Ethanol Extract of Artemisia Annua Prevents LPS-Induced Inflammation and Blood–Milk Barrier Disruption in Bovine Mammary Epithelial Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation and Component Identification of AAE
2.2. Cell Culture and Treatments
2.3. Immunofluorescence Analysis
2.4. Cell Viability
2.5. Flow Cytometry
2.6. Transmission Electron Microscopy
2.7. Quantitative Real-Time PCR
2.8. Western Blotting Analysis
2.9. Statistical Analysis
3. Results
3.1. Analysis of Active Components in AAE
3.2. Immunofluorescence Identification of CK-18 in bMECs
3.3. AAE Increased Cell Viability of bMECs
3.4. AAE Protected bMEC from Apoptosis in Response to LPS Stimulation
3.5. Effect of AAE on Ultrastructural Changes
3.6. Effect of AAE on the Expression of TJP in bMECs Injured by LPS
3.7. AAE Alleviated Inflammatory Cytokine Expression Stimulated by LPS
3.8. AAE Attenuated the Levels of CD36 in bMECs Challenged with LPS
3.9. AAE Pretreatment Suppressed the LPS-Induced Activity of NF-κB Pathway
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mushtaq, S.; Shah, A.M.; Shah, A.; Lone, S.A.; Hussaina, A.; Hassana, Q.P.; Ali, M.N. Bovine mastitis: An appraisal of its alternative herbal cure. Microb. Pathogenesis. 2018, 114, 357–368. [Google Scholar] [CrossRef]
- Cheng, W.N.; Han, S.G. Bovine mastitis: Risk factors, therapeutic strategies, and alternative treatments—A review. Asian Austral. J. Ani. 2020, 33, 1699. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Liu, G.; Wang, W.; Wang, Y.; Cao, Z.; Yang, H.; Li, S. Lactobacillus casei Zhang counteracts blood-milk barrier disruption and moderates the inflammatory response in Escherichia coli-induced mastitis. Front. Microbiol. 2021, 12, 675492. [Google Scholar] [CrossRef] [PubMed]
- Gong, X.X.; Su, X.S.; Zhan, K.; Zhao, G.Q. The protective effect of chlorogenic acid on bovine mammary epithelial cells and neutrophil function. J. Dairy Sci. 2018, 101, 10089–10097. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Campos, C.C.; Hartling, I.; Kaur, M.; Fernandes, A.C.C.; Santos, R.M.; Cerri, R.L.A. Intramammary infusion of lipopolysaccharide promotes inflammation and alters endometrial gene expression in lactating holstein cows. J. Dairy Sci. 2018, 101, 10440–10455. [Google Scholar] [CrossRef] [Green Version]
- Wellnitz, O.; Bruckmaier, R.M. The innate immune response of the bovine mammary gland to bacterial infection. Vet. J. 2012, 192, 148–152. [Google Scholar] [CrossRef]
- Wellnitz, O.; Arnold, E.T.; Lehmann, M.; Bruckmaier, R.M. Differential immunoglobulin transfer during mastitis challenge by pathogen-specific components. J. Dairy Sci. 2013, 96, 1681–1684. [Google Scholar] [CrossRef] [Green Version]
- Yang, P.; Xiao, Y.Y.; Luo, X.; Zhao, Y.F.; Zhao, L.; Wang, Y.; Wu, T.T.; Wei, L.; Chen, Y.X. Inflammatory stress promotes the development of obesity-related chronic kidney disease via CD36 in mice. J. Lipid. Res. 2017, 58, 1417–1427. [Google Scholar] [CrossRef] [Green Version]
- Cifarelli, V.; Ivanov, S.; Xie, Y.; Son, N.H.; Saunders, B.T.; Pietka, T.A.; Shew, T.M.; Yoshino, J.; Sundaresan, S.; Davidson, N.O.; et al. CD36 deficiency impairs the small intestinal barrier and inducessubclinical inflammation in mice. Cell Mol. Gastroenter. 2017, 3, 82–98. [Google Scholar]
