Fermented Diet Liquid Feeding Improves Growth Performance and Intestinal Function of Pigs
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Fermented Feed and Its Quality Determination
2.2. Experimental Design and Animal Management
2.3. Sample Collection
2.4. Measurement of ATTD of Nutrients
2.5. Measurement of Enzyme Activities
2.6. Intestinal Morphology
2.7. Serum Hormone Parameters
2.8. DNA Extraction and Quantification of Intestinal Microflora
2.9. Microbial Metabolites Analysis
2.10. Statistical Analysis
3. Results
3.1. Quality of Fermented Feed
3.2. Growth Performance
3.3. Nutrient Digestibility
3.4. Enzyme Activities
3.5. Serum Hormone Parameters
3.6. Intestinal Morphology
3.7. Intestinal Microbiota
3.8. Intestinal Microbial Metabolites
4. Discussion
4.1. Quality of Fermented Feed
4.2. Growth Performance
4.3. Nutrient Digestibility
4.4. Intestinal Enzyme Activities and Morphology
4.5. Serum Hormone Parameters
4.6. Intestinal Microbiota and Microbial Metabolites
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| CON | Control group |
| AB | Antibiotic group |
| FLF | Fermented liquid feeding group |
| ATTD | Apparent total tract digestibility |
| BW | Body weight |
| ADFI | Average daily feed intake |
| ADG | Average daily gain |
| F/G | Feed/gain |
| DM | Dry matter |
| CP | Crude protein |
| EE | Ether extract |
| CA | Crude ash |
| CF | Crude fiber |
| GE | Gross energy |
| Ca | Calcium |
| TP | Total phosphorus |
| AIA | Acid insoluble ash |
| VFA | Volatile Fatty Acid |
| GH | Growth hormone |
| GLP-1 | Glucagon-like peptide-1 |
| CCK | Cholecystokinin |
| PYY | Peptide tyrosine tyrosine |
References
- Tostenson, B.; Tekeste, A.; Pangeni, D.; Manu, H.; Ren, P.; Yang, X.; Baidoo, S.K. Influence of ethanol co-products and barley on growth performance and carcass characteristics of growing-finishing pigs in liquid or dry feeding systems. J. Anim. Sci. 2017, 95, 43–44. [Google Scholar] [CrossRef] [Scilit]
- Hurst, D.; Clarke, L.; Lean, I.J. Effect of liquid feeding by different water-to-feed ratios on the growth performance of growing-finishing pigs. Animal 2008, 2, 1297–1302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Missotten, J.A.; Michiels, J.; Degroote, J.; Smet, S.D. Fermented liquid feed for pigs: An ancient technique for the future. J. Anim. Sci. Biotechnol. 2015, 6, 4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Price, K.L.; Lin, X.; Heugten, E.V.; Odle, R.; Willis, G.; Odle, J. Diet physical form, fatty acid chain length, and emulsification alter fat utilization and growth of newly weaned pigs. J. Anim. Sci. 2013, 91, 783–792. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, B.; Li, Z.; Wang, C.; Fu, J.; Lu, Z. Effects of fermented feed supplementation on pig growth performance: A meta-analysis. Anim. Feed Sci. Technol. 2020, 259, 114315. [Google Scholar] [CrossRef] [Scilit]
- Hao, L.; Su, W.; Zhang, Y.; Wang, C.; Lu, Z. Effects of supplementing with fermented mixed feed on the performance and meat quality in finishing pigs. Anim. Feed Sci. Technol. 2020, 266, 114501. [Google Scholar] [CrossRef] [Scilit]
