Sodium Fluoride In Vitro Treatment Affects the Expression of Gonadotropin and Steroid Hormone Receptors in Chicken Embryonic Gonads
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents Used in the Research
2.2. Gene Expression Analysis (RNA Isolation, Reverse Transcription Reaction, and qPCR Reaction)
2.3. Immunohistochemical Analysis of Steroid Hormone Receptors
2.4. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Jha, S.K.; Mishra, V.K.; Sharma, D.K.; Damodaran, T. Fluoride in the environment and its metabolism in humans. Rev. Environ. Contam. Toxicol. 2011, 211, 121–142. [Google Scholar] [CrossRef] [Scilit]
- Luke, J. Fluoride Deposition in the Aged Human Pineal Gland. Caries Res. 2001, 35, 125–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Y.; Zhang, H.; He, J.; Chen, X.; Ding, Y.; Wang, Y.; Liu, X. Effects of sodium fluoride on reproductive function in female rats. Food Chem. Toxicol. 2013, 56, 297–303. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Li, Z.; Qie, M.; Zheng, R.; Shetty, J.; Wang, J. Sodium fluoride and sulphur dioxide affected male reproduction by disturbing blood-testis barrier in mice. Food Chem. Toxicol. 2016, 94, 103–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, S.; Zhao, M.H.; Ock, S.A.; Kim, N.H.; Cui, X.S. Fluoride impairs oocyte maturation and subsequent embryonic development in mice. Environ. Toxicol. 2016, 31, 1486–1495. [Google Scholar] [CrossRef] [Scilit]
- Akdogan, M.; Kaleli, S.; Yazar, H.; Desdicioglu, R.; Yuvaci, H. Effect of high-dose fluoride on antioxidant enzyme activities of amniotic fluid in rats. J. Pakistan. Med. Assoc. 2016, 66, 435–438. [Google Scholar]
- Hirst, C.E.; Major, A.T.; Smith, C.A. Sex determination and gonadal sex differentiation in the chicken model. Int. J. Dev. Biol. 2018, 62, 153–166. [Google Scholar] [CrossRef] [Scilit]
- Elbrecht, A.; Smith, R.G. Aromatase enzyme activity and sex determination in chickens. Science 1992, 255, 467–470. [Google Scholar] [CrossRef] [Scilit]
- Major, A.T.; Smith, C.A. Sex reversal in birds. Sex. Dev. 2016, 10, 288–300. [Google Scholar] [CrossRef] [Scilit]
- Akazome, Y.; Mori, T. Evidence of sex reversal in the gonads of chicken embryos after oestrogen treatment as detected by expression of lutropin receptor. J. Reprod. Fertil. 1999, 115, 9–14. [Google Scholar] [CrossRef] [Scilit]
- He, B.; Mi, Y.; Zhang, C. Gonadotropins regulate ovarian germ cell mitosis/meiosis decision in the embryonic chicken. Mol. Cell. Endocrinol. 2013, 370, 32–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akazome, Y.; Abe, T.; Mori, T. Differentiation of chicken gonad as an endocrine organ: Expression of LH receptor, FSH receptor, cytochrome P450c17 and aromatase genes. Reproduction 2002, 123, 721–728. [Google Scholar] [CrossRef] [Scilit]
- Teng, C.T.; Teng, C.S.; Bousfield, G.R.; Liu, W.K.; Ward, D.N. Differential response of growing and regressing chicken ovaries to gonadotropic hormones. Gen. Comp. Endocrinol. 1982, 48, 325–332. [Google Scholar] [CrossRef] [Scilit]
- Pedernera, E.; Solis, L.; Peralta, I.; Velázquez, P.N. Proliferative and steroidogenic effects of follicle-stimulating hormone during chick embryo gonadal development. Gen. Comp. Endocrinol. 1999, 116, 213–220. [Google Scholar] [CrossRef] [Scilit]
