Low Birth Weight Disturbs the Intestinal Redox Status and Mitochondrial Morphology and Functions in Newborn Piglets
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Design
2.2. Sample Collection
2.3. Determination of Histological Analyses
2.4. Enzyme Activities Analysis
2.5. Determination of Gene mRNA Expression
2.6. Statistical Analysis
3. Results
3.1. Birth Weight and Small Intestine Index
3.2. Small Intestine Morphology
3.3. Gene Expression of Tight Junction Protein in Jejunum
3.4. Redox Genes Expression in Jejunum
3.5. Histomorphology of Mitochondria
3.6. Antioxidant Capacity in Jejunal Mitochondria
3.7. mRNA Levels of Mitochondria Biogenesis and Function-Related Gene in Jejunum
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Amdi, C.; Lynegaard, J.C.; Thymann, T.; Williams, A.R. Intrauterine growth restriction in piglets alters blood cell counts and impairs cytokine responses in peripheral mononuclear cells 24 days post-partum. Sci. Rep. 2020, 10, 4683. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Badouard, G.M.B. Managing highly prolific sows. In Proceedings of the London Swine Conference Tools of the Trade, London, UK, 1 April 2009; pp. 3–19. [Google Scholar]
- Gaudré, N.Q.J.D.D. Variation of piglets’ birth weight and consequences on subsequent performance. Livest. Prod. Sci. 2002, 78, 63–70. [Google Scholar]
- Oksbjerg, N.; Nissen, P.M.; Therkildsen, M.; Møller, H.S.; Larsen, L.B.; Andersen, M.; Young, J.F. In utero nutrition related to fetal development, postnatal performance and meat quality of pork. J. Anim. Sci. 2013, 91, 1443–1453. [Google Scholar] [CrossRef]
- Baxter, E.M.; Jarvis, S.; D’Eath, R.B.; Ross, D.W.; Robson, S.K.; Farish, M.; Nevison, I.M.; Lawrence, A.B.; Edwards, S.A. Investigating the behavioural and physiological indicators of newborn survival in pigs. Theriogenology 2008, 69, 773–783. [Google Scholar] [CrossRef] [PubMed]
- Bozzetti, V.; Tagliabue, P.E.; Visser, G.H.; Van Bel, F.; Gazzolo, D. Feeding issues in IUGR preterm infants. Early Hum. Dev. 2013, 89, S21–S23. [Google Scholar] [CrossRef]
- Wang, T.; Huo, Y.J.; Shi, F.; Xu, R.J.; Hutz, R.J. Effects of Intrauterine Growth Retardation on Development of the Gastrointestinal Tract in Newborn Pigs. Neonatology 2005, 88, 66–72. [Google Scholar] [CrossRef]
- Xu, R.-J.; Mellor, D.J.; Birtles, M.J.; Reynolds, G.W.; Simpson, H.V. Impact of Intrauterine growth Retardation on the Gastrointestinal Tract and the Pancreas in Newborn Pigs. J. Pediatr. Gastroenterol. Nutr. 1994, 18, 231–240. [Google Scholar] [CrossRef]
- D’Inca, R.; Guen, C.G.-L.; Che, L.; Sangild, P.T.; Luron, I. Intrauterine Growth Restriction Delays Feeding-Induced Gut Adaptation in Term Newborn Pigs. Neonatology 2011, 99, 208–216. [Google Scholar] [CrossRef]
- D’Inca, R.; Kloareg, M.; Guen, C.G.-L.; Le Huërou-Luron, I. Intrauterine Growth Restriction Modifies the Developmental Pattern of Intestinal Structure, Transcriptomic Profile, and Bacterial Colonization in Newborn Pigs. J. Nutr. 2010, 140, 925–931. [Google Scholar] [CrossRef]