- Huang, L.; Ren, P.; Ouyang, Z.; We, I.T.; He, Q. Effect of fermented feed on growth performance, holistic metabolism and fecal microbiota in weanling piglets. Anim. Feed Sci. Technol. 2020, 266, 114505. [Google Scholar] [CrossRef] [Scilit]
- Fan, L.; Dou, M.; Wang, X.; Han, Q.; Bo, Z.; Hu, J.; Yang, G.; Shi, X.E.; Li, X. Fermented corn-soybean meal elevated IGF1 levels in grower-finisher pigs. J. Anim. Sci. 2018, 96, 5144–5151. [Google Scholar] [CrossRef] [Scilit]
- Jones, C.K.; Derouchey, J.M.; Nelssen, J.L.; Tokach, M.D.; Goodband, R.D. Effects of fermented soybean meal and specialty animal protein sources on nursery pig performance. J. Anim. Sci. 2010, 88, 1725–1732. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Liu, X.T.; Wang, H.L.; Li, D.F.; Piao, X.S.; Lu, W.Q. Optimization of processing conditions for solid-state fermented soybean meal and its effects on growth performance and nutrient digestibility of weanling pigs. Livest. Sci. 2014, 170, 91–99. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.; Chang, J.; Yin, Q.; Min, L.; Lu, F. Fermented soybean meal improves the growth performance, nutrient digestibility, and microbial flora in piglets. Anim. Nutr. 2017, 3, 19–24. [Google Scholar]
- Blaabjerg, K.; Jorgensen, H.; Tauson, A.H.; Poulsen, H.D. The presence of inositol phosphates in gastric pig digesta is affected by time after feeding a nonfermented or fermented liquid wheat- and barley-based diet. J. Anim. Sci. 2011, 89, 3153–3162. [Google Scholar] [CrossRef] [Scilit]
- O’Meara, F.M.; Gardiner, G.E.; O’Doherty, J.V.; Clarke, D.; Cummins, W.; Lawlor, P.G. Effect of wet/dry, fresh liquid, fermented whole diet liquid, and fermented cereal liquid feeding on feed microbial quality and growth in grow-finisher pigs. J. Anim. Sci. 2020, 98, skaa166. [Google Scholar] [CrossRef] [Scilit]
- Wiseman, M.; Wey, D.; de Lange, C.F. Liquid feeding fermented DDGS to weanling pigs: Improvement of growth performance with added enzymes and microbial inoculants. J. Anim. Sci. 2016, 94, 50–51. [Google Scholar] [CrossRef] [Scilit]
- AOAC. Official Methods of Analysis, 16th ed.; Association of Official Analytical Chemists: Washington, DC, USA, 1995. [Google Scholar]
- GB/T, Feeding Stuffs―Determination of Crude Fiber Content Method with Intermediate Filtration; Standards Press of China: Beijing, China, 2006; p. 6434.
- GB/T, Determination of Calcium in Feeds; Standards Press of China: Beijing, China, 2018; p. 6436.
- GB/T, Determination of Phosphorus in Feeds; Standards Press of China: Beijing, China, 2018; p. 6437.
- GB/T, Determination of Soy Peptides Powder; Standards Press of China: Beijing, China, 2008; p. 22492.
- GB/T, Measurement of the Acid Insoluble Ash in Feed; Standards Press of China: Beijing, China, 2009; p. 23742.
- Touchette, K.J.; Carroll, J.A.; Allee, G.L.; Matteri, R.L.; Zannelli, M. Effect of spray-dried plasma and lipopolysaccharide exposure on weaned pigs: I. Effects on the immune axis of weaned pigs. J. Anim. Sci. 2002, 80, 494–501. [Google Scholar] [CrossRef] [Scilit]
- Jiang, J.; Chen, D.; Yu, B.; He, J.; Yu, J.; Mao, X.; Huang, Z.; Luo, Y.; Luo, J.; Zheng, P. Improvement of growth performance and parameters of intestinal function in liquid fed early weanling pigs. J. Anim. Sci. 2019, 97, 2725–2738. [Google Scholar] [CrossRef] [Scilit]
