Next Article in Journal
Issues of Feeding Strategy for Lactating Cows in Vietnamese Smallholder Dairy Farms
Next Article in Special Issue
Biodiversity of Ligilactobacillus salivarius Strains from Poultry and Domestic Pigeons
Previous Article in Journal
Total and Differential Cell Counts as a Tool to Identify Intramammary Infections in Cows after Calving
Previous Article in Special Issue
In Vitro Antibacterial Activity of Manuka (Leptospermum scoparium J.R. et G. Forst) and winter Savory (Satureja montana L.) Essential Oils and Their Blends against Pathogenic E. coli Isolates from Pigs
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biofilm-Formation Ability and the Presence of Adhesion Genes in Coagulase-Negative Staphylococci Isolates from Chicken Broilers

1
Sub-Department of Preventive Veterinary and Avian Diseases, Faculty of Veterinary Medicine, Institute of Biological Bases of Animal Diseases, University of Life Sciences in Lublin, 20-950 Lublin, Poland
2
Department of Epizootiology and Clinic of Infectious Diseases, Faculty of Veterinary Medicine, University of Life Sciences in Lublin, Głęboka 30, 20-612 Lublin, Poland
3
Eskulap-Veterinary Clinic, 37-310 Nowa Sarzyna, Poland
*
Author to whom correspondence should be addressed.
Animals 2021, 11(3), 728; https://doi.org/10.3390/ani11030728
Submission received: 18 February 2021 / Accepted: 2 March 2021 / Published: 7 March 2021
(This article belongs to the Special Issue Alternative Methods for Control of Pathogens in Livestock)

Simple Summary

Bacteria of the genus Staphylococcus are universally present on the mucous membranes and skin of warm-blooded animals. They are divided into two groups on the basis of their ability to clot blood plasma: the coagulase-positive (CoPS) and coagulase-negative staphylococci (CoNS). Some species can cause opportunistic infections in poultry. Identification and characterization of strains of the genus Staphylococcus isolated from farm animals are crucial in epidemiological research and for developing effective methods to treat infections and food poisoning induced by these bacteria. The main virulence factor of coagulase-negative staphylococci is considered to be their ability to form complex biofilm structures on the surfaces of damaged tissues. Biofilms increase the invasive properties of CoNS and their ability to cause infection. The purpose of this study was to determine the biofilm-forming potential of coagulase-negative Staphylococcus strains isolated from poultry. The frequency of selected genes potentially playing a role in the biofilm formation process was also determined. The results of the study indicate that the majority (79.3%) of CoNS isolated from broiler chickens in this study were capable of producing a biofilm.

Abstract

The aim of the study was to analyze the biofilm-production capacity of 87 coagulase-negative Staphylococcus strains (CoNS) isolated from broiler chickens and to determine the occurrence of biofilm-associated genes. The biofilm production capacity of staphylococci was assessed using the microtiter plate method (MTP), and the frequency of genes was determined by PCR. The ability to form a biofilm in vitro was shown in 79.3% of examined strains. Strong biofilm capacity was demonstrated in 26.4% of strains, moderate capacity in 25.3%, weak capacity in 27.6%, and a complete lack of biofilm production capacity in 20.7% of strains. The icaAB gene responsible for the production of extracellular polysaccharide adhesins was detected in 6.9% of strains. The other four genes, i.e., bap (encoding biofilm-associated protein), atlE (encoding cell surface protein exhibiting vitronectin-binding activity), fbe (encoding fibrinogen-binding protein), and eno (encoding laminin-binding protein) were detected in 5.7%, 19.5%, 8%, and 70.1% of strains, respectively. Demonstration of genes that play a role in bacterial biofilm formation may serve as a genetic basis to distinguish between symbiotic and potentially invasive coagulase-negative staphylococcal strains.