- González-Morán, M.G. Effects of luteinizing hormone treatment on oogenesis in ovarian germ cells of the chick (Gallus domesticus). Domest. Anim. Endocrinol. 2007, 33, 154–166. [Google Scholar] [CrossRef] [Scilit]
- Kuiper, G.G.J.M.; Carlsson, B.; Grandien, K.; Enmark, E.; Häggblad, J.; Nilsson, S.; Gustafsson, J.-Å. Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology 1997, 138, 863–870. [Google Scholar] [CrossRef] [PubMed]
- Tremblay, G.B.; Tremblay, A.; Copeland, N.G.; Gilbert, D.J.; Jenkins, N.A.; Labrie, F.; Giguere, V. Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor b. Mol. Endocrinol. 1997, 11, 353–365. [Google Scholar] [CrossRef] [Scilit]
- Zhao, C.; Dahlman-Wright, K.; Gustafsson, J.A. Estrogen receptor beta: An overview and update. Nucl. Recept. Signal. 2008, 1, 6:e003. [Google Scholar] [CrossRef] [Scilit]
- Paterni, I.; Granchi, C.; Katzenellenbogen, J.A.; Minutolo, F. Estrogen receptors alpha (ERα) and beta (ERβ): Subtype-selective ligands and clinical potential. Steroids 2014, 90, 13–29. [Google Scholar] [CrossRef] [Scilit]
- Hrabia, A.; Wilk, M.; Rząsa, J. Expression of alpha and beta estrogen receptors in the chicken ovary. Folia Biol. 2008, 56, 187–191. [Google Scholar] [CrossRef] [Scilit]
- Sechman, A.; Grzegorzewska, A.K.; Grzesiak, M.; Kozubek, A.; Katarzyńska-Banasik, D.; Kowalik, K.; Hrabia, A. Nitrophenols suppress steroidogenesis in prehierarchical chicken ovarian follicles by targeting STAR, HSD3B1, and CYP19A1 and downregulating LH and estrogen receptor expression. Domest. Anim. Endocrinol. 2020, 70, 106378. [Google Scholar] [CrossRef] [Scilit]
- Grzegorzewska, A.K.; Lis, M.W.; Sechman, A. Immunolocalization of leptin receptor and mRNA expression of leptin and estrogen receptors as well as caspases in the chorioallantoic membrane (CAM) of the chicken embryo. Folia Biol. 2016, 64, 79–87. [Google Scholar] [CrossRef] [Scilit]
- Mi, Y.; He, B.; Li, J.; Zhang, C. Progesterone regulates chicken embryonic germ cell meiotic initiation independent of retinoic acid signalling. Theriogenology 2014, 82, 195–203. [Google Scholar] [CrossRef] [Scilit]
- Tora, L.; Gronemeyer, H.; Turcotte, B.; Gaub, M.P.; Chambon, P. The N-terminal region of the chicken progesterone receptor specifies target gene activation. Nature 1988, 333, 185–188. [Google Scholar] [CrossRef] [Scilit]
- Conneely, O.M.; Maxwell, B.L.; Toft, D.O.; Schrader, W.T.; O’Malley, B.W. The A and B forms of the chicken progesterone receptor arise by alternate initiation of translation of a unique mRNA. Biochem. Biophys. Res. Commun. 1987, 149, 493–501. [Google Scholar] [CrossRef] [Scilit]
- Joensuu, T.; Tuohimaa, P.; Vilja, P. Avidin and ovalbumin induction by progesterone in chicken oviduct detected by sensitive immunoenzymometric assays. J. Endocrinol. 1991, 130, 191–197. [Google Scholar] [CrossRef] [Scilit]
- Socha, J.K.; Sechman, A.; Mika, M.; Hrabia, A. Effect of growth hormone on steroid concentrations and mRNA expression of their receptor, and selected egg-specific protein genes in the chicken oviduct during pause in laying induced by fasting. Domest. Anim. Endocrinol. 2017, 61, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshimura, Y.; Bahr, J.M. Localization of progesterone receptors in pre- and postovulatory follicles of the domestic hen. Endocrinology 1991, 128, 323–333. [Google Scholar] [CrossRef] [Scilit]
