Validation of Reference Genes via qRT-PCR in Multiple Conditions in Brandt’s Voles, Lasiopodomys brandtii
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. RNA Extraction and cDNA Synthesis
2.3. Selection of Candidate Reference Genes
2.4. qRT–PCR
2.5. Statistical Analysis
3. Results
3.1. Specificity and Amplification Efficiency of Primers
3.2. Expression Features in Different Tissues
3.3. Expression Features at Different Developmental Stages
3.4. Expression Features under Different Photoperiod Conditions
3.5. Validation of the Selected Reference Genes under Different Photoperiod Conditions
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Kubista, M.; Andrade, J.M.; Bengtsson, M.; Forootan, A.; Jonak, J.; Lind, K.; Sindelka, R.; Sjoback, R.; Sjogreen, B.; Strombom, L.; et al. The real-time polymerase chain reaction. Mol. Asp. Med. 2006, 27, 95–125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Wen, H.; Li, Y.; Zhang, K.; Liu, Y. Evaluation of potential reference genes for quantitative RT-PCR analysis in spotted sea bass (Lateolabrax maculatus) under normal and salinity stress conditions. PeerJ 2018, 6, e5631. [Google Scholar] [CrossRef] [Scilit]
- Schefe, J.H.; Lehmann, K.E.; Buschmann, I.R.; Unger, T.; Funke-Kaiser, H. Quantitative real-time RT-PCR data analysis: Current concepts and the novel "gene expression’s CT difference" formula. J. Mol. Med. 2006, 84, 901–910. [Google Scholar] [CrossRef] [Scilit]
- Nailis, H.; Coenye, T.; Van Nieuwerburgh, F.; Deforce, D.; Nelis, H.J. Development and evaluation of different normalization strategies for gene expression studies in Candida albicans biofilms by real-time PCR. BMC Mol. Biol. 2006, 7, 25. [Google Scholar] [CrossRef] [Scilit]
- Barber, R.D.; Harmer, D.W.; Coleman, R.A.; Clark, B.J. GAPDH as a housekeeping gene: Analysis of GAPDH mRNA expression in a panel of 72 human tissues. Physiol. Genom. 2005, 21, 389–395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Glare, E.M.; Divjak, M.; Bailey, M.J.; Walters, E.H. beta-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels. Thorax 2002, 57, 765–770. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chapman, J.R.; Waldenstrom, J. With Reference to Reference Genes: A Systematic Review of Endogenous Controls in Gene Expression Studies. PLoS ONE 2015, 10, e0141853. [Google Scholar] [CrossRef] [Scilit]
- Selvey, S.; Thompson, E.W.; Matthaei, K.; Lea, R.A.; Irving, M.G.; Griffiths, L.R. Beta-actin--an unsuitable internal control for RT-PCR. Mol. Cell. Probes 2001, 15, 307–311. [Google Scholar] [CrossRef] [Scilit]
- Nolan, T.; Hands, R.E.; Bustin, S.A. Quantification of mRNA using real-time RT-PCR. Nat. Protoc. 2006, 1, 1559–1582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, J.; Li, X.; Liu, J.; Fan, X.; Lei, H.; Li, C. Identification of reference genes in blood before and after entering the plateau for SYBR green RT-qPCR studies. PeerJ 2017, 5, e3726. [Google Scholar] [CrossRef] [Scilit]