- Gao, R.F.; Yang, H.D.; Jing, S.F.; Liu, B.; Wei, M.; He, P.F.; Zhang, N.S. Protective effect of chlorogenic acid on lipopolysaccharide-induced inflammatory response in dairy mammary epithelial cells. Microb. Pathogenesis. 2018, 124, 178–182. [Google Scholar] [CrossRef]
- Póciennikowska, A.; Hromada-Judycka, A.; Borzcka, K.; Wiatkowska, K.K. Co-operation of TLR4 and raft proteins in LPS-induced pro-inflammatory signaling. Cell. Mol. Life Sci. 2015, 72, 557–581. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baranova, I.N.; Kurlander, R.; Bocharov, A.V.; Vishnyakova, T.G.; Chen, Z.G.; Remaley, A.T.; Csako, G.; Patterson, A.P.; Eggerman, T.L. Role of human CD36 in bacterial recognition, phagocytosis, and pathogen-induced JNK-mediated signaling. J. Immunol. 2008, 181, 7147–7156. [Google Scholar] [CrossRef] [PubMed]
- Cao, D.Y.; Luo, J.; Zang, W.J.; Chen, D.K.; Xu, H.F.; Shi, H.P.; Jing, X.Q. Gamma-linolenic acid suppresses NF-κB signaling via CD36 in the lipopolysaccharide-induced inflammatory response in primary goat mammary gland epithelial cells. Inflammation 2016, 39, 1225. [Google Scholar] [CrossRef]
- Guo, W.J.; Liu, B.R.; Yin, Y.H.; Kan, X.C.; Gong, Q.; Li, Y.W.; Cao, Y.; Wang, J.F.; Xu, D.W.; Ma, H.; et al. Licochalcone A protects the blood–milk barrier integrity and relieves the inflammatory response in LPS-induced mastitis. Front. Immunol. 2019, 10, 287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, W.; Zhang, Y.; Wang, X.; Che, H.; Zhang, Y. Piperine improves obesity by inhibiting fatty acid absorption and repairing intestinal barrier function. Plant Food Hum. Nutr. 2021, 76, 410–418. [Google Scholar] [CrossRef] [PubMed]
- Brown, K.; Mugo, H.M.; Call, D.R.; Omulo, S. Antibiotic residues and antibiotic-resistant bacteria detected in milk marketed for human consumption in Kibera, Nairobi. PLoS ONE 2020, 15, e0233413. [Google Scholar] [CrossRef]
- Shen, J.; Wu, X.; Yang, Y.; Lv, Y.; Li, X.; Ding, X.; Li, H. Antimicrobial resistance and virulence factor of Streptococcus dysgalactiae isolated from clinical bovine mastitis cases in northwest China. Infect. Drug Resist. 2021, 14, 3519–3530. [Google Scholar] [CrossRef]
- Rolta, R.; Sharma, A.; Sourirajan, A.; Mallikarjunan, P.K.; Dev, K. Combination between antibacterial and antifungal antibiotics with phytocompounds of Artemisia annua L: A strategy to control drug resistance pathogens-sciencedirect. J. Ethnopharmacol. 2021, 266, 113420. [Google Scholar] [CrossRef]
- Song, Z.H.; Cheng, K.; Zhang, L.L.; Wang, T. Dietary supplementation of enzymatically treated Artemisia annua could alleviate the intestinal inflammatory response in heat-stressed broilers. J. Therm. Biol. 2017, 69, 184–190. [Google Scholar] [CrossRef]
- Soares, M.P.; Cardoso, I.L.; Ishikawa, M.M.; Oliveira, A.D.S.S.; Sartoratto, A.; Jonsson, C.M.; Queiroz, S.C.D.N.D.; Duarte, M.C.T.; Rantin, F.T.; Sampaio, F.G. Effects of Artemisia annua alcohol extract on physiological and innate immunity of nile tilapia (Oreochromis niloticus) to improve health status. Fish Shellfish Immun. 2020, 105, 369–377. [Google Scholar] [CrossRef]