- Orczewska-Dudek, S.; Mika, M. Expression and function of progesterone receptor in the avian ovary (Article in Polish). Roczn. Nauk. Zootech. 2011, 38, 127–135. [Google Scholar]
- Matsuzaka, Y.; Uesawa, Y. DeepSnap-Deep learning approach predicts progesterone receptor antagonist activity with high performance. Front. Bioeng. Biotechnol. 2020, 22, 485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zielniok, K.; Motyl, T.; Gajewska, M. Functional interactions between 17 β-estradiol and progesterone regulate autophagy during acini formation by bovine mammary epithelial cells in 3D cultures. Biomed. Res. Int. 2014, 382653. [Google Scholar] [CrossRef] [Scilit]
- Levin, E.R.; Hammes, S.R. Nuclear receptors outside the nucleus: Extranuclear signalling by steroid receptors. Nat. Rev. Mol. Cell Biol. 2016, 17, 783–797. [Google Scholar] [CrossRef] [Scilit]
- Ribatti, D. Chick embryo chorioallantoic membrane as a useful tool to study angiogenesis. Int. Rev. Cell. Mol. Biol. 2008, 270, 181–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ribatti, D. The chick embryo chorioallantoic membrane (CAM). A multifaceted experimental model. Mech. Dev. 2016, 141, 70–77. [Google Scholar] [CrossRef] [Scilit]
- Miao, L.P.; Zhou, M.Y.; Zhang, X.Y.; Yuan, C.; Dong, X.Y.; Zou, X.T. Effect of excess dietary fluoride on laying performance and antioxidant capacity of laying hens. Poult. Sci. 2017, 96, 2200–2205. [Google Scholar] [CrossRef] [Scilit]
- Grzegorzewska, A.K.; Hrabia, A.; Kowalik, K.; Katarzyńska-Banasik, D.; Kozubek, A.; Sechman, A. In vitro effects of PNP and PNMC on apoptosis and proliferation in the hen ovarian stroma and prehierarchal follicles. Acta Histochem. 2020, 122, 151463. [Google Scholar] [CrossRef] [Scilit]
- Wei, W.; Jiao, Y.; Ma, Y.; Stuart, J.M.; Li, X.; Zhao, F.; Wang, L.; Sun, D.; Gu, W. Effect of fluorosis on liver cells of VC deficient and wild type mice. Sci. World J. 2014, 2014, 287464. [Google Scholar] [CrossRef] [Scilit]
- Fu, X.; Xie, F.N.; Dong, P.; Li, Q.C.; Yu, G.Y.; Xiao, R. High-dose fluoride impairs the properties of human embryonic stem cells via JNK signalling. PLoS ONE 2016, 11, e0148819. [Google Scholar] [CrossRef] [Scilit]
- Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef] [Scilit]
- Khillare, G.S.; Sastry, K.V.H.; Agrawal, R.; Saxena, R.; Mohan, J.; Singh, R.P. Expression of gonadotropin and sex steroid hormone receptor mRNA in the utero-vaginal junction containing sperm storage tubules of oviduct during sexual maturation in Japanese quail. Gen. Comp. Endocrinol. 2018, 259, 141–146. [Google Scholar] [CrossRef] [Scilit]
- Rangel, P.L.; Gutierrez, C.G. Reproduction in hens: Is testosterone necessary for the ovulatory process? Gen. Comp. Endocrinol. 2014, 203, 250–261. [Google Scholar] [CrossRef] [Scilit]