- Wang, W.; Degroote, J.; Van Ginneken, C.; Van Poucke, M.; Vergauwen, H.; Dam, T.M.T.; Vanrompay, D.; Peelman, L.J.; De Smet, S.; Michiels, J. Intrauterine growth restriction in neonatal piglets affects small intestinal mucosal permeability and mRNA expression of redox-sensitive genes. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2015, 30, 863–873. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Lin, G.; Liu, C.; Feng, C.; Zhou, H.; Wang, T.; Li, D.; Wu, G.; Wang, J. Temporal proteomic analysis reveals defects in small-intestinal development of porcine fetuses with intrauterine growth restriction. J. Nutr. Biochem. 2014, 25, 785–795. [Google Scholar] [CrossRef] [PubMed]
- Robles, R.; Palomino, N.; Robles, A. Oxidative stress in the neonate. Early Hum. Dev. 2001, 65, S75–S81. [Google Scholar] [CrossRef]
- Yin, J.; Ren, W.; Liu, G.; Duan, J.; Yang, G.; Wu, L.; Li, T.; Yin, Y. Birth oxidative stress and the development of an antioxidant system in newborn piglets. Free. Radic. Res. 2013, 47, 1027–1035. [Google Scholar] [CrossRef]
- Balaban, R.S.; Nemoto, S.; Finkel, T. Mitochondria, oxidants, and aging. Cell 2005, 120, 483–495. [Google Scholar] [CrossRef] [Green Version]
- Kowaltowski, A.; de Souza-Pinto, N.; Castilho, R.; Vercesi, A. Mitochondria and reactive oxygen species. Free Radic. Biol. Med. 2009, 47, 333–343. [Google Scholar] [CrossRef]
- Michiels, J.; De Vos, M.; Missotten, J.; Ovyn, A.; De Smet, S.; Van Ginneken, C. Maturation of digestive function is retarded and plasma antioxidant capacity lowered in fully weaned low birth weight piglets. Br. J. Nutr. 2012, 109, 65–75. [Google Scholar] [CrossRef] [Green Version]
- Zheng, P.; Yu, B.; He, J.; Yu, J.; Mao, X.; Luo, Y.; Luo, J.; Huang, Z.; Tian, G.; Zeng, Q.; et al. Arginine metabolism and its protective effects on intestinal health and functions in weaned piglets under oxidative stress induced by diquat. Br. J. Nutr. 2017, 117, 1495–1502. [Google Scholar] [CrossRef] [Green Version]
- Reeds, P.J.; Burrin, D.G.; Stoll, B.; Jahoor, F.; Wykes, L.; Henry, J.; Frazer, M.E. Enteral glutamate is the preferential source for mucosal glutathione synthesis in fed piglets. Am. J. Physiol. Content 1997, 273, E408–E415. [Google Scholar] [CrossRef]
- Li, P.; Yin, Y.-L.; Li, D.; Kim, S.W.; Wu, G. Amino acids and immune function. Br. J. Nutr. 2007, 98, 237–252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dong, L.; Zhong, X.; Ahmad, H.; Li, W.; Wang, Y.; Zhang, L.; Wang, T. Intrauterine Growth Restriction Impairs Small Intestinal Mucosal Immunity in Neonatal Piglets. J. Histochem. Cytochem. Off. J. Histochem. Soc. 2014, 62, 510–518. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Tian, H.; Huang, Y.-Q.; Hu, J.; Ji, Y.-X.; Li, S.-Q.; Feng, Y.-Q.; Guo, L.; Zhu, Y.-G. Alterations of Mitochondrial Protein Assembly and Jasmonic Acid Biosynthesis Pathway in Honglian (HL)-type Cytoplasmic Male Sterility Rice. J. Biol. Chem. 2012, 287, 40051–40060. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pi, D.; Liu, Y.; Shi, H.; Li, S.; Odle, J.; Lin, X.; Zhu, H.; Chen, F.; Hou, Y.; Leng, W. Dietary supplementation of aspartate enhances intestinal integrity and energy status in weanling piglets after lipopolysaccharide challenge. J. Nutr. Biochem. 2014, 25, 456–462. [Google Scholar] [CrossRef]