- Zhang, W.F.; Heng, J.H.; Kim, S.W.; Chen, F.; Deng, Z.X.; Zhang, S.H. Dietary enzymatically-treated Artemisia annua L. supplementation could alleviate oxidative injury and improve reproductive performance of sows reared under high ambient temperature. J. Therm. Biol. 2020, 94, 102751. [Google Scholar] [CrossRef] [PubMed]
- Qin, D.P.; Li, H.B.; Pang, Q.Q.; Huang, Y.X.; Pan, D.B.; Su, Z.Z.; Yao, X.J.; Yao, X.S.; Xiao, W.; Yu, Y. Structurally diverse sesquiterpenoids from the aerial parts of Artemisia annua (Qinghao) and their striking systemically anti-inflammatory activities. Bioorg. Chem. 2020, 103, 104221. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.F.; Zhang, X.F. Effects of Artemisia annua extracts on CLA synthesis and mechanism. Sci. Agr. Sinica. 2019, 52, 3271–3278. [Google Scholar] [CrossRef]
- Wang, F.; Chen, L.; Chen, H.; Chen, S.; Liu, Y. Analysis of flavonoid metabolites in citrus peels (Citrus reticulata "Dahongpao") Using UPLC-ESI-MS/MS. Molecules 2019, 24, 2680. [Google Scholar] [CrossRef] [Green Version]
- Duan, Y.; Zhang, D.; Ye, Y.; Zheng, S.; Huang, P.; Zhang, F.; Han, L. Integrated metabolomics and network pharmacology to establish the action mechanism of Qingrekasen Granule for treating nephrotic syndrome. Front. Pharmacol. 2021, 12, 765563. [Google Scholar] [CrossRef]
- Dan, N.; Zhang, H.; Ao, C.J.; Erdene, K. Transcriptional regulation of milk lipid synthesis by exogenous C16:0 and C18 fatty acids in bovine mammary epithelial cells. Can. J. Anim. Sci. 2018, 98, 260–270. [Google Scholar] [CrossRef]
- Dai, H.; Coleman, D.N.; Hu, L.; Martinez-Cortés, I.; Wang, M.; Parys, C. Methionine and arginine supplementation alter inflammatory and oxidative stress responses during lipopolysaccharide challenge in bovine mammary epithelial cells in vitro. J. Dairy Sci. 2020, 103, 676–689. [Google Scholar] [CrossRef]
- Hou, K.; Tong, J.; Chu, K.; Xiong, B.; Jiang, L. Effects of bamboo leaf flavonoids and Artemisia annua extract on milk performance, milk somatic cell count and serum immune and antioxidant related indexes of dairy cows with subclinical mastitis. Chin. J. Anim. Nutr. 2019, 31, 4286–4295. [Google Scholar] [CrossRef]
- Akers, R.M.; Nickerson, S.C. Mastitis and its impact on structure and function in the ruminant mammary gland. J. Mammary Gland Biol. Neoplasia. 2011, 16, 275–289. [Google Scholar] [CrossRef]
- Wang, J.J.; Wei, Z.K.; Zhang, X.; Wang, Y.N.; Fu, Y.H.; Yang, Z.T. Butyrate protects against disruption of the blood-milk barrier and moderates inflammatory responses in a model of mastitis induced by lipopolysaccharide. Brit. J. Pharmacol. 2017, 174, 3811–3822. [Google Scholar] [CrossRef] [Green Version]
- Zhao, L.; Li, M.; Sun, K.; Su, S.; Geng, T.; Sun, H. Hippophae rhamnoides polysaccharides protect IPEC-J2 cells from LPS-induced inflammation, apoptosis and barrier dysfunction in vitro via inhibiting TLR4/NF-κB signaling pathway. Int. J. Biol. Macromol. 2020, 155, 1202–1215. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Li, L.; Wu, J.; Yu, P.; Li, C.M.; Tang, J.; Li, X.J. Bovine recombinant lipopolysaccharide binding protein (BRLBP) regulated apoptosis and inflammation response in lipopolysaccharide-challenged bovine mammary epithelial cells (BMEC). Mol. Immunol. 2015, 65, 205–214. [Google Scholar] [CrossRef] [PubMed]