- Gahr, M. Distribution of sex steroid hormone receptors in the avian brain: Functional implications for neural sex differences and sexual behaviors. Microsc. Res. Tech. 2001, 55, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grzegorzewska, A.K.; Sechman, A.; Paczoska-Eliasiewicz, H.E.; Rzasa, J. The expression of pituitary FSHbeta and LHbeta mRNA and gonadal FSH and LH receptor mRNA in the chicken embryo. Reprod. Biol. 2009, 9, 253–269. [Google Scholar] [CrossRef] [Scilit]
- Rombauts, L.; Berghman, L.R.; Vanmontfort, D.; Decuypere, E.; Verhoeven, G. Changes in immunoreactive FSH and inhibin in developing chicken embryos and the effects of estradiol and the aromatase inhibitor R76713. Biol. Reprod. 1993, 49, 549–554. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Y.; Qiu, Y.; He, J.; Chen, X.; Ding, Y.; Wang, Y.; Liu, X. The toxicity mechanism of sodium fluoride on fertility in female rats. Food Chem. Toxicol. 2013, 62, 566–572. [Google Scholar] [CrossRef] [Scilit]
- Chaithra, B.; Sarjan, H.N.; Shivabasavaiah. Dose and time-dependent effects of sodium fluoride on sperm motility: An in vitro study. Toxicol. Ind. Health 2018, 34, 813–818. [Google Scholar] [CrossRef] [Scilit]
- Miranda, G.H.N.; Gomes, B.A.Q.; Bittencourt, L.O.; Aragão, W.A.B.; Nogueira, L.S.; Dionizio, A.S.; Buzalaf, M.A.R.; Monteiro, M.C.; Lima, R.R. Chronic exposure to sodium fluoride triggers oxidative biochemistry misbalance in mice: Effects on peripheral blood circulation. Oxid. Med. Cell. Longev. 2018, 27, 8379123. [Google Scholar] [CrossRef] [Scilit]
- Sakimura, M.; Tsukada, A.; Usami, M.; Hanzawa, S.; Saito, N.; Ohno, Y.; Shimada, K. Effect of estradiol and nonylphenol on mRNA expression of estrogen receptors α and β, and cytochrome P450 aromatase in the gonad of chicken embryos. J. Poult. Sci. 2002, 39, 302–309. [Google Scholar] [CrossRef] [Scilit]
- González-Morán, M.G. Changes in the immunohistochemical localization of estrogen receptor alpha and in the stereological parameters of the testes of mature and aged chickens (Gallus domesticus). Biochem. Biophys. Res. Communic. 2019, 510, 309–314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Niranjan, M.K.; Srivastava, R. Expression of estrogen receptor alpha in developing brain, ovary and shell gland of Gallus gallus domesticus: Impact of stress and estrogen. Steroids 2019, 146, 21–33. [Google Scholar] [CrossRef] [Scilit]
- Yamamoto, I.; Tsukada, A.; Saito, N.; Shimada, K. Profiles of mRNA expression of genes related to sex differentiation of the gonads in the chicken embryo. Poult. Sci. 2003, 82, 1462–1467. [Google Scholar] [CrossRef] [Scilit]
- Gasc, J.M. Distribution and Regulation of Progesterone Receptor in the Urogenital Tract of the Chick Embryo. An Immunohistochemical Study. Anat. Embryol. 1991, 183, 415–426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- González-Morán, M.G. Immunohistochemical localization of progesterone receptor isoforms and estrogen receptor alpha in the chicken oviduct magnum during development. Acta Histochem. 2015, 117, 681–687. [Google Scholar] [CrossRef] [Scilit]
- Méndez, M.C.; Chávez, B.; Echeverría, O.; Vilchis, F.; Vázquez Nin, G.H.; Pedernera, E. Evidence for estrogen receptor expression in germ cell and somatic cell subpopulations in the ovary of the newly hatched chicken. Cell Tissue Res. 1999, 298, 145–152. [Google Scholar] [CrossRef] [Scilit]