- Niu, G.; Yang, Y.; Zhang, Y.; Hua, C.; Wang, Z.; Tang, Z.; Li, K. Identifying suitable reference genes for gene expression analysis in developing skeletal muscle in pigs. PeerJ 2016, 4, e2428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pérez, R.; Tupac-Yupanqui, I.; Dunner, S. Evaluation of suitable reference genes for gene expression studies in bovine muscular tissue. BMC Mol. Biol. 2008, 9, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; Li, N.; Tian, L.; Ren, F.; Li, Z.; Chen, Y.; Liu, L.; Hu, X.; Zhang, X.; Song, Y.; et al. Dynamic expressions of hypothalamic genes regulate seasonal breeding in a natural rodent population. Mol. Ecol. 2019, 28, 3508–3522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.Y.; Zhang, Q.; Wang, D.H. Litter size variation in hypothalamic gene expression determines adult metabolic phenotype in Brandt’s voles (Lasiopodomys brandtii). PLoS ONE 2011, 6, e19913. [Google Scholar] [CrossRef] [Scilit]
- Sakai, H.; Sato, K.; Kai, Y.; Shoji, T.; Hasegawa, S.; Nishizaki, M.; Sagara, A.; Yamashita, A.; Narita, M. Distribution of aquaporin genes and selection of individual reference genes for quantitative real-time RT-PCR analysis in multiple tissues of the mouse. Can. J. Physiol. Pharm. 2014, 92, 789–796. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rueda-Martínez, C.; Fernández, M.C.; Soto-Navarrete, M.T.; Jiménez-Navarro, M.; Fernández, B. Identification of Reference Genes for Quantitative Real Time PCR Assays in Aortic Tissue of Syrian Hamsters with Bicuspid Aortic Valve. PLoS ONE 2016, 11, e0164070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, D.; Liu, A.; Wang, X.; Zhang, M.; Zhang, Z.; Tan, Z.; Qiu, M. Identifying suitable reference genes for developing and injured mouse CNS tissues. Dev. Neurobiol. 2018, 78, 39–50. [Google Scholar] [CrossRef] [Scilit]
- Svingen, T.; Letting, H.; Hadrup, N.; Hass, U.; Vinggaard, A.M. Selection of reference genes for quantitative RT-PCR (RT-qPCR) analysis of rat tissues under physiological and toxicological conditions. PeerJ 2015, 3, e855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andersen, C.L.; Jensen, J.L.; Orntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [Scilit]
- Hou, H.; Uusküla-Reimand, L.; Makarem, M.; Corre, C.; Saleh, S.; Metcalf, A.; Goldenberg, A.; Palmert, M.R.; Wilson, M.D. Gene expression profiling of puberty-associated genes reveals abundant tissue and sex-specific changes across postnatal development. Hum. Mol. Genet. 2017, 26, 3585–3599. [Google Scholar] [CrossRef] [Scilit]
- Cardoso-Moreira, M.; Halbert, J.; Valloton, D.; Velten, B.; Chen, C.; Shao, Y.; Liechti, A.; Ascencao, K.; Rummel, C.; Ovchinnikova, S.; et al. Gene expression across mammalian organ development. Nature 2019, 571, 505–509. [Google Scholar] [CrossRef] [Scilit]
- Palmert, M.R.; Boepple, P.A. Variation in the timing of puberty: Clinical spectrum and genetic investigation. J. Clin. Endocrinol. Metab. 2001, 86, 2364–2368. [Google Scholar] [CrossRef] [PubMed]