- Sordillo, L.M. Mammary gland immunobiology and resistance to mastitis. Vet. Clin. Food Anim. 2018, 34, 507–523. [Google Scholar] [CrossRef]
- Li, F.Y.; Wang, W.; Cao, Y.G.; Liang, D.J.; Zhang, W.L.; Zhang, Z.C.; Jiang, H.C.; Guo, M.Y.; Zhang, N.S. Inhibitory effects of astragalin on lipopolysaccharide-induced inflammatory response in mouse mammary epithelial cells. J. Surg. Res. 2014, 192, 573–581. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.J.; Song, S.X.; Li, H.R.; Jiang, X.Y.; Peng, Y.; Wan, C.R.; Liu, X.X.; Liu, F.H.; Xu, J.Q. The protective effect of caffeic acid against inflammation injury of primary bovine mammary epithelial cells induced by lipopolysaccharide. J. Dairy Sci. 2014, 97, 2856–2865. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hunt, S.; Yoshida, M.; Davis, C.E.; Greenhill, N.S.; Davis, P.F. An extract of the medicinal plant Artemisia annua modulates production of inflammatory markers in activated neutrophils. J. Inflamm. Res. 2015, 8, 9–14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abate, G.; Zhang, L.; Pucci, M.; Morbini, G.; Mac Sweeney, E.; Maccarinelli, G.; Mastinu, A. Phytochemical analysis and anti-inflammatory activity of different ethanolic phyto-extracts of Artemisia annua L. Biomolecules 2021, 11, 975. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.X.; Lin, Y.; Liu, L.L.; Bian, Y.J.; Zhang, L.; Gao, X.J.; Li, Q.Z. 14-3-3γ regulates lipopolysaccharide-induced inflammatory responses and lactation in dairy cow mammary epithelial cells by inhibiting NF-κB and MAPKs and up-regulating mTOR signaling. Int. J. Mol. Sci. 2015, 16, 16622–16641. [Google Scholar] [CrossRef] [Green Version]
- Liu, P.; Yang, C.; Lin, S.; Zhao, G.; Zhang, T.; Guo, S.; Jiang, K.F.; Wu, H.C.; Qiu, C.W.; Guo, M.Y.; et al. Sodium houttuyfonate inhibits LPS-induced mastitis in mice via the NFκB signalling pathway. Mol. Med. Rep. 2019, 19, 2279–2286. [Google Scholar]
- Sun, X.D.; Luo, S.B.; Jiang, C.H.; Tang, Y.; Cao, Z.J.; Jia, H.D.; Xu, Q.S.; Zhao, C.X.; Loor, J.J.; Xu, C. Sodium butyrate reduces bovine mammary epithelial cell inflammatory responses induced by exogenous lipopolysaccharide, by inactivating NF-κB signaling. J. Dairy Sci. 2020, 103, 8388–8397. [Google Scholar] [CrossRef]
- Wang, Y.; Huang, Z.; Wang, L.; Meng, S.; Fan, Y.; Chen, T.; Wang, C. The anti-malarial artemisinin inhibits pro-inflammatory cytokines via the NF-κB canonical signaling pathway in PMA-induced THP-1 monocytes. Int. J. Mol. Med. 2011, 27, 233–241. [Google Scholar] [CrossRef] [PubMed]
- Jiao, J.; Yang, Y.; Liu, M.; Li, J.; Cui, Y.; Yin, S.; Tao, J. Artemisinin and Artemisia annua leaves alleviate Eimeria tenella infection by facilitating apoptosis of host cells and suppressing inflammatory response. Vet. Parasitol. 2018, 254, 172–177. [Google Scholar] [CrossRef] [PubMed]
- Lai, L.; Chen, Y.; Tian, X.; Li, X.; Zhang, X.; Lei, J.; Song, X. Artesunate alleviates hepatic fibrosis induced by multiple pathogenic factors and inflammation through the inhibition of LPS/TLR4/NF-κB signaling pathway in rats. Eur. J. Pharmacol. 2015, 765, 234–241. [Google Scholar] [CrossRef] [PubMed]