- Oliveira, A.G.; Dornas, R.A.P.; Praes, L.C.; Hess, R.A.; Mahecha, G.A.B.; Oliveira, C.A. Roosters affected by epididymal lithiasis present local alteration in vitamin D3, testosterone and estradiol levels as well as estrogen receptor 2 (beta) expression. Reproduction 2011, 142, 439–446. [Google Scholar] [CrossRef] [Scilit]
- Nishizawa, N.; Okamoto, I.; Yoshimura, Y. Immunolocalization of sex steroid receptors in the epididymis and ductus deferens of immature and mature Japanese Quail, Coturnix Japonica. Anim. Sci. J. 2002, 73, 339–346. [Google Scholar] [CrossRef] [Scilit]
- Dumasia, K.; Kumar, A.; Deshpande, S.; Sonawane, S.; Balasinor, N.H. Differential roles of estrogen receptors, ESR1 and ESR2, in adult rat spermatogenesis. Mol. Cell. Endocrinol. 2016, 428, 89–100. [Google Scholar] [CrossRef] [Scilit]
- Kuiper, G.G.; Enmark, E.; Pelto-Huikko, M.; Nilsson, S.; Gustafsson, J.-Å. Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc. Natl. Acad. Sci. USA 1996, 93, 5925–5930. [Google Scholar] [CrossRef] [Scilit]
- Shughrue, P.J.; Komm, B.; Merchenthaler, I. The distribution of estrogen receptor-b mRNA in the rat hypothalamus. Steroids 1996, 61, 678–681. [Google Scholar] [CrossRef] [Scilit]
- Mosselman, S.; Polman, J.; Dijkema, R. ER beta: Identification and characterization of a novel human estrogen receptor. FEBS Lett. 1996, 392, 49–53. [Google Scholar] [CrossRef] [Scilit]
- Nakabayashi, O.; Kikuch, H.; Kikuch, T.; Mizuno, S. Differential expression of genes for aromatase and estrogen receptor during the gonadal development in chicken embryos. J. Mol. Endocrinol. 1998, 20, 193–202. [Google Scholar] [CrossRef] [Scilit]
- Scheib, D. Effects and role of estrogens in avian gonadal differentiation. Differentiation 1983, 23, 87–92. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez-Moran, G.; Camacho-Arroyo, I. Immunohistochemical localization of progesterone receptor isoforms in the chick pre-follicular ovary. Anat. Histol. Embryol. 2001, 30, 153–158. [Google Scholar] [CrossRef] [Scilit]
- Teilmann, S.C.; Clement, A.C.; Thorup, J.; Byskoy, G.A.; Chistensen, S.T. Expression and localization of the progesterone receptor in mouse and human reproductive organs. J. Endocrinol. 2006, 191, 525–535. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- González-Morán, M.G.; González-Arenas, A.; Germán-Castelán, L.; Camacho-Arroyo, I. Changes in the content of sex steroid hormone receptors in the growing and regressing ovaries of Gallus domesticus during development. Gen. Comp. Endocrinol. 2013, 189, 51–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, Z.R.; Zhang, R.; Lian, Z.X.; Deng, S.L.; Yu, K. Estrogen-receptor expression and function in female reproductive disease. Cells 2019, 8, 1123. [Google Scholar] [CrossRef] [Scilit]
- Gunawan, A.; Cinar, M.U.; Uddin, M.J.; Kaewmala, K.; Tesfaye, D.; Phatsara, C.; Tholen, E.; Looft, C.; Schellander, K. Investigation on association and expression of ESR2 as a candidate gene for boar sperm quality and fertility. Reprod. Domest. Anim. 2012, 47, 782–790. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hewitt, S.C.; Korach, K.S. Estrogen receptors: New directions in the New Millennium. Endocr. Rev. 2018, 39, 664–675. [Google Scholar] [CrossRef] [Scilit]
