Chestnut Shell Tannins: Effects on Intestinal Inflammation and Dysbiosis in Zebrafish
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Fish Husbandry
2.2. Intestinal Inflammation Induction
2.3. Preparation of Chestnut Shell Extract
2.4. High Performance Liquid Chromatography (HPLC) Analysis
2.5. Experimental Design and Feeding Protocol
2.6. Hystological Analysis
2.7. Immunohistochemical Analysis
2.8. RNA Isolation, cDNA Synthesis and Real-Time PCR
2.9. Microbiota Intestinal Isolation and Analysis by Culture-Dependent Methods
2.10. Microbiome Analysis
2.11. 16S rDNA Library Sequencing and Processing
2.12. Analysis of Alpha and Beta Diversity
2.13. Statistical Analysis
3. Results
3.1. Chestnut Shell Extract Composition
3.2. Intestinal Histopathology
3.3. PCR Analysis
3.4. Analysis of Intestinal Microbiota by Culture-Dependent Methods
3.5. Gut Microbiome Metagenomic Analysis
3.5.1. Alpha-Diversity
3.5.2. Beta-Diversity
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Serrano, J.; Puupponen-Pimiä, R.; Dauer, A.; Aura, A.-M.; Calixto, F.D.S. Tannins: Current knowledge of food sources, intake, bioavailability and biological effects. Mol. Nutr. Food Res. 2009, 53, S310–S329. [Google Scholar] [CrossRef]
- Mueller-Harvey, I. Unravelling the conundrum of tannins in animal nutrition and health. J. Sci. Food Agric. 2006, 86, 2010–2037. [Google Scholar] [CrossRef]
- Huang, Q.; Liu, X.; Zhao, G.; Hu, T.; Wang, Y. Potential and challenges of tannins as an alternative to in-feed antibiotics for farm animal production. Anim. Nutr. 2018, 4, 137–150. [Google Scholar] [CrossRef]
- Caprarulo, V.; Giromini, C.; Rossi, L. Review: Chestnut and quebracho tannins in pig nutrition: The effects on performance and intestinal health. Animal 2021, 15, 100064. [Google Scholar] [CrossRef]
- Sieniawska, E. Activities of Tannins-from in vitro Studies to Clinical Trials. Nat. Prod. Commun. 2015, 10, 1877–1884. [Google Scholar] [CrossRef]
- Smeriglio, A.; Barreca, D.; Bellocco, E.; Trombetta, D. Proanthocyanidins and hydrolysable tannins: Occurrence, dietary intake and pharmacological effects. Br. J. Pharmacol. 2016, 174, 1244–1262. [Google Scholar] [CrossRef]
- Dueñas, M.; Muñoz-González, I.; Cueva, C.; Jiménez-Girón, A.; Sánchez-Patán, F.; Santos-Buelga, C.; Moreno-Arribas, M.V.; Bartolomé, B. A Survey of Modulation of Gut Microbiota by Dietary Polyphenols. BioMed Res. Int. 2015, 2015, 1–15. [Google Scholar] [CrossRef]
- Sugiyama, A.; Kimura, H.; Ogawa, S.; Yokota, K.; Takeuchi, T. Effects of polyphenols from seed shells of Japanese horse chestnut (Aesculus turbinata BLUME) on methotrexate-induced intestinal injury in rats. J. Veter. Med. Sci. 2011, 73, 673–678. [Google Scholar] [CrossRef]
- Liu, H.W.; Li, K.; Zhao, J.S.; Deng, W. Effects of chestnut tannins on intestinal morphology, barrier function, pro-inflammatory cytokine expression, microflora and antioxidant capacity in heat-stressed broilers. J. Anim. Physiol. Anim. Nutr. 2017, 102, 717–726. [Google Scholar] [CrossRef]
- Rampone, S.; Pagliarulo, C.; Marena, C.; Orsillo, A.; Iannaccone, M.; Trionfo, C.; Sateriale, D.; Paolucci, M. In silico analysis of the antimicrobial activity of phytochemicals: Towards a technological breakthrough. Comput. Methods Programs Biomed. 2021, 200, 105820. [Google Scholar] [CrossRef]
- Halliwell, B. Are polyphenols antioxidants or pro-oxidants? What do we learn from cell culture and in vivo studies? Arch. Biochem. Biophys. 2008, 476, 107–112. [Google Scholar] [CrossRef] [PubMed]
- Rahal, A.; Kumar, A.; Singh, V.; Yadav, B.; Tiwari, R.; Chakraborty, S.; Dhama, K. Oxidative Stress, Prooxidants, and Antioxidants: The Interplay. BioMed Res. Int. 2014, 2014, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Prochazkova, D.; Boušová, I.; Wilhelmová, N. Antioxidant and prooxidant properties of flavonoids. In Fitoterapia; Elsevier: Amsterdam, The Netherlands, 2011. [Google Scholar] [CrossRef]
- Vancamelbeke, M.; Vermeire, S. The intestinal barrier: A fundamental role in health and disease. Expert Rev. Gastroenterol. Hepatol. 2017, 11, 821–834. [Google Scholar] [CrossRef] [PubMed]
- Farré, R.; Fiorani, M.; Rahiman, S.A.; Matteoli, G. Intestinal Permeability, Inflammation and the Role of Nutrients. Nutrients 2020, 12, 1185. [Google Scholar] [CrossRef]
- Gu, X.; Hao, Y.; Wang, X. Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 2. Intestinal oxidative stress. Poult. Sci. 2012, 91, 790–799. [Google Scholar] [CrossRef] [PubMed]
- Santos, R.R.; Awati, A.; Hil, P.J.R.-V.D.; Tersteeg-Zijderveld, M.H.G.; Koolmees, P.A.; Fink-Gremmels, J. Quantitative histo-morphometric analysis of heat-stress-related damage in the small intestines of broiler chickens. Avian Pathol. 2014, 44, 19–22. [Google Scholar] [CrossRef]
- Barreau, F.; Hugot, J. Intestinal barrier dysfunction triggered by invasive bacteria. Curr. Opin. Microbiol. 2014, 17, 91–98. [Google Scholar] [CrossRef]
