20 ± 0.20 | 97.60 ± 0.53 | 4.21 ± 0.04 ab |
| Hap4Hap4 | 5 | 131.60 ± 2.75 | 130.80 ± 2.56 | 140.20 ± 2.07 | 21.62 ± 1.46 | 137.80 ± 6.50 | 17.80 ± 0.20 | 71.70 ± 1.95 AB | 4.03 ± 0.07 ab | 5.20 ± 0.20 | 23.80 ± 1.15 | 4.58 ± 0.14 | 23.00 ± 0.00 | 95.50 ± 1.78 | 4.15 ± 0.08 ab |
| Hap4Hap8 | 5 | 132.80 ± 2.08 | 128.60 ± 4.21 | 143.10 ± 2.04 | 24.28 ± 1.18 | 144.80 ± 7.28 | 18.20 ± 0.20 | 74.10 ± 1.95 AB | 4.08 ± 0.14 ab | 5.00 ± 0.00 | 23.20 ± 0.58 | 4.64 ± 0.12 | 23.20 ± 0.20 | 97.30 ± 2.45 | 4.20 ± 0.13 ab |
| p-value | 0.419 | 0.702 | 0.230 | 0.398 | 0.593 | 0.078 | 0.006 | 0.020 | 0.204 | 0.748 | 0.412 | 0.689 | 0.133 | 0.040 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Z.; Gao, Q.; Wang, T.; Chai, W.; Zhan, Y.; Akhtar, F.; Zhang, Z.; Li, Y.; Shi, X.; Wang, C. Multi-Thoracolumbar Variations and NR6A1 Gene Polymorphisms Potentially Associated with Body Size and Carcass Traits of Dezhou Donkey. Animals 2022, 12, 1349. https://doi.org/10.3390/ani12111349
Liu Z, Gao Q, Wang T, Chai W, Zhan Y, Akhtar F, Zhang Z, Li Y, Shi X, Wang C. Multi-Thoracolumbar Variations and NR6A1 Gene Polymorphisms Potentially Associated with Body Size and Carcass Traits of Dezhou Donkey. Animals. 2022; 12(11):1349. https://doi.org/10.3390/ani12111349
Chicago/Turabian StyleLiu, Ziwen, Qican Gao, Tianqi Wang, Wenqiong Chai, Yandong Zhan, Faheem Akhtar, Zhenwei Zhang, Yuhua Li, Xiaoyuan Shi, and Changfa Wang. 2022. "Multi-Thoracolumbar Variations and NR6A1 Gene Polymorphisms Potentially Associated with Body Size and Carcass Traits of Dezhou Donkey" Animals 12, no. 11: 1349. https://doi.org/10.3390/ani12111349
APA StyleLiu, Z., Gao, Q., Wang, T., Chai, W., Zhan, Y., Akhtar, F., Zhang, Z., Li, Y., Shi, X., & Wang, C. (2022). Multi-Thoracolumbar Variations and NR6A1 Gene Polymorphisms Potentially Associated with Body Size and Carcass Traits of Dezhou Donkey. Animals, 12(11), 1349. https://doi.org/10.3390/ani12111349