- Zhou, G.Y.; Ren, L.J.; Hou, J.X.; Cui, L.X.; Ding, Z.; Cheng, X.M.; Zhu, J.Y.; Cui, R.R.; Ba, Y. Endemic fluorosis in Henan province, China: ERα gene polymorphisms and reproductive hormones among women. Asia Pac. J. Clin. Nutr. 2013, 25, 911–919. [Google Scholar] [CrossRef] [Scilit]
- An, N.; Zhu, J.; Ren, L.; Liu, X.; Zhou, T.; Zuang, H.; Sun, L.; Ding, Z.; Li, Z.; Cheng, X.; et al. Trends of SHBG and ABP levels in male farmers: Influences of environmental fluoride exposure and ESR alpha gene polymorphisms. Ecotoxicol. Environment. Safety 2019, 172, 40–44. [Google Scholar] [CrossRef] [Scilit]
- Yilmaz, B.A.; Korkut, A.; Erkan, M. Sodium fluoride disrupts testosterone biosynthesis by affecting the steroidogenic pathway in TM3 Leydig cells. Chemosphere 2018, 212, 447–455. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Téllez-Rojo, M.; Hu, H.; Sánchez, B.N.; Martinez-Mier, E.A.; Basu, N.; Mercado-García, A.; Solano-González, M.; Peterson, K.E. Fluoride exposure and pubertal development in children living in Mexico City. Environ. Health 2019, 18, 26. [Google Scholar] [CrossRef] [Scilit]
- Nakamoto, T.; Rawls, H.R. Fluoride exposure in early life as the possible root cause of disease in later life. J. Clin. Pediatr. Dent. 2018, 42, 325–330. [Google Scholar] [CrossRef] [Scilit]
- Brenowitz, E.A. Transsynaptic trophic effects of steroid hormones in an avian model of adult brain plasticity. Front Neuroendocrinol. 2015, 37, 119–128. [Google Scholar] [CrossRef] [Scilit]




| Gene | Primer Sequence (5′–3′) | Position [bp] | GenBank Accession Number | Product Size [bp] |
|---|---|---|---|---|
| FSHR | ATGGAACCTGCCTGGATGAG CTTGTATGTAGACCTCGCTCTTAG | 627–646 785–808 | NM_205079 | 182 |
| LHR | ATTGTGCTCCTCGTCCTC GTCTATGGCGTGGTTGTAG | 1273–1290 1416–1434 | AB009283 | 162 |
| ESR1 | TGCGAGCTCCAACCCTTTGGACA GGAGCGCCAGACTAAGCCGATCA | 1037–1059 1343–1365 | NM_205183 | 329 |
| ESR2 | TCCTGCTATGCTGAATTACAAC GGCTCTTAGGCTGCTCTG | 399–420 548–565 | AB036415.1 | 167 |
| PGR | GGAAGGGCAGCACAACTATT GACACGCTGGACAGTTCTTC | 2067–2086 2130–2149 | NM_205262.1 | 83 |
| GAPDH | GTGTGCCAACCCCCAATGTCTCT GCAGCAGCCTTCACTACCCTCT | 752–774 827–848 | NM_204305 | 97 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Grzegorzewska, A.K.; Grot, E.; Sechman, A. Sodium Fluoride In Vitro Treatment Affects the Expression of Gonadotropin and Steroid Hormone Receptors in Chicken Embryonic Gonads. Animals 2021, 11, 943. https://doi.org/10.3390/ani11040943
Grzegorzewska AK, Grot E, Sechman A. Sodium Fluoride In Vitro Treatment Affects the Expression of Gonadotropin and Steroid Hormone Receptors in Chicken Embryonic Gonads. Animals. 2021; 11(4):943. https://doi.org/10.3390/ani11040943
Chicago/Turabian StyleGrzegorzewska, Agnieszka Karolina, Ewa Grot, and Andrzej Sechman. 2021. "Sodium Fluoride In Vitro Treatment Affects the Expression of Gonadotropin and Steroid Hormone Receptors in Chicken Embryonic Gonads" Animals 11, no. 4: 943. https://doi.org/10.3390/ani11040943
APA StyleGrzegorzewska, A. K., Grot, E., & Sechman, A. (2021). Sodium Fluoride In Vitro Treatment Affects the Expression of Gonadotropin and Steroid Hormone Receptors in Chicken Embryonic Gonads. Animals, 11(4), 943. https://doi.org/10.3390/ani11040943