- Chelakkot, C.; Ghim, J.; Ryu, S.H. Mechanisms regulating intestinal barrier integrity and its pathological implications. Exp. Mol. Med. 2018, 50, 1–9. [Google Scholar] [CrossRef]
- Quinteiro-Filho, W.M.; Gomes, A.V.S.; Pinheiro, M.L.; Ribeiro, A.; Ferraz-De-Paula, V.; Astolfi-Ferreira, C.S.; Ferreira, A.J.P.; Palermo-Neto, J. Heat stress impairs performance and induces intestinal inflammation in broiler chickens infected withSalmonellaEnteritidis. Avian Pathol. 2012, 41, 421–427. [Google Scholar] [CrossRef]
- Burkholder, K.M.; Thompson, K.L.; Einstein, M.E.; Applegate, T.; Patterson, J.A. Influence of Stressors on Normal Intestinal Microbiota, Intestinal Morphology, and Susceptibility to Salmonella Enteritidis Colonization in Broilers. Poult. Sci. 2008, 87, 1734–1741. [Google Scholar] [CrossRef]
- Quinteiro-Filho, W.M.; Ribeiro, A.; Ferraz-De-Paula, V.; Pinheiro, M.L.; Sakai, M.; Sá, L.R.M.; Ferreira, A.J.P.; Palermo-Neto, J. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci. 2010, 89, 1905–1914. [Google Scholar] [CrossRef] [PubMed]
- Amoroso, C.; Perillo, F.; Strati, F.; Fantini, M.; Caprioli, F.; Facciotti, F. The Role of Gut Microbiota Biomodulators on Mucosal Immunity and Intestinal Inflammation. Cells 2020, 9, 1234. [Google Scholar] [CrossRef] [PubMed]
- Sitjà-Bobadilla, A.; Estensoro, I.; Pérez-Sánchez, J. Immunity to gastrointestinal microparasites of fish. Dev. Comp. Immunol. 2016, 64, 187–201. [Google Scholar] [CrossRef] [PubMed]
- Vasemägi, A.; Visse, M.; Kisand, V. Effect of Environmental Factors and an Emerging Parasitic Disease on Gut Microbiome of Wild Salmonid Fish. mSphere 2017, 2, e00418-17. [Google Scholar] [CrossRef] [PubMed]
- Lazzarotto, V.; Médale, F.; Larroquet, L.; Corraze, G. Long-term dietary replacement of fishmeal and fish oil in diets for rainbow trout (Oncorhynchus mykiss): Effects on growth, whole body fatty acids and intestinal and hepatic gene expression. PLoS ONE 2018, 13, e0190730. [Google Scholar] [CrossRef]
- Naylor, R.L.; Hardy, R.W.; Bureau, D.P.; Chiu, A.; Elliott, M.; Farrell, A.P.; Forster, I.; Gatlin, D.M.; Goldburg, R.J.; Hua, K.; et al. Feeding aquaculture in an era of finite resources. Proc. Natl. Acad. Sci. USA 2009, 106, 15103–15110. [Google Scholar] [CrossRef]
- Ulloa, P.E.; Medrano, J.F.; Feijoo, C.G. Zebrafish as animal model for aquaculture nutrition research. Front. Genet. 2014, 5, 313. [Google Scholar] [CrossRef]
- Teame, T.; Zhang, Z.; Ran, C.; Zhang, H.; Yang, Y.; Ding, Q.; Xie, M.; Gao, C.; Ye, Y.; Duan, M.; et al. The use of zebrafish (Danio rerio) as biomedical models. Anim. Front. 2019, 9, 68–77. [Google Scholar] [CrossRef]
- Jørgensen, L.V.G. Zebrafish as a Model for Fish Diseases in Aquaculture. Pathogens 2020, 9, 609. [Google Scholar] [CrossRef]
- Brugman, S. The zebrafish as a model to study intestinal inflammation. Dev. Comp. Immunol. 2016, 64, 82–92. [Google Scholar] [CrossRef]
- Nadal, A.L.; Ikeda-Ohtsubo, W.; Sipkema, D.; Peggs, D.; McGurk, C.; Forlenza, M.; Wiegertjes, G.F.; Brugman, S. Feed, Microbiota, and Gut Immunity: Using the Zebrafish Model to Understand Fish Health. Front. Immunol. 2020, 11. [Google Scholar] [CrossRef]
- Coccia, E.; Siano, F.; Volpe, M.G.; Varricchio, E.; Eroldogan, O.T.; Paolucci, M. Chestnut Shell Extract Modulates Immune Parameters in the Rainbow Trout Oncorhynchus mykiss. Fishes 2019, 4, 18. [Google Scholar] [CrossRef]
- Van Doan, H.; Hoseinifar, S.H.; Hung, T.Q.; Lumsangkul, C.; Jaturasitha, S.; El-Haroun, E.; Paolucci, M. Dietary inclusion of chestnut (Castanea sativa) polyphenols to Nile tilapia reared in biofloc technology: Impacts on growth, immunity, and disease resistance against Streptococcus agalactiae. Fish. Shellfish. Immunol. 2020, 105, 319–326. [Google Scholar] [CrossRef]
- Safari, R.; Hoseinifar, S.H.; Imanpour, M.R.; Mazandarani, M.; Sanchouli, H.; Paolucci, M. Effects of dietary polyphenols on mucosal and humoral immune responses, antioxidant defense and growth gene expression in beluga sturgeon (Huso huso). Aquaculture 2020, 528, 735494. [Google Scholar] [CrossRef]
- Hoseinifar, S.H.; Jahazi, M.A.; Nikdehghan, N.; Van Doan, H.; Volpe, M.G.; Paolucci, M. Effects of dietary polyphenols from agricultural by-products on mucosal and humoral immune and antioxidant responses of convict cichlid (Amatitlania nigrofasciata). Aquaculture 2020, 517, 734790. [Google Scholar] [CrossRef]
- Jahazi, M.A.; Hoseinifar, S.H.; Jafari, J.; Hajimoradloo, A.; Van Doan, H.; Paolucci, M. Dietary supplementation of poly-phenols positively affects the innate immune response, oxidative status, and growth performance of common carp, Cy-prinus carpio L. Aquaculture 2020, 517, 734709. [Google Scholar] [CrossRef]
- Villamil, L.; Villamil, S.I.; Rozo, G.; Rojas, J. Effect of dietary administration of kappa carrageenan extracted from Hypnea musciformis on innate immune response, growth, and survival of Nile tilapia (Oreochromis niloticus). Aquac. Int. 2019, 27, 53–62. [Google Scholar] [CrossRef]