- Yang, R.; Harada, T.; Li, J.; Uchiyama, T.; Han, Y.; Englert, J.; Fink, M.P. Bile modulates intestinal epithelial barrier function via an extracellular signal related kinase 1/2 dependent mechanism. Intensiv. Care Med. 2005, 31, 709–717. [Google Scholar] [CrossRef] [PubMed]
- Friel, J.K.; Friesen, R.W.; Harding, S.V.; Roberts, L.J. Evidence of Oxidative Stress in Full-Term Healthy Infants. Pediatr. Res. 2004, 56, 878–882. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Circu, M.L.; Aw, T.Y. Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic. Biol. Med. 2010, 48, 749–762. [Google Scholar] [CrossRef] [Green Version]
- Valko, M.; Rhodes, C.; Moncol, J.; Izakovic, M.; Mazur, M. Free radicals, metals and antioxidants in oxidative stress-induced cancer. Chem. Interact. 2006, 160, 1–40. [Google Scholar] [CrossRef]
- Tenhunen, R.; Marver, H.S.; Schmid, R. The enzymatic conversion of heme to bilirubin by microsomal heme oxygenase. Proc. Natl. Acad. Sci. USA 1968, 61, 748–755. [Google Scholar] [CrossRef] [Green Version]
- Oates, P.S. Heme in intestinal epithelial cell turnover, differentiation, detoxification, inflammation, carcinogenesis, absorption and motility. World J. Gastroenterol. 2006, 12, 4281–4295. [Google Scholar] [CrossRef]
- Wang, X.; Zhang, L.; Zhou, G.L.; Wang, T. Effect of Supplement of Soya Lecithine on Mucosal Anti-Oxidation and Heat ShockProtein 70 Content in Intrauterine Growth Retardation Piglets. Sci. Agric. Sin. 2012, 43, 2711–2717. [Google Scholar] [CrossRef]
- Edeas, M.; Attaf, D.; Mailfert, A.-S.; Nasu, M.; Joubet, R. Maillard Reaction, mitochondria and oxidative stress: Potential role of antioxidants. Pathol. Biol. 2010, 58, 220–225. [Google Scholar] [CrossRef]
- Qi, M.; Wang, J.; Tan, B.; Liao, S.; Long, C.; Yin, Y. Postnatal growth retardation is associated with intestinal mucosa mitochondrial dysfunction and aberrant energy status in piglets. J. Cell. Mol. Med. 2020, 24, 10100–10111. [Google Scholar] [CrossRef] [PubMed]
- Rosero, D.S.; Odle, J.; Moeser, A.J.; Boyd, R.D.; Van Heugten, E. Peroxidised dietary lipids impair intestinal function and morphology of the small intestine villi of nursery pigs in a dose-dependent manner. Br. J. Nutr. 2015, 114, 1985–1992. [Google Scholar] [CrossRef] [Green Version]
- Kaarniranta, K.; Kajdanek, J.; Morawiec, J.; Pawlowska, E.; Blasiak, J. PGC-1α Protects RPE Cells of the Aging Retina against Oxidative Stress-Induced Degeneration through the Regulation of Senescence and Mitochondrial Quality Control. The Significance for AMD Pathogenesis. Int. J. Mol. Sci. 2018, 19, 2317. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, X.; Zhang, L.; Li, P.; Wang, J.; Li, R.; Huang, Y.; Wu, M.; Zhou, H.; Li, Y.; Wei, S.; et al. The protective effects of compatibility of Aconiti Lateralis Radix Praeparata and Zingiberis Rhizoma on rats with heart failure by enhancing mitochondrial biogenesis via Sirt1/PGC-1α pathway. Biomed. Pharmacother. 2017, 92, 651–660. [Google Scholar] [CrossRef] [PubMed]