- Lavery, D.N.; McEwan, I.J. The human androgen receptor AF1 transactivation domain: Interactions with transcription factor IIF and molten-globule-like structural characteristics. Biochem. Soc. Trans. 2006, 34, 1054–1057. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.D.; Yu, B.Y.; Luo, F.H.; Zhang, X.L.; Wu, S.; Liu, L.H.; Wu, Y.J. Gene Expression Profiling of Rat Testis Development During the Early Post-Natal Stages. Reprod. Domest. Anim. 2012, 47, 724–731. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Wang, D.; Li, N.; Hu, X.; Ren, F.; Hao, W.; Song, Y.; Liu, X. Kinship analysis reveals reproductive success skewed toward overwintered Brandt’s voles in semi-natural enclosures. Integr. Zool. 2019, 14, 435–445. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.; Xin, N.; Yi, Z.; Jiang, L.; Zhai, J.; Zhang, Q.; Jie, Q.; Susanne, K.E. Reference Gene Selection for Quantitative Real-Time RT-PCR Normalization in the Half-Smooth Tongue Sole (Cynoglossus semilaevis) at Different Developmental Stages, in Various Tissue Types and on Exposure to Chemicals. PLoS ONE 2014, 9, e91715. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Meng, Q.; Zhu, X.; Sun, S.; Liu, A.; Gao, S.; Gou, Y. Identification and Evaluation of Reference Genes for Normalization of Gene Expression in Developmental Stages, Sexes, and Tissues of Diaphania caesalis (Lepidoptera, Pyralidae). J. Insect Sci. 2020, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]

| Sample Sets | Tissue Type | Postnatal Day | Sex | Photoperiod | Samples of Different Treatments | Total |
|---|---|---|---|---|---|---|
| Tissues | Hypothalamus, pituitary, heart, kidney, adrenal gland, small intestine, bladder, and testes | 4 week(w) | male | Voles were raised under the natural photoperiod conditions in Beijing city. All samples were dissected in May. | 3,3,3,3,3,3,3,3 | 24 |
| Developmental stages | Hypothalamus | 2 w, 4 w, 8 w, 9 months (m), 20 m | female | Voles were raised under the natural photoperiod conditions in Beijing city. Males and females were dissected between May and June. | 8,8,7,8,8 | 39 |
| Hypothalamus | 2 w, 4 w, 8 w, 9 m, 20 m | male | 7,8,8,8,8 | 39 | ||
| Photoperiod conditions | Hypothalamus | 6 w | male | Voles were raised under different photoperiod conditions, including Light: Dark = 16:8; Light: Dark = 8:16; and the natural photoperiod conditions from September to next March in Beijing city. The age of the newborns was equivalent to the period of treatment. | 4,3,6 | 13 |
| Hypothalamus | 12 w | male | 6,5,7 | 18 | ||
| Hypothalamus | 24 w | male | 4,5,4 | 13 |
| Gene Name | Primers (5′-3′) | Amplicon Size(bp) | PCR Efficiency | R-Squared Value |
|---|---|---|---|---|
| Gapdh | GCTGCCCAGAACATCATCCCTG | 126 | 96.685 | 0.999 |
| GACGACGGACACATTGGGGGTA | ||||
| Hprt1 | TGACACTGGTAAAACAATGCAGACT | 110 | 95.576 | 0.999 |
| ACCCAACACTTCGAGAGGTCC | ||||
| β-actin | GCTCTCTTCCAGCCTTCCTTCCTG | 112 | 96.471 | 0.999 |
| GTGTTGGCGTACAGGTCCTTGCGG | ||||
| PPIA | TGGTGGGTAAGAAGCCCGCAA | 110 | 95.443 | 1 |
| GGAAGCCATGGAGCGTTTTGGA | ||||
| Rpl13a | CATGCTGCCCCACAAGACCA | 150 | 97.145 | 0.987 |
| GCAAACTTCCTTGTAGGCTTCAG | ||||
| Tbp | CCCTATGACCCCGATCACTCC | 165 | 107.581 | 0.983 |
| GCAGCAAACCGCTTGGGATTAT | ||||
| Sdha | AATTACAAGGGGCAGGTGCTGAA | 139 | 100.345 | 0.991 |
| TACGAGGTCCAATAGGGAATTTGC | ||||
| Hmbs | TGCCAGAGAAAAGTGCGGTG | 102 | 100.429 | 0.993 |
| TGAGGTTGCCCCGAATACTCC | ||||
| B2M | GTTACACACACCACTCTGAAGGAAC | 115 | 98.056 | 0.997 |
| TTAAACTGGTCCAAATGAAGCATCT | ||||
| Dio2 | [14] |