- Tobacman, J.K. Review of harmful gastrointestinal effects of carrageenan in animal experiments. Environ. Health Perspect. 2001, 109, 983–994. [Google Scholar] [CrossRef] [PubMed]
- Martino, J.V.; Van Limbergen, J.; Cahill, L.E. The Role of Carrageenan and Carboxymethylcellulose in the Development of Intestinal Inflammation. Front. Pediatr. 2017, 5, 96. [Google Scholar] [CrossRef]
- Mohan, K.; Ravichandran, S.; Muralisankar, T.; Uthayakumar, V.; Chandirasekar, R.; Seedevi, P.; Abirami, R.; Rajan, D.K. Application of marine-derived polysaccharides as immunostimulants in aquaculture: A review of current knowledge and further perspectives. Fish. Shellfish. Immunol. 2019, 86, 1177–1193. [Google Scholar] [CrossRef]
- Singleton, V.L.; Rossi, J.A. Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. Am. J. Enol. Vitic. 1965, 16, 144–158. [Google Scholar]
- Picariello, G.; De Vito, V.; Ferranti, P.; Paolucci, M.; Volpe, M.G. Species- and cultivar-dependent traits of Prunus avium and Prunus cerasus polyphenols. J. Food Compos. Anal. 2016, 45, 50–57. [Google Scholar] [CrossRef]
- Ettore, V.; Finizia, R.; Elena, C.; Giovanni, T.; David, F.; Paolo, D.G.; Marina, P. Immunohistochemical and immunological detection of ghrelin and leptin in rainbow trout Oncorhynchus mykiss and murray cod Maccullochella peelii peelii as affected by different dietary fatty acids. Microsc. Res. Tech. 2012, 75, 771–780. [Google Scholar] [CrossRef] [PubMed]
- Imperatore, R.; Coccia, E.; D’Angelo, L.; Varricchio, E.; De Girolamo, P.; Paolucci, M. Evidence for leptin receptor immunoreactivity in the gastrointestinal tract and gastric leptin regulation in the rainbow trout (Oncorhynchus mykiss). Ann. Anat. Anat. Anz. 2018, 220, 70–78. [Google Scholar] [CrossRef] [PubMed]
- Imperatore, R.; D’Angelo, L.; De Girolamo, P.; Cristino, L.; Paolucci, M. Identification of Orexin and Endocannabinoid Receptors in Adult Zebrafish Using Immunoperoxidase and Immunofluorescence Methods. J. Vis. Exp. 2019, 25, e59308. [Google Scholar] [CrossRef] [PubMed]
- Imperatore, R.; Tunisi, L.; Mavaro, I.; D’Angelo, L.; Attanasio, C.; Safari, O.; Motlagh, H.A.; De Girolamo, P.; Cristino, L.; Varricchio, E.; et al. Immunohistochemical Analysis of Intestinal and Central Nervous System Morphology in an Obese Animal Model (Danio rerio) Treated with 3,5-T2: A Possible Farm Management Practice? Animals 2020, 10, 1131. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Xia, J.; Pan, Z.; Yang, J.; Wang, W.; Fu, Z. Polystyrene microplastics induce microbiota dysbiosis and inflammation in the gut of adult zebrafish. Environ. Pollut. 2018, 235, 322–329. [Google Scholar] [CrossRef] [PubMed]
- Rassier, G.T.; Silveira, T.L.R.; Remião, M.H.; Daneluz, L.O.; Martins, A.W.S.; Dellagostin, E.N.; Ortiz, H.G.; Domingues, W.B.; Komninou, E.R.; Kütter, M.T.; et al. Evaluation of qPCR reference genes in GH-overexpressing transgenic zebrafish (Danio rerio). Sci. Rep. 2020, 10, 1–15. [Google Scholar] [CrossRef]
- Luo, T.; Wang, X.; Jin, Y. Low concentrations of imidacloprid exposure induced gut toxicity in adult zebrafish (Danio rerio). Comp. Biochem. Physiol. Part. C Toxicol. Pharmacol. 2021, 241, 108972. [Google Scholar] [CrossRef]
- Cirmi, S.; Randazzo, B.; Russo, C.; Musumeci, L.; Maugeri, A.; Montalbano, G.; Guerrera, M.C.; Lombardo, G.E.; Levanti, M. Anti-inflammatory effect of a flavonoid-rich extract of orange juice in adult zebrafish subjected toVibrio anguillarum-induced enteritis. Nat. Prod. Res. 2020, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Klindworth, A.; Pruesse, E.; Schweer, T.; Peplies, J.; Quast, C.; Horn, M.; Glöckner, F.O. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 2012, 41, e1. [Google Scholar] [CrossRef] [PubMed]
- Schloss, P.D.; Westcott, S.L.; Ryabin, T.; Hall, J.R.; Hartmann, M.; Hollister, E.B.; Lesniewski, R.A.; Oakley, B.B.; Parks, D.H.; Robinson, C.J.; et al. Introducing mothur: Open-Source, Platform-Independent, Community-Supported Software for Describing and Comparing Microbial Communities. Appl. Environ. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME Allows Analysis of High-Throughput Community Sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460–2461. [Google Scholar] [CrossRef] [PubMed]
- Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree 2 Approximately Maximum-Likelihood Trees for Large Alignments. PLoS ONE 2010, 5, e9490. [Google Scholar] [CrossRef] [PubMed]
- Lozupone, C.; Knight, R. UniFrac: A New Phylogenetic Method for Comparing Microbial Communities. Appl. Environ. Microbiol. 2005, 71, 8228–8235. [Google Scholar] [CrossRef] [PubMed]
- Oksanen, J.; Blanchet, F.G.; Friendly, M.; Kindt, R.; Legendre, P.; McGlinn, D.; Minchin, P.R.; O’Hara, R.B.; Simspon, G.L.; Solymos, P.; et al. Vegan: Community Ecology Package. R Package Version 2.5-4. 2019. Available online: https://CRAN.R-project.org/package=vegan. (accessed on 20 August 2020).