- Suntar, I.; Sureda, A.; Belwal, T.; Silva, A.S.; Vacca, R.A.; Tewari, D.; Sobarzo-Sánchez, E.; Nabavi, S.F.; Shirooie, S.; Dehpour, A.R.; et al. Natural products, PGC-1, and Duchenne muscular dystrophy. Acta Pharm. Sin. B 2020, 10, 734–745. [Google Scholar] [CrossRef]
- Moro, M.A.; Almeida, A.; Bolanos, J.; Lizasoain, I. Mitochondrial respiratory chain and free radical generation in stroke. Free Radic. Biol. Med. 2005, 39, 1291–1304. [Google Scholar] [CrossRef] [PubMed]
- Turrens, J.F. Superoxide Production by the Mitochondrial Respiratory Chain. Biosci. Rep. 1997, 17, 3–8. [Google Scholar] [CrossRef]
- Huang, Q.; Xu, W.; Bai, K.-W.; He, J.-T.; Ahmad, H.; Zhou, L.; Zhang, L.-L.; Wang, T. Protective effects of leucine on redox status and mitochondrial-related gene abundance in the jejunum of intrauterine growth-retarded piglets during early weaning period. Arch. Anim. Nutr. 2017, 71, 93–107. [Google Scholar] [CrossRef] [PubMed]
Genes 1 | Primers | Sequence (5′-3′) | Size (bp) | Accession No. |
---|---|---|---|---|
SOD | Forward | GAGACCTGGGCAATGTGACT | 139 | E06791.1 |
Reverse | CTGCCCAAGTCATCTGGTTT | |||
CAT | Forward | TGTACCCGCTATTCTGGGGA | 119 | NM_214301.2 |
Reverse | TCACACAGGCGTTTCCTCTC | |||
GPX | Forward | GCTCGGTGTATGCCTTCTCT | 103 | AF532927.1 |
Reverse | AGCGACGCTACGTTCTCAAT | |||
HO-1 | Forward | GCTGAGAATGCCGAGTTCAT | 142 | NM_001004027.1 |
Reverse | TGTAGACCGGGTTCTCCTTG | |||
PGC-1α | Forward | CCCGAAACAGTAGCAGAGACAAG | 111 | NM_213963 |
Reverse | CTGGGGTCAGAGGAAGAGATAAAG | |||
TFAM | Forward | GGTCCATCACAGGTAAAGCTGAA | 167 | NM_001130211.1 |
Reverse | ATAAGATCGTTTCGCCCAACTTC | |||
Nrf1 | Forward | GCCAGTGAGATGAAGAGAAACG | 166 | AK237171.1 |
Reverse | CTACAGCAGGGACCAAAGTTCAC | |||
NQO1 | Forward | CATACTCCAATGAAGACTATGACAGG | 133 | NC_010448.4 |
Reverse | AAGTTCCAGCTTTTCTACACGC | |||
Occludin | Forward | CAGGTGCACCCTCCAGATTG | 110 | NM_001162647.2 |
Reverse | GGACTTTCAAGAGGCCTGGAT | |||
Claudin1 | Forward | GCCACAGCAAGGTATGGTAAC | 140 | FJ873109.1 |
Reverse | AGTAGGGCACCTCCCAGAAG | |||
ZO1 | Forward | CTGAGGGAATTGGGCAGGA | 105 | XM_005659811.1 |
Reverse | TCACCAAAGGACTCAGCAGG | |||
Cytc | Forward | AGTTGGCCACCGCCTTATTT | 126 | NM_001129970 |
Reverse | CCAACAGAAACATTCCATCAGCC | |||
Ccox I | Forward | ATTATCCTGACGCATACACAGCA | 127 | AJ950517.1 |
Reverse | GCAGATACTTCTCGTTTTGATGC | |||
Ccox IV | Forward | CCAAGTGGGACTACGACAAGAAC | 160 | AY786556.1 |
Reverse | CCTGCTCGTTTATTAGCACTGG | |||
Ccox V | Forward | GGACCTCATAAGGAAATCTACCCC | 123 | NC_010449.5 |
Reverse | ACACTTTGTCAAGGCCCAGT | |||
ATPS | Forward | TGTCCTCCTCCCTATCACCATT | 116 | AK230503 |
Reverse | TAGTGGTTATGACGTTGGCTTGA | |||
Nrf2 | Forward | GAAAGCCCAGTCTTCATTGC | 190 | XM_003133500.5 |
Reverse | TTGGAACCGTGCTAGTCTCA | |||
Hsp70 | Forward | GCCCTGAATCCGCAGAATA | 152 | NC_010446.5 |
Reverse | TCCCCACGGTAGGAAACG | |||
β-actin | Forward | TCTGGCACCACACCTTCT | 114 | DQ178122 |
Reverse | TGATCTGGGTCATCTTCTCAC |