- Cho, J.H.; Zhang, Z.F.; Kim, I.H. Effects of fermented grains as raw cereal substitutes on growth performance, nutrient digestibility, blood profiles, and fecal noxious gas emission in growing pigs. Livest. Sci. 2013, 154, 131–136. [Google Scholar] [CrossRef] [Scilit]
- Lu, J.; Zhang, X.; Liu, Y.; Cao, H.; Han, Q.; Xie, B.; Fan, L.; Li, X.; Hu, J.; Yang, G.; et al. Effect of Fermented Corn-Soybean Meal on Serum Immunity, the Expression of Genes Related to Gut Immunity, Gut Microbiota, and Bacterial Metabolites in Grower-Finisher Pigs. Front. Microbiol. 2019, 10, 2620. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Shi, C.; Wang, C.; Lu, Z.; Wang, F.; Feng, J.; Wang, Y. Effect of soybean meal fermented with Bacillus subtilis BS12 on growth performance and small intestinal immune status of piglets. Food Agric. Immunol. 2018, 29, 133–146. [Google Scholar] [CrossRef] [Scilit]
- Jones, A.; Woodworth, J. Effect of Enzymatically Fermented Soybean Meal and Lactobacillus Plantarum on Nursery Pig Performance. Kans. Agric. Exp. Stn. Res. Rep. 2016, 2, 14. [Google Scholar] [CrossRef] [Scilit]
- Zheng, L.; Li, D.; Li, Z.; Kang, L.; Jiang, Y.; Liu, X.; Chi, Y.; Li, Y.; Wang, J. Effects of Bacillus fermentation on the protein microstructure and anti-nutritional factors of soybean meal. Lett. Appl. Microbiol. 2017, 65, 520–526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meunier-Salaün, M.-C.; Chiron, J.; Etore, F.; Fabre, A.; Laval, A.; Pol, F.; Prunier, A.; Ramonet, Y.; Nielsen, B.L. Review: Drinking water for liquid-fed pigs. Animal 2017, 11, 836–844. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- I’Anson, K.; Choct, M.; Brooks, P.H. The influence of particle size and processing method for wheat-based diets, offered in dry or liquid form, on growth performance and diet digestibility in male weaner pigs. Anim. Prod. Sci. 2012, 52, 899–904. [Google Scholar] [CrossRef] [Scilit]
- Lan, R.X.; Koo, J.M.; Lee, S.I.; Kim, I.H. Effects of Lactobacillus acidophilus fermentation product supplementation in different nutrient density diets on growth performance, nutrient digestibility, fecal microbiota and fecal noxious gas emissions in weanling pigs. J. Anim. Sci. 2016, 94, 71. [Google Scholar] [CrossRef] [Scilit]
- Le, M.H.; Galle, S.; Yang, Y.; Landero, J.L.; Beltranena, E.; Gänzle, M.G.; Zijlstra, R.T. Effects of feeding fermented wheat with Lactobacillus reuteri on gut morphology, intestinal fermentation, nutrient digestibility, and growth performance in weaned pigs. J. Anim. Sci. 2016, 94, 4677–4687. [Google Scholar] [CrossRef] [Scilit]
- Torres-Pitarch, A.; Gardiner, G.E.; Cormican, P.; Rea, M.; Lawlor, P.G. Effect of cereal fermentation and carbohydrase supplementation on growth, nutrient digestibility and intestinal microbiota in liquid-fed grow-finishing pigs. Sci. Rep. 2020, 10, 13716. [Google Scholar] [CrossRef] [Scilit]
- Thacker, P.A.; Han, Y.K.; Yang, J.S. Effects of the Duration of Liquid Feeding on Performance and Nutrient Digestibility in Weaned Pigs. Asian Australas. J. Anim. 2006, 19, 396–401. [Google Scholar]
- Lyberg, K.; Simonsson, A.; Lindberg, J.E. Influence of phosphorus level and soaking of food on phosphorus availability and performance in growing-finishing pigs. Anim. Sci. 2007, 81, 375–381. [Google Scholar] [CrossRef] [Scilit]