- Yan, L.; Xiong, C.; Xu, P.; Zhu, J.; Yang, Z.; Ren, H.; Luo, Q. Structural characterization and in vitro antitumor activity of A polysaccharide from Artemisia annua L. (Huang Huahao). Carbohyd. Polym. 2019, 213, 361–369. [Google Scholar] [CrossRef]
- Tran, T.T.T.; Poirier, H.; Clement, L.; Nassir, F.; Pelsers, M.M.A.L.; Petit, V.; Degrace, P.; Monno, M.C.; Glatz, J.F.C.; Abumrad, N.A.; et al. Luminal lipid regulates CD36 levels and downstream signaling to stimulate chylomicron synthesis. J. Biol. Chem. 2011, 286, 25201–25210. [Google Scholar] [CrossRef] [Green Version]
- Baranova, I.N.; Vishnyakova, T.G.; Bocharov, A.V.; Leelahavanichkul, A.; Kurlander, R.; Chen, Z.G.; Souza, A.C.P.; Yuen, P.S.T.; Star, R.A.; Csako, G.; et al. Class B scavenger receptor types I and II and CD36 mediate bacterial recognition and proinflammatory signaling induced by Escherichia coli, lipopolysaccharide, and cytosolic chaperonin 60. J. Immunol. 2012, 188, 1371–1380. [Google Scholar] [CrossRef] [Green Version]
- Cai, L.; Wang, Z.; Ji, A.; Meyer, J.M.; Westhuyzen, D.R.V.D. Scavenger receptor CD36 expression contributes to adipose tissue inflammation and cell death in diet-induced obesity. PLoS ONE 2012, 7, e36785. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.P.; Franco, F.; Tsui, Y.C.; Xie, X.; Trefny, M.P.; Zappasodi, R.; Mohmood, S.R.; Fernández-García, J.; Tsai, C.H.; Schulze, I.; et al. CD36-mediated metabolic adaptation supports regulatory T cell survival and function in tumors. Nat. Immunol. 2020, 21, 298–308. [Google Scholar] [CrossRef]
- Choi, Y.; Yanagawa, Y.; Kim, S.; Whang, W.K.; Park, T. Artemisia iwayomogi extract attenuates high-fat diet-induced obesity by decreasing the expression of genes associated with adipogenesis in mice. Evid-Based. Compl. Alt. 2013, 2013, e915953. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.; Kim, M.H.; Lee, J.H.; Jung, E.; Yoo, E.S.; Park, D. Artemisinic acid is a regulator of adipocyte differentiation and C/EBP δ expression. J. Cell Biochem. 2012, 113, 2488–2499. [Google Scholar] [CrossRef]
Gene Name | Accession Number | Primer Sequence (5′–3′) 1 | Size (bp) |
TNF-α | NM_173966.3 | F:CTGGCGGAGGAGGTGCTCTC | 85 |
R:GGAGGAAGGAGAAGAGGCTGAGG | |||
IL-1β | NM_174093.1 | F:ATGAAGAGCTGCATCCAACACCTG | 110 |
R:ACCGACACCACCTGCCTGAAG | |||
IL-6 | NM_173923.2 | F:GCCTTCACTCCATTCGCTGTCTC | 117 |
R:AAGTAGTCTGCCTGGGGTGGTG | |||
CD36 | NM_174010.3 | F:TGCAGGTCAACATGCTGGTCAAG | 126 |
R:TTTCCGCCTTCTCATCACCAATGG | |||
Occludin | NM_001082433.2 | F:GCCTGTGTTGCCTCCACTCTTG | 132 |
R: ACCGTAGCCATAGCCGTAGCC | |||
Claudin- 1 | NM_001001854.2 | F:TGCTGGGACTAATAGCCATCTTTGTG | 83 |
R:CATCTTCTGTGCCTCGTCGTCTTC | |||
ZO-1 | XM_024982009.1 | F:CCGAATGAAACCGCACACAAACC | 107 |
R:GTCTCCACGCCACTGTCAAACTC | |||
UXT | NM_001037471.2 | F: AATGTCATTGAGCGACTCCAGGAAG | 92 |
R: GGGACCACTGTGTCAACGAAGAAG |
Index | Q1 (Da) | Q3 (Da) | Molecular Weight (Da) | Compound | Class |
mws0177 | 111.01 | 67 | 112.02 | 2-Furanoic acid | Organic acids |
pme3207 | 141.02 | 59 | 142.03 | Muconic acid | Organic acids |