- Salazar, G. EcolUtils: Utilities for community ecology analysis. R package version 0.1. 2018. Available online: https://github.com/GuillemSalazar/EcolUtils (accessed on 20 August 2020).
- Chen, W.; Simpson, J.; Levesque, C.A. RAM: R for Amplicon-Sequencing-Based Microbial-Ecology. R package version 1.2.1.7. 2018. Available online: https://CRAN.R-project.org/package=RAM (accessed on 13 November 2020).
- Sorice, A.; Siano, F.; Capone, F.; Guerriero, E.; Picariello, G.; Budillon, A.; Ciliberto, G.; Paolucci, M.; Costantini, S.; Volpe, M.G. Potential Anticancer Effects of Polyphenols from Chestnut Shell Extracts: Modulation of Cell Growth, and Cytokinomic and Metabolomic Profiles. Molecules 2016, 21, 1411. [Google Scholar] [CrossRef]
- He, Q.; Wang, L.; Wang, F.; Wang, C.; Tang, C.; Li, Q.; Li, J.; Zhao, Q. Microbial fingerprinting detects intestinal microbiota dysbiosis in Zebrafish models with chemically-induced enterocolitis. BMC Microbiol. 2013, 13, 289. [Google Scholar] [CrossRef] [PubMed]
- Urán, P.; Gonçalves, A.; Taverne-Thiele, J.; Schrama, J.; Verreth, J.; Rombout, J. Soybean meal induces intestinal inflammation in common carp (Cyprinus carpio L.). Fish. Shellfish. Immunol. 2008, 25, 751–760. [Google Scholar] [CrossRef]
- Krogdahl, Å.; Bakke-McKellep, A.; Baeverfjord, G. Effects of graded levels of standard soybean meal on intestinal structure, mucosal enzyme activities, and pancreatic response in Atlantic salmon (Salmo salar L.). Aquac. Nutr. 2003, 9, 361–371. [Google Scholar] [CrossRef]
- Arias-Jayo, N.; Abecia, L.; Alonso-Sáez, L.; Ramirez-Garcia, A.; Rodriguez, A.; Pardo, M.A. High-Fat Diet Consumption Induces Microbiota Dysbiosis and Intestinal Inflammation in Zebrafish. Microb. Ecol. 2018, 76, 1089–1101. [Google Scholar] [CrossRef]
- Fehrmann-Cartes, K.; Coronado, M.; Hernández, A.; Allende, M.; Feijoo, C. Anti-inflammatory effects of aloe vera on soy meal-induced intestinal inflammation in zebrafish. Fish. Shellfish. Immunol. 2019, 95, 564–573. [Google Scholar] [CrossRef]
- Huang, S.-Y.; Feng, C.-W.; Hung, H.-C.; Chakraborty, C.; Chen, C.-H.; Chen, W.-F.; Jean, Y.-H.; Wang, H.-M.D.; Sung, C.-S.; Sun, Y.-M.; et al. A Novel Zebrafish Model to Provide Mechanistic Insights into the Inflammatory Events in Carrageenan-Induced Abdominal Edema. PLoS ONE 2014, 9, e104414. [Google Scholar] [CrossRef] [PubMed]
- Ekambaram, S.P.; Perumal, S.S.; Pavadai, S. Anti-inflammatory effect of Naravelia zeylanica DC via suppression of inflammatory mediators in carrageenan-induced abdominal oedema in zebrafish model. Inflammopharmacology 2017, 25, 147–158. [Google Scholar] [CrossRef] [PubMed]
- Marcus, S.N.; Marcus, A.J.; Marcus, R.; Ewen, S.W.; Watt, J. The pre-ulcerative phase of carrageenan-induced colonic ulceration in the guinea-pig. Int. J. Exp. Pathol. 1992, 73, 515–526. [Google Scholar] [PubMed]
- Wei, W.; Feng, W.; Xin, G.; Tingting, N.; Zhanghe, Z.; Haimin, C.; Xiaojun, Y. Enhanced effect of κ-carrageenan on TNBS-induced inflammation in mice. Int. Immunopharmacol. 2016, 39, 218–228. [Google Scholar] [CrossRef]
- Borthakur, A.; Bhattacharyya, S.; Dudeja, P.K.; Tobacman, J.K. Carrageenan induces interleukin-8 production through distinct Bcl10 pathway in normal human colonic epithelial cells. Am. J. Physiol. Liver Physiol. 2007, 292, G829–G838. [Google Scholar] [CrossRef]
- Park, M.; Cho, H.; Jung, H.; Lee, H.; Hwang, K.T. Antioxidant and Anti-Inflammatory Activities of Tannin Fraction of the Extract from Black Raspberry Seeds Compared to Grape Seeds. J. Food Biochem. 2013, 38, 259–270. [Google Scholar] [CrossRef]
- Fumagalli, M.; SanGiovanni, E.; Vrhovsek, U.; Piazza, S.; Colombo, E.; Gasperotti, M.; Mattivi, F.; De Fabiani, E.; Dell’Agli, M. Strawberry tannins inhibit IL-8 secretion in a cell model of gastric inflammation. Pharmacol. Res. 2016, 111, 703–712. [Google Scholar] [CrossRef]
- Gong, X.; Jiang, S.; Tian, H.; Xiang, D.; Zhang, J. Polyphenols in the Fermentation Liquid of Dendrobium candidum Relieve Intestinal Inflammation in Zebrafish Through the Intestinal Microbiome-Mediated Immune Response. Front. Immunol. 2020, 11, 1542. [Google Scholar] [CrossRef]