1. Introduction

Bacteria of the genus Staphylococcus are ubiquitous in the environment, including the water, soil, and air, and are isolated from various animal species, including poultry. The genus Staphylococcus currently includes almost 60 species, and within some of these species, subspecies have been distinguished [1]. Traditionally, they are divided into two groups on the basis of their ability to clot blood plasma (the coagulase reaction). From a clinical perspective, particularly harmful species include coagulase-positive staphylococci, such as S. aureus, S. intermedius, S. schleiferi subsp. coagulans, S. pseudointermedius, S. lutrae, and S. delphini, and some strains of the species S. hyicus. The most important of these is S. aureus, which, apart from organ infections, can produce as many as 25 different toxins causing severe food poisoning [2]. The remaining Staphylococcus species, which are coagulase-negative (CoNS), usually induce infections in individuals with reduced immunity. CoNS are natural in the microbiota of humans and animals. They inhabit the digestive tract and respiratory system and are present as physiological biota on the skin and mucous membranes of humans and animals. CoNS have been isolated from clinically infected chickens with cellulitis, granulomas in the liver and lungs, and gangrenous dermatitis or subcutaneous abscesses. S. xylosus and S. simulans have been recovered from infected bones and in the course of endocarditis [3,4,5]. These staphylococcal species can also induce subclinical disease with histopathological lesions in the liver, spleen, and intestines of infected chickens [6,7]. Compared to S. aureus, CoNS do not produce a large number of toxic enzymes and toxins [1]. Factors affecting their virulence include structures that compose the bacterial cell, as well as substances and structures produced extracellularly but integrally associated with the cell, e.g., mucus or adhesins [8]. These microorganisms were long-considered non-pathogenic, and isolation from material collected from sick individuals was treated as contamination [9]. However, due to their implication in infections in both humans and animals, research interest in CoNS has increased over the past decade [10,11,12]. Many species, such as S. gallinarum, S. arlettae, S. chromogenes, S. xylosus, and S. epidermidis, have commonly been isolated from the nares and skin of healthy chickens, but some of them have also been isolated from cases of dermatitis tendinitis and endocarditis in chickens [3,5,13,14,15]. Moreover, chicken meat products are susceptible to contamination by these bacteria during post-slaughter processing. The contamination is mainly attributed to poor carcasses handling or cross-contamination during meat processing [7]. In recent years, species such as S. equorum, S. saprophyticus, S. haemolyticus, S. xylosus, and especially S. epidermidis have also been isolated from clinical specimens collected from humans [9,16]. Among coagulase-negative staphylococci, S. epidermidis and S. saprophyticus have the greatest pathogenic potential and diversity. S. epidermidis strains from different sources exhibit genetic differences. For example, S. epidermidis isolated from infections associated with clinical catheters has been reported to differ from those isolated from other environments [17,18,19]. Different origins of isolates, e.g., from animals or air, may affect their adherence and/or capability of forming a biofilm
The main virulence factor in this group of bacteria is considered to be their ability to form complex biofilm structures on the surfaces of damaged tissues [20,21,22]. The biofilm ensures bacterial survival by making cells less accessible to the host’s defense system and by impairing antibiotic activity. Bacteria present in the biofilm show stronger resistance to antibiotics, whose concentrations must be several times higher to kill microorganisms compared to planktonic cells [23]. The biofilm is permanently attached to the substrate on which it grows, which can be either inanimate matter or body tissues. The biofilm allows bacteria to colonize diverse ecological niches, and in many cases to survive in adverse conditions for individual cells. In the natural environment, over 99% of bacteria occur in the form of a biofilm. The biofilm promotes the survival of bacteria in the host organism, protecting them against immune mechanisms. As a result of biofilm fragmentation and detachment, bacteria can spread in the body, colonizing new places; therefore, biofilm infections are very often chronic and recurrent [24].
Several stages can be distinguished in biofilm development: cell adhesion to the surface, production of microcolonies, biofilm maturation, and detachment of surface biofilm fragments and/or individual planktonic cells [25]. Initial attachment occurs via various proteins, such as Bhp, AtlE, and Fbe, as well as intercellular adhesin. The accumulation stage is characterized by the production of polysaccharide intercellular adhesin (PIA), encoded by icaADBC genes [26,27]. Two major cell-surface-associated proteins, Aap and Embp, have also been shown to contribute to biofilm formation in CoNS. The accumulation protein (Aap) belongs to the Bap family of proteins, and the extracellular matrix-binding protein (Embp) mediates binding of bacteria to fibronectin and is involved in biofilm accumulation [28]. As a result of adhesion to the surface, significant changes in cell metabolism occur, mainly consisting of increased expression of genes encoding the production of extracellular proteins and extracellular secreted polysaccharide substances. The result is cell immobilization in the extracellular matrix, allowing further biofilm formation.
Although research interest in CoNS has increased in recent years, there are very little data on its prevalence and characteristics in poultry production. Therefore, the purpose of this study was to determine the biofilm-forming potential of coagulase-negative Staphylococcus strains isolated from poultry. The frequency of selected genes potentially playing a role in the biofilm formation process was also determined.