| Gene Name | p-Value by Shapiro-Wilk Test | p-Value of Intergroup Variation | Mean Cq | Standard Deviation (SD) Cq | CV | Rank |
|---|---|---|---|---|---|---|
| Gapdh | 0.37 | 0.230 | 15.85 | 2.22 | 13.99 | 6 |
| Hprt1 | 0.24 | 0.039 | 19.76 | 2.54 | 12.86 | 5 |
| β-actin | 0.16 | 0.055 | 15.64 | 2.23 | 14.26 | 7 |
| PPIA | 0.01 | 0.138 | 13.58 | 1.96 | 14.46 | 8 |
| Rpl13a | 0.15 | 0.194 | 15.19 | 2.28 | 15.02 | 9 |
| Tbp | 0.30 | 0.011 | 22.29 | 2.60 | 11.67 | 3 |
| Sdha | 0.09 | 0.125 | 19.06 | 1.85 | 9.73 | 1 |
| Hmbs | 0.01 | 0.080 | 21.48 | 2.26 | 10.52 | 2 |
| B2M | 0.01 | 0.051 | 18.50 | 2.21 | 11.93 | 4 |
| Gene Name | Intergroup Variation | Intragroup Variation | Stability Value | Rank |
|---|---|---|---|---|
| Gapdh | 3.15 | 0.54 | 0.89 | 4 |
| Hprt1 | ||||
| β-actin | 2.09 | 0.68 | 0.95 | 5 |
| PPIA | 2.62 | 0.36 | 0.64 | 3 |
| Rpl13a | 2.01 | 0.76 | 0.98 | 6 |
| Tbp | ||||
| Sdha | 1.95 | 0.42 | 0.73 | 1 |
| Hmbs | 2.80 | 0.59 | 0.75 | 2 |
| B2M | 5.67 | 1.46 | 1.53 | 7 |
| Gene Name | p-Value by Shapiro-Wilk Test | p-Value of Intergroup Variation | Mean Cq | SD Cq | CV | CV Rank |
|---|---|---|---|---|---|---|
| Gapdh | 7.95 × 10−2 | 5.20 × 10−5 | 12.16 | 0.97 | 7.99 | 8 |
| Hprt1 | 5.00 × 10−1 | 2.75 × 10−2 | 14.63 | 0.50 | 3.43 | 1 |
| β-actin | 1.19 × 10−1 | 2.44 × 10−6 | 13.30 | 1.09 | 8.19 | 9 |
| PPIA | 6.07 × 10−1 | 6.61 × 10−4 | 10.91 | 0.56 | 5.11 | 6 |
| Rpl13a | 1.86 × 10−1 | 6.15 × 10−3 | 12.55 | 0.57 | 4.53 | 3 |
| Tbp | 1.99 × 10−2 | 1.47 × 10−4 | 19.27 | 0.89 | 4.59 | 4 |
| Sdha | 1.11 × 10−1 | 6.90 × 10−5 | 15.76 | 0.96 | 6.09 | 7 |
| Hmbs | 1.61 × 10−1 | 1.79 × 10−4 | 18.33 | 0.92 | 5 | 5 |
| B2M | 8.20 × 10−1 | 6.30 × 10−1 | 18.20 | 0.73 | 4.01 | 2 |
| Gene Name | p-Value by Shapiro-Wilk Test | p-Value of Intergroup Variation | Mean Cq | SD Cq | CV | CV Rank |
|---|---|---|---|---|---|---|
| Gapdh | 2.74 × 10−3 | 6.44 × 10−3 | 12.08 | 1.18 | 9.75 | 9 |
| Hprt1 | 3.16 × 10−4 | 1.56 × 10−2 | 14.54 | 0.83 | 5.70 | 2 |
| β-actin | 2.06 × 10−3 | 5.58 × 10−4 | 13.15 | 1.26 | 9.60 | 8 |
| PPIA | 5.38 × 10−4 | 5.36 × 10−2 | 10.85 | 0.84 | 7.74 | 7 |
| Rpl13a | 1.42 × 10−4 | 6.68 × 10−2 | 12.53 | 0.84 | 6.72 | 4 |
| Tbp | 1.93 × 10−5 | 1.35 × 10−3 | 19.17 | 1.18 | 6.13 | 3 |
| Sdha | 1.45 × 10−3 | 7.70 × 10−3 | 15.63 | 1.17 | 7.50 | 6 |
| Hmbs | 2.50 × 10−4 | 4.18 × 10−3 | 18.30 | 1.27 | 6.91 | 5 |
| B2M | 5.63 × 10−1 | 1.47 × 10−1 | 18.11 | 1.03 | 5.68 | 1 |
| Gene Name | Intergroup Variation | Intragroup Variation | Stability Value | Rank |
|---|---|---|---|---|
| Gapdh | ||||
| Hprt1 | ||||
| β-actin | ||||
| PPIA | 0.78 | 0.26 | 0.25 | 2 |
| Rpl13a | 0.23 | 0.15 | 0.13 | 1 |
| Tbp | ||||
| Sdha | ||||
| Hmbs | ||||
| B2M | 1.01 | 0.66 | 0.4 | 3 |
| Gene Name | p-Value by Shapiro-Wilk Test | p-Value of Intergroup Variation | Mean Cq | SD Cq | CV | CV Rank |
|---|---|---|---|---|---|---|
| Gapdh | 0.25 | 8.97 × 10−4 | 17.31 | 2.18 | 12.61 | 8 |
| Hprt1 | 0.04 | 3.95 × 10−2 | 19.82 | 1.85 | 9.33 | 5 |
| β-actin | 0.22 | 1.29 × 10−2 | 16.80 | 1.53 | 9.08 | 4 |
| PPIA | 0.42 | 2.08 × 10−2 | 14.06 | 1.32 | 9.41 | 6 |
| Rpl13a | 0.46 | 6.42 × 10−4 | 20.12 | 2.47 | 12.26 | 7 |