- Comalada, M.; Ballester, I.; Bailón, E.; Sierra, S.; Xaus, J.; Gálvez, J.; de Medina, F.S.; Zarzuelo, A. Inhibition of pro-inflammatory markers in primary bone marrow-derived mouse macrophages by naturally occurring flavonoids: Analysis of the structure–activity relationship. Biochem. Pharmacol. 2006, 72, 1010–1021. [Google Scholar] [CrossRef] [PubMed]
- Boshtam, M.; Asgary, S.; Kouhpayeh, S.; Shariati, L.; Khanahmad, H. Aptamers Against Pro- and Anti-Inflammatory Cytokines: A Review. Inflammatory 2017, 40, 340–349. [Google Scholar] [CrossRef] [PubMed]
- Pessina, A.; Di Vincenzo, M.; Maradonna, F.; Marchegiani, F.; Olivieri, F.; Randazzo, B.; Gioacchini, G.; Carnevali, O. Polydatin Beneficial Effects in Zebrafish Larvae Undergoing Multiple Stress Types. Int. J. Environ. Res. Public Heal. 2021, 18, 1116. [Google Scholar] [CrossRef]
- Yahfoufi, N.; Alsadi, N.; Jambi, M.; Matar, C. The Immunomodulatory and Anti-Inflammatory Role of Polyphenols. Nutrients 2018, 10, 1618. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.P.; Son, K.H.; Chang, H.W.; Kang, S.S. Anti-inflammatory Plant Flavonoids and Cellular Action Mechanisms. J. Pharmacol. Sci. 2004, 96, 229–245. [Google Scholar] [CrossRef] [PubMed]
- Yoon, J.-H.; Baek, S.J. Molecular Targets of Dietary Polyphenols with Anti-inflammatory Properties. Yonsei Med. J. 2005, 46, 585–596. [Google Scholar] [CrossRef]
- Santangelo, C.; Varì, R.; Scazzocchio, B.; Di Benedetto, R.; Filesi, C.; Masella, R. Polyphenols, intracellular signalling and inflammation. Ann. Ist. Super Sanita 2007, 43, 394–405. [Google Scholar]
- Malireddy, S.; Kotha, S.R.; Secor, J.D.; Gurney, T.O.; Abbott, J.L.; Maulik, G.; Maddipati, K.R.; Parinandi, N.L. Phytochemical Antioxidants Modulate Mammalian Cellular Epigenome: Implications in Health and Disease. Antioxid. Redox Signal. 2012, 17, 327–339. [Google Scholar] [CrossRef]
- Hussain, T.; Tan, B.; Yin, Y.; Blachier, F.; Tossou, M.C.B.; Rahu, N. Oxidative Stress and Inflammation: What Polyphenols Can Do for Us? Oxid. Med. Cell. Longev. 2016. [Google Scholar] [CrossRef]
- Grishin, A.V.; Wang, J.; Potoka, D.A.; Hackam, D.J.; Upperman, J.S.; Boyle, P.; Zamora, R.; Ford, H.R. Lipopolysaccharide Induces Cyclooxygenase-2 in Intestinal Epithelium via a Noncanonical p38 MAPK Pathway. J. Immunol. 2005, 176, 580–588. [Google Scholar] [CrossRef]
- Cárdeno, A.; Sánchez-Hidalgo, M.; Alarcón-De-La-Lastra, C. An up-date of olive oil phenols in inflammation and cancer: Molecular mechanisms and clinical implications. Curr. Med. Chem. 2013, 20, 4758–4776. [Google Scholar] [CrossRef] [PubMed]
- Prata, M.; Charlie-Silva, I.; Gomes, J.; Barra, A.; Berg, B.; Paiva, I.; Melo, D.; Klein, A.; Romero, M.C.; Oliveira, C.; et al. Anti-inflammatory and immune properties of the peltatoside, isolated from the leaves of Annona crassiflora Mart., in a new experimental model zebrafish. Fish. Shellfish. Immunol. 2020, 101, 234–243. [Google Scholar] [CrossRef]
- Mestecky, J.; Russell, M.; Elson, C.O. Intestinal IgA: Novel views on its function in the defence of the largest mucosal surface. Gut 1999, 44, 2–5. [Google Scholar] [CrossRef]
- Ouwehand, A.; Isolauri, E.; Salminen, S. The role of the intestinal microflora for the development of the immune system in early childhood. Eur. J. Nutr. 2002, 41, 1. [Google Scholar] [CrossRef] [PubMed]
- Preidis, G.A.; Ajami, N.J.; Wong, M.C.; Bessard, B.C.; Conner, M.E.; Petrosino, J.F. Composition and function of the un-dernourished neonatal mouse intestinal microbiome. J. Nutr. Biochem. 2015, 26, 1050–1057. [Google Scholar] [CrossRef] [PubMed]
- Xia, J.; Lu, L.; Jin, C.; Wang, S.; Zhou, J.; Ni, Y.; Fu, Z.; Jin, Y. Effects of short term lead exposure on gut microbiota and hepatic metabolism in adult zebrafish. Comp. Biochem. Physiol. Part. C Toxicol. Pharmacol. 2018, 209, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Da Silva, L.M.R.; Lima, J.D.S.S.; Magalhães, F.E.A.; Campos, A.R.; De Araújo, J.I.F.; Batista, F.L.A.; De Araújo, S.M.B.; De Sousa, P.H.M.; Lima, G.C.; Holanda, D.K.R.; et al. Graviola Fruit Bar Added Acerola By-Product Extract Protects Against Inflammation and Nociception in Adult Zebrafish (Danio rerio). J. Med. Food 2020, 23, 173–180. [Google Scholar] [CrossRef] [PubMed]