- Choct, M.; Selby, E.; Cadogan, D.J.; Campbell, R.G. Effect of liquid to feed ratio, steeping time, and enzyme supplementation on the performance of weaner pigs. Aust. J. Agric. Res. 2004, 55, 247–252. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Bollinger, D.W.; Ledoux, D.R.; Ellersieck, M.R.; Veum, T.L. Soaking increases the efficacy of supplemental microbial phytase in a low-phosphorus corn-soybean meal diet for growing pigs. J. Anim. Sci. 1997, 75, 1292–1298. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.F.; An, X.P.; Wang, Y.; Qi, J.W.; Zhang, J.; Liu, Y.H.; Weng, M.Q.; Yang, Y.P.; Gao, A.Q. Effects of polysaccharide from fermented wheat bran on growth performance, muscle composition, digestive enzyme activities and intestinal microbiota in juvenile common carp. Aquacult. Nutr. 2020, 26, 1096–1107. [Google Scholar] [CrossRef] [Scilit]
- Ao, X.; Meng, Q.W.; Kim, I.H. Effects of Fermented Red Ginseng Supplementation on Growth Performance, Apparent Nutrient Digestibility, Blood Hematology and Meat Quality in Finishing Pigs. Asian Australas. J. Anim. 2011, 24, 525–531. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, M.V.; Jordal, A.; Espe, M.; Buttle, L.; Lai, H.V.; Nnestad, I. Feed intake and brain neuropeptide Y (NPY) and cholecystokinin (CCK) gene expression in juvenile cobia fed plant-based protein diets with different lysine to arginine ratios. Comp. Biochem. Phys. A 2013, 165, 328–337. [Google Scholar] [CrossRef] [Scilit]
- Pavlisova, J.; Horakova, O.; Kalendova, V.; Buresova, J.; Bardova, K.; Holendova, B.; Plecita-Hlavata, L.; Vackova, S.; Windrichova, J.; Topolcan, O.; et al. Chronic n-3 fatty acid intake enhances insulin response to oral glucose and elevates GLP-1 in high-fat diet-fed obese mice. Food Funct. 2020, 11, 9764–9775. [Google Scholar] [CrossRef] [Scilit]
- Strubbe, J.H.; Dijk, G.V. The temporal organization of ingestive behaviour and its interaction with regulation of energy balance. Neurosci. Biobehav. R 2002, 26, 485–498. [Google Scholar] [CrossRef] [Scilit]
- Delavaud, C.; Ferlay, A.; Faulconnier, Y.; Bocquier, F.; Kann, G.; Chilliard, Y. Plasma leptin concentration in adult cattle: Effects of breed, adiposity, feeding level, and meal intake. J. Anim. Sci. 2002, 80, 1317–1328. [Google Scholar] [CrossRef] [Scilit]
- Foote, A.P.; Hales, K.E.; Kuehn, L.A.; Keisler, D.H.; King, D.A.; Shackelford, S.D.; Wheeler, T.L.; Freetly, H.C. Relationship of leptin concentrations with feed intake, growth, and efficiency in finishing beef steers. J. Anim. Sci. 2015, 93, 4401–4407. [Google Scholar] [CrossRef] [Scilit]
- Neary, N.M.; Druce, M.R.; Small, C.J.; Bloom, S.R. Acylated ghrelin stimulates food intake in the fed and fasted states but desacylated ghrelin has no effect. Gut 2006, 55, 135. [Google Scholar]
- Salfen, B.E.; Ca Rroll, J.A.; Keisler, D.H.; Strauch, T.A. Effects of exogenous ghrelin on feed intake, weight gain, behavior, and endocrine responses in weanling pigs. J. Anim. Sci. 2004, 82, 1957–1966. [Google Scholar] [CrossRef] [Scilit]
- Tyra, M.; Ropka-Molik, K.; Piórkowska, K.; Oczkowicz, M.; Maopolska, M. Association of Ghrelin Gene Polymorphisms with Fattening Traits and Feed Intake in Pig: A Preliminary Study. Animals 2019, 9, 410. [Google Scholar] [CrossRef] [Scilit]