| Tbp | 0.01 | 5.87 × 10−2 | 22.08 | 1.98 | 8.97 | 3 |
| Sdha | 0.26 | 4.55 × 10−4 | 22.58 | 2.94 | 13.02 | 9 |
| Hmbs | 0.96 | 4.07 × 10−2 | 23.73 | 1.93 | 8.15 | 2 |
| B2M | 0.31 | 3.60 × 10−2 | 19.31 | 1.53 | 7.94 | 1 |
| Gene Name | p-Value by Shapiro-Wilk Test | p-Value of Intergroup Variation | Mean Cq | SD Cq | CV | CV Rank |
|---|---|---|---|---|---|---|
| Gapdh | 0.94 | 0.59 | 17.91 | 1.78 | 9.96 | 9 |
| Hprt1 | 0.61 | 0.19 | 20.12 | 1.29 | 6.43 | 4 |
| β-actin | 0.79 | 0.53 | 17.26 | 1.10 | 6.35 | 3 |
| PPIA | 0.22 | 0.58 | 14.14 | 1.15 | 8.17 | 6 |
| Rpl13a | 0.84 | 0.75 | 20.89 | 1.89 | 9.07 | 7 |
| Tbp | 0.67 | 0.31 | 22.13 | 1.31 | 5.94 | 1 |
| Sdha | 0.62 | 0.41 | 23.30 | 2.15 | 9.23 | 8 |
| Hmbs | 0.58 | 0.25 | 24.21 | 1.58 | 6.53 | 5 |
| B2M | 0.10 | 0.22 | 19.42 | 1.19 | 6.12 | 2 |
| Gene Name | Intergroup Variation | Intragroup Variation | Stability Value | Rank |
|---|---|---|---|---|
| Gapdh | 0.68 | 0.67 | 0.47 | 4 |
| Hprt1 | 1.21 | 0.83 | 0.6 | 6 |
| β-actin | 0.29 | 0.57 | 0.36 | 2 |
| PPIA | 0.2 | 0.61 | 0.35 | 1 |
| Rpl13a | 0.8 | 1.11 | 0.6 | 7 |
| Tbp | 0.63 | 0.7 | 0.45 | 3 |
| Sdha | 1.35 | 1.12 | 0.73 | 9 |
| Hmbs | 1.2 | 0.35 | 0.52 | 5 |
| B2M | 1.4 | 0.56 | 0.61 | 8 |
| Gene Name | p-Value by Shapiro-Wilk Test | p-Value of Intergroup Variation | Mean Cq | SD Cq | CV | CV Rank |
|---|---|---|---|---|---|---|
| Gapdh | 0.88 | 0.74 | 18.54 | 1.97 | 10.61 | 9 |
| Hprt1 | 0.85 | 0.95 | 19.82 | 1.09 | 5.52 | 1 |
| β-actin | 0.34 | 0.70 | 16.97 | 1.26 | 7.40 | 6 |
| PPIA | 0.34 | 0.80 | 13.99 | 0.98 | 7.02 | 5 |
| Rpl13a | 0.95 | 0.88 | 21.56 | 1.70 | 7.87 | 7 |
| Tbp | 0.29 | 0.65 | 21.78 | 1.41 | 6.47 | 3 |
| Sdha | 0.35 | 0.76 | 23.71 | 2.21 | 9.31 | 8 |
| Hmbs | 0.20 | 0.82 | 24.07 | 1.62 | 6.73 | 4 |
| B2M | 0.98 | 0.91 | 19.00 | 1.08 | 5.70 | 2 |
| Gene Name | Intergroup Variation | Intragroup Variation | Stability Value | Rank |
|---|---|---|---|---|
| Gapdh | 0.72 | 0.64 | 0.35 | 7 |
| Hprt1 | 0.49 | 0.45 | 0.25 | 2 |
| β-actin | 0.41 | 0.39 | 0.26 | 3 |
| PPIA | 0.09 | 0.56 | 0.27 | 4 |
| Rpl13a | 1.22 | 0.92 | 0.47 | 8 |
| Tbp | 0.62 | 0.58 | 0.33 | 6 |
| Sdha | 1.08 | 1 | 0.5 | 9 |
| Hmbs | 0.35 | 0.26 | 0.21 | 1 |
| B2M | 0.44 | 0.55 | 0.27 | 5 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tian, L.; Chen, Y.; Wang, D.-W.; Liu, X.-H. Validation of Reference Genes via qRT-PCR in Multiple Conditions in Brandt’s Voles, Lasiopodomys brandtii. Animals 2021, 11, 897. https://doi.org/10.3390/ani11030897
Tian L, Chen Y, Wang D-W, Liu X-H. Validation of Reference Genes via qRT-PCR in Multiple Conditions in Brandt’s Voles, Lasiopodomys brandtii. Animals. 2021; 11(3):897. https://doi.org/10.3390/ani11030897
Chicago/Turabian StyleTian, Lin, Yan Chen, Da-Wei Wang, and Xiao-Hui Liu. 2021. "Validation of Reference Genes via qRT-PCR in Multiple Conditions in Brandt’s Voles, Lasiopodomys brandtii" Animals 11, no. 3: 897. https://doi.org/10.3390/ani11030897
APA StyleTian, L., Chen, Y., Wang, D.-W., & Liu, X.-H. (2021). Validation of Reference Genes via qRT-PCR in Multiple Conditions in Brandt’s Voles, Lasiopodomys brandtii. Animals, 11(3), 897. https://doi.org/10.3390/ani11030897