- Peuhkuri, K. Even low-grade inflammation impacts on small intestinal function. World J. Gastroenterol. 2010, 16, 1057–1062. [Google Scholar] [CrossRef]
- Nathan, C. Neutrophils and immunity: Challenges and opportunities. Nat. Rev. Immunol. 2006, 6, 173–182. [Google Scholar] [CrossRef]
- Nathan, C. Points of control in inflammation. Nat. Cell Biol. 2002, 420, 846–852. [Google Scholar] [CrossRef]
- Webb, C.R.; Koboziev, I.; Furr, K.L.; Grisham, M.B. Protective and pro-inflammatory roles of intestinal bacteria. Pathophysiology 2016, 23, 67–80. [Google Scholar] [CrossRef]
- Bates, J.M.; Akerlund, J.; Mittge, E.; Guillemin, K. Intestinal Alkaline Phosphatase Detoxifies Lipopolysaccharide and Prevents Inflammation in Zebrafish in Response to the Gut Microbiota. Cell Host Microbe 2007, 2, 371–382. [Google Scholar] [CrossRef] [PubMed]
- Galindo-Villegas, J.; Garcia-Moreno, D.; De Oliveira, S.; Meseguer, J.; Mulero, V. Regulation of immunity and disease resistance by commensal microbes and chromatin modifications during zebrafish development. Proc. Natl. Acad. Sci. USA 2012, 109, E2605–E2614. [Google Scholar] [CrossRef] [PubMed]
- Fawley, J.; Koehler, S.; Cabrera, S.; Lam, V.; Fredrich, K.; Hessner, M.; Salzman, N.; Gourlay, D. Intestinal alkaline phosphatase deficiency leads to dysbiosis and bacterial translocation in the newborn intestine. J. Surg. Res. 2017, 218, 35–42. [Google Scholar] [CrossRef] [PubMed]
- Roeselers, G.; Mittge, E.K.; Stephens, W.Z.; Parichy, D.M.; Cavanaugh, C.M.; Guillemin, K.; Rawls, J.F. Evidence for a core gut microbiota in the zebrafish. ISME J. 2011, 5, 1595–1608. [Google Scholar] [CrossRef] [PubMed]
- Stephens, W.Z.; Burns, A.R.; Stagaman, K.; Wong, S.; Rawls, J.F.; Guillemin, K.; Bohannan, B.J.M. The composition of the zebrafish intestinal microbial community varies across development. ISME J. 2016, 10, 644–654. [Google Scholar] [CrossRef]
- Cholan, P.M.; Han, A.; Woodie, B.R.; Watchon, M.; Kurz, A.R.; Laird, A.S.; Britton, W.J.; Ye, L.; Holmes, Z.C.; McCann, J.R.; et al. Conserved anti-inflammatory effects and sensing of butyrate in zebrafish. Gut Microbes 2020, 12, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Walburn, J.W.; Wemheuer, B.; Thomas, T.; Copeland, E.; O’Connor, W.; Booth, M.; Fielder, S.; Egan, S. Diet and diet-associated bacteria shape early microbiome development in Yellowtail Kingfish (Seriola lalandi). Microb. Biotechnol. 2019, 12, 275–288. [Google Scholar] [CrossRef]
- Chen, L.; Zhang, W.; Hua, J.; Hu, C.; Lai, N.L.-S.; Qian, P.-Y.; Lam, P.K.S.; Lam, J.C.W.; Zhou, B. Dysregulation of Intestinal Health by Environmental Pollutants: Involvement of the Estrogen Receptor and Aryl Hydrocarbon Receptor. Environ. Sci. Technol. 2018, 52, 2323–2330. [Google Scholar] [CrossRef]
- Li, X.; Zhou, L.; Yu, Y.; Ni, J.; Xu, W.; Yan, Q. Composition of Gut Microbiota in the Gibel Carp (Carassius auratus gibelio) Varies with Host Development. Microb. Ecol. 2017, 74, 239–249. [Google Scholar] [CrossRef]
- Zheng, M.; Lu, J.; Lin, G.; Su, H.; Sun, J.; Luan, T. Dysbiosis of gut microbiota by dietary exposure of three graphene-family materials in zebrafish (Danio rerio). Environ. Pollut. 2019, 254, 112969. [Google Scholar] [CrossRef]
- Gaulke, C.A.; Barton, C.L.; Proffitt, S.; Tanguay, R.L.; Sharpton, T.J. Triclosan Exposure Is Associated with Rapid Restructuring of the Microbiome in Adult Zebrafish. PLoS ONE 2016, 11, e0154632. [Google Scholar] [CrossRef] [PubMed]
- Gu, W.; Tong, P.; Liu, C.; Wang, W.; Lu, C.; Han, Y.; Sun, X.; Kuang, D.X.; Li, N.; Dai, J. The characteristics of gut microbiota and commensal Enterobacteriaceae isolates in tree shrew (Tupaia belangeri). BMC Microbiol. 2019, 19, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Martinson, J.N.V.; Pinkham, N.V.; Peters, G.W.; Cho, H.; Heng, J.; Rauch, M.; Broadaway, S.C.; Walk, S.T. Rethinking gut microbiome residency and the Enterobacteriaceae in healthy human adults. ISME J. 2019, 13, 2306–2318. [Google Scholar] [CrossRef]