- Batterham, R.L.; Cowley, M.A.; Small, C.J.; Herzog, H.; Cohen, M.A.; Dakin, C.L.; Wren, A.M.; Brynes, A.E.; Low, M.J.; Ghatei, M.A.; et al. Gut hormone PYY(3-36) physiologically inhibits food intake. Nature 2002, 418, 650–654. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, X.; Wang, J.; Zhang, J.; Smith, S.; Orr, W.C.; Chen, J. Altered Circulatory Ghrelin and PYY in Response to Food Intake and Sham Feeding in Obese Subjects. Gastroenterology 2009, 136, A480–A481. [Google Scholar] [CrossRef] [Scilit]
- Hu, Y.; Dun, Y.; Li, S.; Zhao, S.; Peng, N.; Liang, Y. Effects of KN-42 on Growth Performance, Diarrhea and Faecal Bacterial Flora of Weaned Piglets. Asian Australas. J. Anim. 2014, 27, 1130–1140. [Google Scholar]
- Mikkelsen, L.L.; Bendixen, C.; Jakobsen, M.; Jensen, B. Enumeration of Bifidobacteria in Gastrointestinal Samples from Piglets. Appl. Environ. Microb. 2003, 69, 654–658. [Google Scholar] [CrossRef] [Scilit]
- Mathew, A.G.; Chattin, S.E.; Robbins, C.M.; Golden, D.A. Effects of a direct-fed yeast culture on enteric microbial populations, fermentation acids, and performance of weanling pigs. J. Anim. Sci. 1998, 76, 2138–2145. [Google Scholar] [CrossRef] [Scilit]
- Muza-Moons, M.M.; Schneeberger, E.; Hecht, G.A. Enteropathogenic Escherichia coli infection leads to appearance of aberrant tight junctions strands in the lateral membrane of intestinal epithelial cells. Cell. Microbiol. 2004, 6, 783–793. [Google Scholar] [CrossRef] [Scilit]
- Brooks, P.H.; Beal, J.D.; Niven, S.; Demeckova, V. Liquid feeding of pigs. II. Potential for improving pig health and food safety. Anim. Sci. Pap. Rep. 2003, 21 (Suppl. 1), 23–39. [Google Scholar]
- Missotten, J.A.; Michiels, J.; Dierick, N.; Ovyn, A.; Akbarian, A.; Smet, S.D. Effect of fermented moist feed on performance, gut bacteria and gut histo-morphology in broilers. Br. Poult. Sci. 2013, 54, 627–634. [Google Scholar] [CrossRef] [Scilit]
- Van Winsen, R.J.A. Effect of fermented feed on the microbial population of the gastrointestinal tracts of pigs. Appl. Environ. Microbiol. 2001, 67, 3071–3076. [Google Scholar] [CrossRef] [Scilit]
- Russell, P.J.; Geary, T.M.; Campbell, A.; Brooks, P.H. Performance, Water Use and Effluent Output of Weaner Pigs Fedad libitumwith Either Dry Pellets or Liquid Feed and the Role of Microbial Activity in the Liquid Feed. J. Sci. Food Agric. 2015, 72, 8–16. [Google Scholar] [CrossRef]
- Corrier, D.E.; Hinton, A.; Ziprin, R.L.; Deloach, J.R. Effect of Dietary Lactose on Salmonella Colonization of Market-Age Broiler Chickens. Avian Dis. 1990, 34, 668–676. [Google Scholar] [CrossRef] [Scilit]
- Heinritz, S.N.; Weiss, E.; Eklund, M.; Aumiller, T.; Mosenthin, R. Intestinal Microbiota and Microbial Metabolites Are Changed in a Pig Model Fed a High-Fat/Low-Fiber or a Low-Fat/High-Fiber Diet. PLoS ONE 2016, 11, e0154329. [Google Scholar]



| Ingredients | Phase (kg) | ||||
|---|---|---|---|---|---|
| 8–20 | 20–50 | 50–75 | 75–100 | 100–125 | |
| Extruded corn | 30.00 | 10.00 | 0.00 | 0.00 | 0.00 |
| Corn | 30.23 | 57.11 | 68.14 | 77.21 | 73.36 |
| Rice bran | 0.00 | 2.00 | 4.00 | 0.00 | 4.00 |