mws0281 | 191.02 | 111.01 | 192.03 | Citric Acid | Organic acids |
mws0470 | 117.02 | 73 | 118.03 | Methylmalonic acid | Organic acids |
mws0192 | 117.02 | 73 | 118.03 | Succinic acid | Organic acids |
pmn001578 | 255.23 | 255.23 | 256.22 | Hexadecanoic acid | Phenolic acids |
Lmlp012720 | 279.16 | 149.02 | 278.15 | Dibutyl phthalate | Phenolic acids |
Lmln010063 | 205.16 | 189.13 | 206.17 | 2,6-Di-t-butylphenol | Phenolic acids |
mws0178 | 353.09 | 191.01 | 354.10 | Chlorogenic acid | Phenolic acids |
pme0281 | 165.02 | 121.03 | 166.03 | Terephthalic acid | Phenolic acids |
ML10174588 | 233.16 | 233.16 | 234.16 | Confertifoline | Terpenoids |
Hmcp003852 | 223.21 | 207.03 | 222.20 | Elemol | Terpenoids |
Lmjp006982 | 267.16 | 203.14 | 266.15 | Deoxyartemisinin | Terpenoids |
Lmjn006711 | 249.15 | 205.16 | 250.16 | 4,5-Epoxyartemisinic Acid | Terpenoids |
Lmjn004991 | 283.16 | 203.14 | 287.18 | Dihydro Artemisinin-D3 | Terpenoids |
pmp001309 | 465.1 | 303.1 | 464.10 | 6-Hydroxykaempferol-7-O-glucoside | Flavonoids |
Lmdp003286 | 465.1 | 303.06 | 464.10 | Isohyperoside | Flavonoids |
mws0061 | 463.09 | 300 | 464.10 | Quercetin-3-O-galactoside (Hyperin) | Flavonoids |
pmb3894 | 329.1 | 229.1 | 330.06 | Di-O-methylquercetin | Flavonoids |
pme3211 | 463 | 301 | 464.08 | Quercetin 3-O-glucoside (Isotrifoliin) | Flavonoids |
pme0489 | 137.07 | 108 | 136.06 | N-Methylnicotinamide | Alkaloids |
pmp001287 | 120.08 | 103.05 | 119.07 | N-Benzylmethylene isomethylamine | Alkaloids |
pmp001275 | 672.42 | 331.29 | 671.41 | 3-Hydroxypropyl palmitate glc-glucosamine | Alkaloids |
pme2268 | 138.05 | 94.07 | 137.05 | Trigonelline | Alkaloids |
pmp001198 | 132.1 | 57.1 | 131.10 | 6-Deoxyfagomine | Alkaloids |
pmp000605 | 449.1 | 287.05 | 448.08 | Rhamnone-2-O-B-D-Glucopyranoside from Italy | Quinones |
pmp000608 | 493.13 | 331.08 | 492.13 | Aurantio-obtusin-6-O-Glucoside | Quinones |
pmn001492 | 187.1 | 123.1 | 188.04 | Ayapin | Lignans and Coumarins |
Lmgp003270 | 369.16 | 177.06 | 368.07 | Scopoletin-7-O-glucuronide | Lignans and Coumarins |
pmn001378 | 519.19 | 357.14 | 520.19 | Pinoresinol-4-O-glucoside | Lignans and Coumarins |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, J.; Hu, Y.; Wang, L.; Ao, C. Ethanol Extract of Artemisia Annua Prevents LPS-Induced Inflammation and Blood–Milk Barrier Disruption in Bovine Mammary Epithelial Cells. Animals 2022, 12, 1228. https://doi.org/10.3390/ani12101228
Song J, Hu Y, Wang L, Ao C. Ethanol Extract of Artemisia Annua Prevents LPS-Induced Inflammation and Blood–Milk Barrier Disruption in Bovine Mammary Epithelial Cells. Animals. 2022; 12(10):1228. https://doi.org/10.3390/ani12101228
Chicago/Turabian StyleSong, Jie, Yao Hu, Lifang Wang, and Changjin Ao. 2022. "Ethanol Extract of Artemisia Annua Prevents LPS-Induced Inflammation and Blood–Milk Barrier Disruption in Bovine Mammary Epithelial Cells" Animals 12, no. 10: 1228. https://doi.org/10.3390/ani12101228
APA StyleSong, J., Hu, Y., Wang, L., & Ao, C. (2022). Ethanol Extract of Artemisia Annua Prevents LPS-Induced Inflammation and Blood–Milk Barrier Disruption in Bovine Mammary Epithelial Cells. Animals, 12(10), 1228. https://doi.org/10.3390/ani12101228