- Cámara-Ruiz, M.; Balebona, M.C.; Moriñigo, M.Á.; Esteban, M.Á. Probiotic Shewanella putrefaciens (SpPdp11) as a Fish Health Modulator: A Review. Microorganism 2020, 8, 1990. [Google Scholar] [CrossRef] [PubMed]
- Toranzo, A.E.; Magariños, B.; Romalde, J.L. A review of the main bacterial fish diseases in mariculture systems. Aquaculture 2005, 246, 37–61. [Google Scholar] [CrossRef]
- Besten, G.D.; van Eunen, K.; Groen, A.K.; Venema, K.; Reijngoud, D.-J.; Bakker, B.M. The role of short-chain fatty acids in the interplay between diet, gut microbiota, and host energy metabolism. J. Lipid Res. 2013, 54, 2325–2340. [Google Scholar] [CrossRef]
- Venegas, D.P.; De La Fuente, M.K.; Landskron, G.; González, M.J.; Quera, R.; Dijkstra, G.; Harmsen, H.J.M.; Faber, K.N.; Hermoso, M.A. Short Chain Fatty Acids (SCFAs)-Mediated Gut Epithelial and Immune Regulation and Its Relevance for Inflammatory Bowel Diseases. Front. Immunol. 2019, 10, 277. [Google Scholar] [CrossRef] [PubMed]
- Jin, C.; Luo, T.; Zhu, Z.; Pan, Z.; Yang, J.; Wang, W.; Fu, Z.; Jin, Y. Imazalil exposure induces gut microbiota dysbiosis and hepatic metabolism disorder in zebrafish. Comp. Biochem. Physiol. Part. C Toxicol. Pharmacol. 2017, 202, 85–93. [Google Scholar] [CrossRef]
- Tsuchiya, C.; Sakata, T.; Sugita, H. Novel ecological niche of Cetobacterium somerae, an anaerobic bacterium in the intestinal tracts of freshwater fish. Lett. Appl. Microbiol. 2007, 46, 43–48. [Google Scholar] [CrossRef]
- Van Kessel, M.A.; Dutilh, B.E.; Neveling, K.; Kwint, M.P.; Veltman, A.J.; Flik, G.; Jetten, M.S.; Klaren, P.H.; Camp, H.J.O.D. Pyrosequencing of 16S rRNA gene amplicons to study the microbiota in the gastrointestinal tract of carp (Cyprinus carpio L.). AMB Express 2011, 1, 41. [Google Scholar] [CrossRef]
- Hao, Y.T.; Wu, S.G.; Xiong, F.; Tran, N.T.; Jakovlić, I.; Zou, H.; Li, W.X.; Wang, G.T. Succession and Fermentation Products of Grass Carp (Ctenopharyngodon idellus) Hindgut Microbiota in Response to an Extreme Dietary Shift. Front. Microbiol. 2017, 8, 1585. [Google Scholar] [CrossRef]
- Qiao, R.; Deng, Y.; Zhang, S.; Wolosker, M.B.; Zhu, Q.; Ren, H.; Zhang, Y. Accumulation of different shapes of microplastics initiates intestinal injury and gut microbiota dysbiosis in the gut of zebrafish. Chemosphere 2019, 236, 124334. [Google Scholar] [CrossRef]
- Osimani, A.; Milanović, V.; Roncolini, A.; Riolo, P.; Ruschioni, S.; Isidoro, N.; Loreto, N.; Franciosi, E.; Tuohy, K.; Olivotto, I.; et al. Hermetia illucens in diets for zebrafish (Danio rerio): A study of bacterial diversity by using PCR-DGGE and metagenomic sequencing. PLoS ONE 2019, 14, e0225956. [Google Scholar] [CrossRef] [PubMed]
- Smith, A.H.; Mackie, R.I. Effect of Condensed Tannins on Bacterial Diversity and Metabolic Activity in the Rat Gastrointestinal Tract. Appl. Environ. Microbiol. 2004, 70, 1104–1115. [Google Scholar] [CrossRef] [PubMed]
- Mirpuri, J.; Raetz, M.; Sturge, C.R.; Wilhelm, C.L.; Benson, A.; Savani, R.C.; Hooper, L.V.; Yarovinsky, F. Proteobacteria-specific IgA regulates maturation of the intestinal microbiota. Gut Microbes 2013, 5, 28–39. [Google Scholar] [CrossRef] [PubMed]
- Shin, N.-R.; Whon, T.W.; Bae, J.-W. Proteobacteria: Microbial signature of dysbiosis in gut microbiota. Trends Biotechnol. 2015, 33, 496–503. [Google Scholar] [CrossRef] [PubMed]
- Langille, M.G.I.; Zaneveld, J.; Caporaso, J.G.; McDonald, D.; Knights, D.; Reyes, J.A.; Clemente, J.C.; Burkepile, D.E.; Thurber, R.L.V.; Knight, R.; et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 2013, 31, 814–821. [Google Scholar] [CrossRef] [PubMed]
- Luo, C.; Yi, C.; Ni, L.; Guo, L. Characterization of dominant and cellulolytic bacterial communities along the gut of silver carp Hypophthalmichthys molitrix during cyanobacterial blooms. Chin. J. Oceanol. Limnol. 2017, 35, 624–633. [Google Scholar] [CrossRef]