| Wheat bran | 0.00 | 0.00 | 0.00 | 2.00 | 0.00 |
| Phytase | 0.00 | 0.00 | 0.00 | 0.01 | 0.00 |
| Soy protein concentrate | 4.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Low protein whey powder | 4.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Extruded soybean | 10.00 | 10.00 | 8.00 | 0.00 | 5.00 |
| Soybean meal | 10.00 | 13.10 | 15.00 | 18.00 | 13.00 |
| Soybean oil | 1.80 | 2.00 | 2.00 | 0.00 | 2.00 |
| Fish meal | 4.00 | 3.00 | 0.00 | 0.00 | 0.00 |
| Sucrose | 2.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Glucose | 1.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Nacl | 0.40 | 0.40 | 0.40 | 0.40 | 0.40 |
| Chloride choline | 0.18 | 0.15 | 0.15 | 0.15 | 0.15 |
| Limestone | 0.86 | 1.00 | 1.05 | 0.95 | 0.95 |
| Dicalcium phosphate | 0.52 | 0.40 | 0.52 | 0.59 | 0.45 |
| Vitamin premix 1 | 0.05 | 0.04 | 0.04 | 0.04 | 0.04 |
| Mineral premix 2 | 0.20 | 0.20 | 0.20 | 0.20 | 0.20 |
| l-Lysine HCl | 0.50 | 0.34 | 0.30 | 0.28 | 0.28 |
| l-Threonine | 0.13 | 0.10 | 0.08 | 0.08 | 0.08 |
| DL-Methionine | 0.10 | 0.12 | 0.10 | 0.07 | 0.07 |
| Tryptophan | 0.03 | 0.04 | 0.02 | 0.02 | 0.02 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Calculated nutrient compositions | |||||
| DE (Mcal/Kg) | 3.54 | 3.51 | 3.48 | 3.33 | 3.47 |
| CP, % | 19.58 | 17.09 | 15.62 | 14.30 | 13.98 |
| Ca, % | 0.81 | 0.67 | 0.59 | 0.55 | 0.53 |
| Total P, % | 0.59 | 0.53 | 0.51 | 0.47 | 0.46 |
| Available P, % | 0.41 | 0.33 | 0.27 | 0.27 | 0.24 |
| Lys, % | 1.37 | 1.11 | 0.97 | 0.87 | 0.85 |
| Met, % | 0.48 | 0.39 | 0.33 | 0.28 | 0.28 |
| Met + Cys, % | 0.75 | 0.63 | 0.56 | 0.49 | 0.49 |
| Thr, % | 0.80 | 0.67 | 0.60 | 0.58 | 0.54 |
| Trp, % | 0.23 | 0.21 | 0.18 | 0.17 | 0.16 |
| Primer | Nucleotide Sequence (5′-3′) | AT, °C | Product Size, bp |
|---|---|---|---|
| Total bacteria | F: ACTCCTACGGGAGGCAGCAG | 60 | 200 |
| R: ATTACCGCGGCTGCTGG | |||
| Lactobacillus | F: ACTCCTACGGGAGGCAGCAG | 60 | 126 |
| R: CAACAGTTACTCTGACACCCGTTCTTC | |||
| P: AAGAAGGGTTTCGGCTCGTAAAACTCTGTT | |||
| Escherichia coli | F: CATGCCGCGTGTATGAAGAA | 60 | 96 |
| R: CGGGTAACGTCAATGAGCAAA | |||
| P: AGGTATTAACTTTACTCCCTTCCTC | |||
| Bacillus | F: GCAACGAGCGCAACCCTTGA | 60 | 92 |
| R: TCATCCCCACCTTCCTCCGGT | |||
| P: CGGTTTGTCACCGGCAGTCACCT | |||
| Bifidobacterium | F: CGCGTCCGGTGTGAAAG | 60 | 121 |
| R: CTTCCCGATATCTACACATTCCA | |||
| P: ATTCCACCGTTACACCGGGAA |
| Items | 8–20 kg | 20–50 kg | 50–7 5 kg | 75–100 kg | 100–125 kg | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| CON | FLF | CON | FLF | CON | FLF | CON | FLF | CON | FLF | |
| Dry matter, % | 90.75 | 64.85 | 88.14 | 58.95 | 85.96 | 58.38 | 87.93 | 56.64 | 88.10 | 56.38 |
| Crude protein, % | 20.40 | 22.24 | 18.67 | 18.80 | 18.43 | 18.80 | 18.59 | 17.60 | 16.51 | 16.32 |
| Crude fat, % | 6.08 | 6.70 | 6.47 | 7.10 | 4.69 | 6.15 | 2.68 | 3.00 | 2.83 | 3.00 |
| Crude fiber, % | 1.78 | 1.50 | 2.18 | 1.50 | 2.80 | 2.10 | 1.76 | 1.53 | 2.57 | 2.36 |
| Calcium, % | 0.73 | 0.76 | 0.53 | 0.60 | 0.64 | 0.61 | 0.44 | 0.67 | 0.52 | 0.70 |
| Total phosphorus, % | 0.50 | 0.59 | 0.52 | 0.58 | 0.49 | 0.52 | 0.48 | 0.55 | 0.37 | 0.49 |
| pH | 6.90 | 4.02 | 6.92 | 4.01 | 6.89 | 4.04 | 6.91 | 4.01 | 6.93 | 4.03 |