2. Materials and Methods

2.1. Sample Collection and Identification of Bacterial Strains

The study was conducted on material obtained from broiler chicken farms located in Central-Western Poland between November 2016 and December 2017. During this time, samples from 84 flocks were collected. The samples were taken from the internal organs (heart, liver, spleen, tarsal joints, or bone marrow) of chickens aged 1 day to 6 weeks and showing the following clinical symptoms: increased mortality, dermatitis and cellulitis, lameness and arthritis, decreased weight gain, and/or omphalitis and yolk sac infections. Three to five specimens were taken from the affected organs of each bird. A total of 268 samples were collected from the broilers. The size of the flocks from which the samples were collected ranged from 8000 to 44,000 birds.
The material (samples of internal organs) was plated on a blood agar medium (Blood LAB-AGAR, Biocorp, Warsaw, Poland) and Chapman selective medium (Mannitol Salt LAB-AGAR, Biocorp, Warsaw, Poland) and incubated under aerobic conditions at 37 °C for 24–48 h, depending on the rate of growth of the bacteria. Single colonies were transferred to blood agar to isolate pure bacterial cultures, and a preliminary bacteriological characterization of the isolated bacteria was performed, involving Gram staining, microscope examination of cell morphology and motility, and determination of the type of hemolysis. Quantitative measurement of the colonies was not performed. Isolated bacteria were stored for further testing at −85 °C in 50% (v/v) glycerol in brain heart infusion broth (BHI; Sigma-Aldrich, Poznan, Poland).
All Staphylococcus strains were identified by MALDI-TOF MS mass spectrometry using the IVD MALDI Biotyper (Bruker Daltonik, Bremen, Germany), as described by Marek et al. [3].

2.2. Biofilm Detection by the Microtiter Plate (MTP) Method

All CoNS isolates were grown overnight at 37 °C on blood agar. Single colonies were inoculated in 3 mL of brain heart infusion broth (BHI; Sigma-Aldrich, Poznan, Poland), incubated for 24 h at 37 °C and then diluted at 1:40 in BHI (2–7 × 107 cfu/mL) using 0.5 MacFarland standard tubes. The microtiter plate test was performed according to Dubravka et al. [29] and Stepanović et al. [30]. For each Staphylococcus isolate, 200 μL aliquots of prepared suspension were inoculated into four wells of the 96-well plates (Kartell S.p.A., Noviglio MI, Italy). Each plate included a negative control: four wells with BHI. The plates were incubated at 37 °C for 24 h. Then the contents of each well were removed by aspiration, and the wells were rinsed three times with 250 μL of sterile physiological saline. After the plates were dried, the attached bacteria were fixed for 15 min at room temperature by adding 200 μL of methanol to each well. The plates were stained with 160 μL aqueous solution of crystal violet 0.5% (Crystal Violet, Sigma) for 15 min at room temperature. Then, the plates were rinsed under running water until there was no visible trace of stain. The stain bound to bacteria was dissolved by adding 160 μL of 95% ethanol. The optical density (OD) of each well was measured using an ELISA microplate reader (BIO-RAD, Warsaw, Poland) at 570 nm. Each strain was tested for biofilm production in duplicates and the assay was repeated three times. The following criteria were used for biofilm gradation in clinical isolates. ODc = ODavg of negative control + 3 × standard deviation (SD) of ODs of negative control.
Strains were interpreted as follows:
(1)
non-biofilm producers (OD ≤ ODc);
(2)
weak biofilm producers (ODc < OD ≤ 2 × ODc);
(3)
moderate biofilm producers (2 × ODc < OD ≤ 4 × ODc);
(4)
strong biofilm producers (4 × ODc < OD).

2.3. Bacterial DNA Extraction and Detection of Biofilm-Associated Genes

Total DNA was extracted from strains inoculated individually on blood agar and incubated at 37 °C/24 h. The Novabeads Bacterial DNA kit (Novazym, Poznan, Poland) was used for DNA extraction according to the manufacturer’s protocol.
Five biofilm-related genes were analyzed by simplex PCR assays to detect the presence of icaAB (ica cluster encoding synthesis of polysaccharide intercellular adhesion—PIA), bap (encoding biofilm-associated protein), atlE (encoding cell surface protein exhibiting vitronectin-binding activity), fbe (encoding fibrinogen-binding protein), and eno (encoding laminin-binding protein) in all Staphylococcus isolates [31,32,33]. The ica primers were designed to amplify the icaA and icaB genes of the ica locus. The nucleotide sequences of the primers are presented in Table 1.
Each 25 μL PCR mixture contained 1.5 U TaqDNA polymerase (EURX, Gdansk, Poland), 1× Standard Taq reaction buffer (10 mM Tris–HCl, 50 mM KCl, 1.5 mM MgCl2, pH 8.3), 0.5 μM of each primer, 200 μM dNTPs, and 2 μL of template DNA. Each PCR was performed twice to confirm the results, and each experiment included a PCR-positive control strain and a negative control consisting of the PCR mixture without bacterial DNA.
Reference strains Staphylococcus epidermidis ATCC 35984/RP62A (able to form biofilms) and Staphylococcus epidermidis ATCC 12,228 (not able to form biofilms) were selected as positive and negative controls in the genetic testing, respectively. Polymerase chain reaction (PCR) conditions for each pair of primers are presented in Table 1. After PCR amplification, 10 μL of PCR product was resolved by 1% (w/v) agarose gel electrophoresis and visualized by staining with SimplySafe™ (EURX, Gdansk, Poland).