Item | NBW 2 | LBW 3 | p-Value |
---|---|---|---|
Birth weight (kg) | 1.66 ± 0.07 | 0.83 ± 0.04 | <0.01 |
Intestinal weight (g) | 43.83 ± 3.07 | 21.74 ± 1.61 | <0.01 |
Intestinal length (cm) | 343.8 ± 5.89 | 261.8 ± 7.23 | <0.01 |
Intestinal weight/length (g/cm) | 0.13 ± 0.01 | 0.08 ± 0.01 | <0.01 |
Item | NBW 2 | LBW 3 | p-Value |
---|---|---|---|
Duodenum | |||
Villus height (µm) | 343.44 ± 31.68 | 311.62 ± 14.73 | 0.32 |
Crypt depth (µm) | 86.08 ± 14.02 | 88.43 ± 11.66 | 0.86 |
V/C 4 | 4.68 ± 0.54 | 3.87 ± 0.30 | 0.16 |
Jejunum | |||
Villus height (µm) | 428.68 ± 26.84 | 328.90 ± 33.20 | 0.09 |
Crypt depth (µm) | 69.11 ± 5.65 | 76.33 ± 9.30 | 0.59 |
V/C | 6.50 ± 0.45 | 4.50 ± 0.33 | 0.01 |
Ileum | |||
Villus height (µm) | 386.37 ± 31.14 | 304.34 ± 26.10 | 0.09 |
Crypt depth (µm) | 83.97 ± 9.44 | 82.46 ± 11.40 | 0.92 |
V/C | 5.00 ± 0.37 | 4.10 ± 0.41 | 0.17 |
Item 2 | NBW 3 | LBW 4 | p-Value |
---|---|---|---|
SOD | 1.00 ± 0.13 | 0.53 ± 0.13 | 0.04 |
GPX | 1.00 ± 0.15 | 0.55 ± 0.08 | 0.05 |
CAT | 1.00 ± 0.13 | 0.57 ± 0.10 | 0.01 |
HO-1 | 1.00 ± 0.08 | 0.79 ± 0.07 | 0.03 |
NQO1 | 1.00 ± 0.14 | 0.71 ± 0.12 | 0.22 |
Nrf2 | 1.00 ± 0.08 | 0.76 ± 0.16 | 0.31 |
Hsp70 | 1.00 ± 0.28 | 1.01 ± 0.31 | 0.98 |
Item 2 | NBW 3 | LBW 4 | p-Value |
---|---|---|---|
MDA (nmol/mg prot) | 2.20 ± 0.30 | 3.54 ± 0.67 | 0.06 |
SOD (U/mg prot) | 48.42 ± 2.76 | 41.65 ± 1.24 | 0.03 |
CAT (U/mg prot) | 7.78 ± 1.00 | 10.07 ± 1.19 | 0.10 |
Item 2 | NBW 3 | LBW 4 | p-Value |
---|---|---|---|
PGC-1α | 1.00 ± 0.09 | 0.69 ± 0.06 | 0.03 |
TFAM | 1.00 ± 0.11 | 0.83 ± 0.08 | 0.17 |
Nrf1 | 1.00 ± 0.18 | 1.00 ± 0.21 | 1.00 |
Cytc | 1.00 ± 0.10 | 0.65 ± 0.09 | 0.08 |
Ccox I | 1.00 ± 0.11 | 0.90 ± 0.10 | 0.61 |
Ccox IV | 1.00 ± 0.15 | 0.57 ± 0.09 | 0.07 |
Ccox V | 1.00 ± 0.17 | 0.56 ± 0.09 | 0.10 |
ATPS | 1.00 ± 0.16 | 1.16 ± 0.20 | 0.48 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, J.; Song, Y.; Chen, D.; Yu, B.; He, J.; Mao, X.; Huang, Z.; Luo, J.; Yu, J.; Luo, Y.; et al. Low Birth Weight Disturbs the Intestinal Redox Status and Mitochondrial Morphology and Functions in Newborn Piglets. Animals 2021, 11, 2561. https://doi.org/10.3390/ani11092561
Chen J, Song Y, Chen D, Yu B, He J, Mao X, Huang Z, Luo J, Yu J, Luo Y, et al. Low Birth Weight Disturbs the Intestinal Redox Status and Mitochondrial Morphology and Functions in Newborn Piglets. Animals. 2021; 11(9):2561. https://doi.org/10.3390/ani11092561
Chicago/Turabian StyleChen, Jiaojiao, Yi Song, Daiwen Chen, Bing Yu, Jun He, Xiangbing Mao, Zhiqing Huang, Junqiu Luo, Jie Yu, Yuheng Luo, and et al. 2021. "Low Birth Weight Disturbs the Intestinal Redox Status and Mitochondrial Morphology and Functions in Newborn Piglets" Animals 11, no. 9: 2561. https://doi.org/10.3390/ani11092561
APA StyleChen, J., Song, Y., Chen, D., Yu, B., He, J., Mao, X., Huang, Z., Luo, J., Yu, J., Luo, Y., Yan, H., & Zheng, P. (2021). Low Birth Weight Disturbs the Intestinal Redox Status and Mitochondrial Morphology and Functions in Newborn Piglets. Animals, 11(9), 2561. https://doi.org/10.3390/ani11092561