| Lactic acid, mmol/kg | 35.62 | 67.22 | 61.81 | 84.72 | 84.03 | 105.14 | 75.97 | 102.64 | 23.06 | 63.19 |
| Acid-soluble protein, % | 1.24 | 3.15 | 1.60 | 2.98 | 1.24 | 3.05 | 1.17 | 2.46 | 1.17 | 1.78 |
| Items | CON | AB | FLF | SEM | P |
|---|---|---|---|---|---|
| 8–20 kg | |||||
| Initial BW, kg | 8.21 | 8.21 | 8.21 | 0.27 | 1 |
| Final BW, kg | 23.53 | 23.95 | 26.23 | 0.52 | 0.068 |
| ADG, g | 313 b | 321 b | 368 a | 7.83 | 0.002 |
| ADFI, g | 563 b | 570 b | 661 a | 14.38 | 0.002 |
| F/G | 1.8 | 1.78 | 1.8 | 0.02 | 0.798 |
| 20–50 kg | |||||
| Final BW, kg | 46.04 b | 49.19 a,b | 52.34 a | 0.99 | 0.023 |
| ADG, g | 643 b | 721 a | 746 a | 15.99 | 0.013 |
| ADFI, g | 1504 b | 1679 a | 1714 a | 35.59 | 0.004 |
| F/G | 2.34 | 2.33 | 2.3 | 0.25 | 0.804 |
| 50–75 kg | |||||
| Final BW, kg | 71.15 b | 76.62 a,b | 80.79 a | 1.42 | 0.01 |
| ADG, g | 718 b | 784 a | 813 a | 15.02 | 0.018 |
| ADFI, g | 2333 | 2621 | 2640 | 65.62 | 0.081 |
| F/G | 3.14 | 3.25 | 3.09 | 0.04 | 0.263 |
| 75–100 kg | |||||
| Final BW, kg | 103.6 | 109.79 | 111.56 | 1.49 | 0.062 |
| ADG, g | 1159 | 11,895 | 1099 | 16.7 | 0.093 |
| ADFI, g | 3288 | 3379 | 3346 | 49.95 | 0.76 |
| F/G | 2.76 | 2.78 | 2.96 | 0.05 | 0.202 |
| 100–125 kg | |||||
| Final BW, kg | 124.39 b | 132.14 a,b | 134.86 a | 1.78 | 0.032 |
| ADG, g | 1039 | 1118 | 1165 | 30.01 | 0.234 |
| ADFI, g | 3476 b | 4044 a | 3913 a | 99.14 | 0.007 |
| F/G | 3.37 | 3.63 | 3.35 | 0.09 | 0.466 |
| 8–125 kg | |||||
| Initial BW, kg Final BW, kg | 8.21 | 8.21 | 8.21 | 0.27 | 1 |
| ADG(g) | 124.39 b | 132.14 a,b | 134.86 a | 1.78 | 0.032 |
| ADFI, g | 726 b | 775 a | 792 a | 10.09 | 0.012 |
| F/G | 1920 | 2097 | 2114 | 26.09 | 0.086 |
| 2.64 | 2.71 | 2.67 | 0.26 | 0.624 |
| Items, % | CON | AB | FLF | SEM | P |
|---|---|---|---|---|---|
| 8–20 kg | |||||
| Dry matter | 79.08 c | 81.79 b | 88.26 a | 0.96 | <0.05 |
| Crude protein | 70.27 c | 75.44 b | 84.40 a | 1.46 | <0.05 |
| Ether extract | 68.25 b | 75.85 a | 74.35 a | 0.89 | <0.05 |
| Crude ash | 34.45 c | 44.29 b | 60.57 a | 2.72 | <0.05 |
| Crude fiber | 20.64 c | 30.13 b | 50.76 a | 3.29 | <0.05 |
| Gross energy | 79.50 c | 82.20 b | 88.01 a | 0.89 | <0.05 |
| Calcium | 42.45 b | 39.22 b | 64.96 a | 2.88 | <0.05 |
| Total phosphorus | 22.33 c | 36.33 b | 75.54 a | 5.55 | <0.05 |
| 20–50 kg | |||||
| Dry matter | 86.80 b | 88.59 a | 87.66 a,b | 0.30 | 0.043 |
| Crude protein | 83.35 | 84.90 | 83.80 | 0.46 | 0.380 |
| Ether extract | 80.80 | 82.93 | 80.94 | 0.50 | 0.156 |
| Crude ash | 58.87 | 55.48 | 57.77 | 0.92 | 0.322 |
| Crude fiber | 58.86 | 58.64 | 58.02 | 0.55 | 0.826 |
| Gross energy | 88.29 | 89.12 | 88.14 | 0.20 | 0.088 |
| Calcium | 74.42 | 73.81 | 73.81 | 0.61 | 0.905 |
| Total phosphorus | 69.30 b | 66.39 b | 77.59 a | 1.43 | <0.05 |
| 50–75 kg | |||||
| Dry matter | 85.93 | 86.01 | 86.94 | 0.28 | 0.280 |
| Crude protein | 82.83 | 83.25 | 83.03 | 0.39 | 0.916 |
| Ether extract | 71.46 b | 73.99 a,b | 78.02 a | 1.01 | 0.017 |
| Crude ash | 58.87 | 58.23 | 58.58 | 0.67 | 0.936 |
| Crude fiber | 48.63 | 48.76 | 48.03 | 0.79 | 0.932 |
| Gross energy | 86.95 | 87.42 | 86.57 | 0.27 | 0.474 |
| Calcium | 61.74 | 61.26 | 62.82 | 0.70 | 0.676 |
| Total phosphorus | 58.67 b | 58.15 b | 72.38 a | 1.78 | <0.05 |