- Selma, M.V.; Espín, J.C.; Tomás-Barberán, F.A. Interaction between Phenolics and Gut Microbiota: Role in Human Health. J. Agric. Food Chem. 2009, 57, 6485–6501. [Google Scholar] [CrossRef] [PubMed]
- Farshkhahi, F.; Delazar, A.; Memar, M.Y. Antibacterial and antibiofilm activity of grape seed extract against carbapenem resistant and biofilm producer Enterobacteriaceae. Res. J. Pharmacogn. 2018, 5, 33–40. [Google Scholar]
- Dhara, L.; Tripathi, A. Cinnamaldehyde: A compound with antimicrobial and synergistic activity against ESBL-producing quinolone-resistant pathogenic Enterobacteriaceae. Eur. J. Clin. Microbiol. Infect. Dis. 2019, 39, 65–73. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Liu, L.-L.; Wang, X.-W.; Guo, C.-Y.; Zhu, H. Dietary tea polyphenols induce changes in immune response and intestinal microbiota in Koi carp, cryprinus carpio. Aquaculture 2020, 516, 734636. [Google Scholar] [CrossRef]
- Hoque, F.; Abraham, T.J.; Nagesh, T.S.; Kamilya, D. Pseudomonas aeruginosa FARP72 Offers Protection Against Aeromonas hydrophila Infection in Labeo rohita. Probiotics Antimicrob. Proteins 2019, 11, 973–980. [Google Scholar] [CrossRef]
- Nayak, S. Probiotics and immunity: A fish perspective. Fish. Shellfish. Immunol. 2010, 29, 2–14. [Google Scholar] [CrossRef] [PubMed]
- Gatesoupe, F.J. Live yeasts in the gut: Natural occurrence, dietary introduction, and their effects on fish health and de-velopment. Aquaculture 2007, 267, 20–30. [Google Scholar] [CrossRef]
- Romero, J.; Ringø, E.; Merrifield, D.L. The Gut Microbiota of Fish. In Aquaculture Nutrition; Wiley: Hoboken, NJ, USA, 2014; pp. 75–100. [Google Scholar]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
β-Actin | TCTCTTAAGTCGACAACCCCC | TCTGAGCCTCATCACCAAG |
COX-2A | AGGGCGTGTGTTTATCCAAG | ACCTGGACGTCCTTCATAAG |
IL-1β | TGGACTTCGCAGCACAAAATG | GTTCACTTCACGCTCTTGTG |
IL-8 | TGTGTTATTGTTTTCCTGGCATC | GCGACAGCGTGGATCTACG |
IL-10 | CACTGAACGAAAGTTTGCCTAC | TGGAAATGCATCTGGCTTTG |
TNFα | GCTTATGAGCCATGCAGTGA | TGCCCAGTCTGTCTCCTTCT |
tuba1 | CCTGCTGGGAACTGTATTGT | TCAATGAGTTCCTTGCCAAT |
Score | Intestinal Architecture Disruption | Goblet Cell Number | Leukocyte Infiltrate | |
---|---|---|---|---|
Intestinal Folds | Gut Lumen | |||
0 | Normal | Normal | Normal (~5 GC/villus) | Normal |
1 | Slight modification | Slight expansion | Increased number (~9 GC/villus) | Appearance of some leukocytes |
2 | Moderate modification | Moderate expansion | Increased number and different in size (~12 GC/villus) | Increased number of leukocytes in the lamina propria |
3 | Severe alteration with destruction of the epithelial surface | Severe alterations | Severe high number and morphological changes (~16 GC/villus) | Severe increase of leukocytes in the lamina propria and epithelium |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Orso, G.; Solovyev, M.M.; Facchiano, S.; Tyrikova, E.; Sateriale, D.; Kashinskaya, E.; Pagliarulo, C.; Hoseinifar, H.S.; Simonov, E.; Varricchio, E.; et al. Chestnut Shell Tannins: Effects on Intestinal Inflammation and Dysbiosis in Zebrafish. Animals 2021, 11, 1538. https://doi.org/10.3390/ani11061538
Orso G, Solovyev MM, Facchiano S, Tyrikova E, Sateriale D, Kashinskaya E, Pagliarulo C, Hoseinifar HS, Simonov E, Varricchio E, et al. Chestnut Shell Tannins: Effects on Intestinal Inflammation and Dysbiosis in Zebrafish. Animals. 2021; 11(6):1538. https://doi.org/10.3390/ani11061538
Chicago/Turabian StyleOrso, Graziella, Mikhail M. Solovyev, Serena Facchiano, Evgeniia Tyrikova, Daniela Sateriale, Elena Kashinskaya, Caterina Pagliarulo, Hossein S. Hoseinifar, Evgeniy Simonov, Ettore Varricchio, and et al. 2021. "Chestnut Shell Tannins: Effects on Intestinal Inflammation and Dysbiosis in Zebrafish" Animals 11, no. 6: 1538. https://doi.org/10.3390/ani11061538
APA StyleOrso, G., Solovyev, M. M., Facchiano, S., Tyrikova, E., Sateriale, D., Kashinskaya, E., Pagliarulo, C., Hoseinifar, H. S., Simonov, E., Varricchio, E., Paolucci, M., & Imperatore, R. (2021). Chestnut Shell Tannins: Effects on Intestinal Inflammation and Dysbiosis in Zebrafish. Animals, 11(6), 1538. https://doi.org/10.3390/ani11061538