| 75–100 kg | |||||
| Dry matter | 89.98 | 89.72 | 90.72 | 0.11 | 0.134 |
| Crude protein | 88.83 | 88.80 | 88.12 | 0.18 | 0.182 |
| Ether extract | 64.75 | 65.95 | 64.98 | 0.43 | 0.506 |
| Crude ash | 60.96 | 61.17 | 62.55 | 0.45 | 0.314 |
| Crude fiber | 43.48 | 43.25 | 43.15 | 1.10 | 0.993 |
| Gross energy | 90.63 | 90.35 | 90.34 | 0.12 | 0.548 |
| Calcium | 64.91 | 64.50 | 68.89 | 0.91 | 0.086 |
| Total phosphorus | 73.03 | 71.08 | 72.39 | 0.58 | 0.248 |
| 100–125 kg | |||||
| Dry matter | 90.14 | 90.42 | 89.80 | 0.17 | 0.368 |
| Crude protein | 86.39 | 87.02 | 86.08 | 0.30 | 0.423 |
| Ether extract | 58.60 b | 60.40 b | 78.03 a | 2.36 | < 0.05 |
| Crude ash | 56.48 | 56.58 | 58.57 | 0.92 | 0.611 |
| Crude fiber | 59.79 | 61.42 | 61.65 | 0.87 | 0.660 |
| Gross energy | 91.22 a | 91.43 a | 90.02 b | 0.21 | 0.005 |
| Calcium | 64.58 b | 66.37 a,b | 70.69 a | 0.99 | 0.024 |
| Total phosphorus | 48.69 b | 55.58 b | 66.69 a | 2.24 | <0.05 |
| Items | CON | AB | FLF | SEM | P |
|---|---|---|---|---|---|
| Jejunum | |||||
| Amylase, U/mgprot | 3.46 | 3.02 | 3.6 | 0.26 | 0.673 |
| Trypsin, U/mgprot | 1271.78 | 1209.81 | 1206.27 | 48.52 | 0.839 |
| Lipase, U/mgprot | 16.96 | 16.24 | 16.29 | 0.39 | 0.725 |
| Ileum | |||||
| Amylase, U/mgprot | 2.86 | 2.95 | 2.81 | 0.14 | 0.933 |
| Trypsin, U/mgprot | 1100.68 | 1104.46 | 1164.68 | 75.95 | 0.935 |
| Lipase, U/mgprot | 15.68 | 16.17 | 16.99 | 0.9 | 0.843 |
| Items | CON | AB | FLF | SEM | P |
|---|---|---|---|---|---|
| Duodenum | |||||
| Villus height, µm | 551.81 | 523.35 | 546.1 | 21.32 | 0.871 |
| Crypt depth, µm | 354.07 | 379.55 | 370.04 | 11.04 | 0.671 |
| Villus: crypt | 1.54 | 1.41 | 1.53 | 0.05 | 0.539 |
| Jejunum | |||||
| Villus height, µm | 541.07 | 451.98 | 517.95 | 18.23 | 0.129 |
| Crypt depth, µm | 264.59 | 226.42 | 278.26 | 11.76 | 0.181 |
| Villus: crypt | 1.95 | 2.13 | 1.94 | 0.07 | 0.521 |
| Ileum | |||||
| Villus height, µm | 515.72 | 520.74 | 508.75 | 20.15 | 0.977 |
| Crypt depth, µm | 314.44 | 325.87 | 326.82 | 11.24 | 0.905 |
| Villus: crypt | 1.64 | 1.6 | 1.66 | 0.04 | 0.613 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xin, H.; Wang, M.; Xia, Z.; Yu, B.; He, J.; Yu, J.; Mao, X.; Huang, Z.; Luo, Y.; Luo, J.; et al. Fermented Diet Liquid Feeding Improves Growth Performance and Intestinal Function of Pigs. Animals 2021, 11, 1452. https://doi.org/10.3390/ani11051452
Xin H, Wang M, Xia Z, Yu B, He J, Yu J, Mao X, Huang Z, Luo Y, Luo J, et al. Fermented Diet Liquid Feeding Improves Growth Performance and Intestinal Function of Pigs. Animals. 2021; 11(5):1452. https://doi.org/10.3390/ani11051452
Chicago/Turabian StyleXin, Huailu, Mingyu Wang, Zou Xia, Bing Yu, Jun He, Jie Yu, Xiangbing Mao, Zhiqing Huang, Yuheng Luo, Junqiu Luo, and et al. 2021. "Fermented Diet Liquid Feeding Improves Growth Performance and Intestinal Function of Pigs" Animals 11, no. 5: 1452. https://doi.org/10.3390/ani11051452
APA StyleXin, H., Wang, M., Xia, Z., Yu, B., He, J., Yu, J., Mao, X., Huang, Z., Luo, Y., Luo, J., Yan, H., Wang, H., Wang, Q., Zheng, P., & Chen, D. (2021). Fermented Diet Liquid Feeding Improves Growth Performance and Intestinal Function of Pigs. Animals, 11(5), 1452. https://doi.org/10.3390/ani11051452