2.4. Statistical Analysis

Statistical analysis was performed with Statistica 10.0 software (StatSoft, Krakow, Poland). The statistically significant differences in the frequency of biofilm-related genes in Staphylococcus isolates were calculated by Fisher’s exact test, which can be performed online at https://www.langsrud.com/stat/fisher.htm, https://www.graphpad.com/quickcalcs/contingency1, or at https://www.socscistatistics.com/tests/fisher/default2.aspx. Results were considered statistically significant at a p-value of <0.05.

3. Results

3.1. Bacterial Strains

A total of 87 CoNS isolates from broiler chickens were selected in this study. These were strains of S. epidermidis (n = 17), S. hominis (n = 4), S. saprophyticus (n = 19), S. xylosus (n = 19), S. haemolyticus (n = 4), S. sciuri (n = 10), S. simulans (n = 5), and S. chromogenes (n = 9), (Table 2).

3.2. Biofilm Detection by the Microtiter Plate (MTP) Method

Testing for biofilm production showed that 69 of the 87 CoNS isolated from broiler chickens were biofilm producers, of which 24 isolates (27.6%) were weak biofilm producers, 11 (25.3%) were moderate biofilm producers, and 13 (26.4%) were strong biofilm producers. The ability to form biofilms varied among CoNS species. All isolates of S. haemolyticus, S. sciuri and S. simulans were found to form biofilms. In addition, more than 84% of S. saprophyticus and S. xylosus isolates were able to form biofilms. In the case of the remaining species, the ability to form a biofilm was observed in a smaller percentage of isolates. The results of the MTP assay of biofilm production by CoNS are presented in Table 3.

3.3. Detection of the icaAB, atlE, fbe, bap, and eno Genes

The majority (72; 82.8%) of the isolates were positive for at least one of the five genes tested in different combinations (Table 4), while only 15 isolates (17.2%) were negative for all five genes. The majority of isolates (n = 61) were positive for the eno gene (70.11%). The presence of the altE gene was demonstrated in 17 Staphylococcus isolates (19.5%). Other genes were found in <10% of the isolates and were found frequently almost exclusively in S. epidermidis, S. xylosus, S. simulans, and S. saprophyticus. Detailed data are presented in Table 3 and Table 4.

4. Discussion

In the present study, 87 coagulase-negative Staphylococcus strains were isolated from broiler chickens. The high number of CoNS isolated in this study could be due to CoNS being abundant in the normal skin and mucosal biota of animals, and some are free-living in the environment [23]. Although normally present, several of these commensal and nonpathogenic staphylococci have been implicated in infections [4]. The predominant CNS species found in this study were S. xylosus and S. saprophyticus, which are found specifically on the skin and mucous membrane of livestock and birds [39]. In studies published by various authors, the percentage of coagulase-negative Staphylococcus species isolated from poultry samples varied significantly. For example, in a study by Boamah et al. [40], the levels of coagulase-negative strains of staphylococci isolated from samples taken from poultry were as follows: S. sciuri 42.97%, S. lentus 35.94%, S. xylosus 4.30%, S. haemolyticus 3.91%, S. saprophyticus 1.95%, and S. cohnii 0.39%. In a report by Simjee et al. [41], 38% of the coagulase-negative Staphylococcus spp. was S. sciuri, while S. lentus and S. xylosus constituted 21% and 14%, respectively. In a study published by El-Nagar et al. [42], in Egypt, the CoNS isolates from poultry samples were S. xylosus (34.49%), S. warneri (17.25%), S. epidermidis (10.34%), S. saprophyticus (10.34%), S. simulans (10.34%), S. hominis (10.34%), and S. capitis (6.9%). Coagulase-negative Staphylococcus species, such as S. sciuri, S. xylosus, or S. cohnii, are considered important poultry pathogens, particularly because they carry genes encoding antimicrobial resistance, biofilm formation, and hemolysin production [40].
Biofilms increase the invasive properties of CoNS and their ability to cause infection [16,43]. The majority (79.3%) of CoNS isolated from broiler chickens in this study were capable of producing a biofilm, and 51.7% were classified as strong or moderate biofilm producers. The data indicated the relatively high prevalence of biofilm-producing CoNS in poultry. Variation was noted in mucus production by strains within individual species. The highest percentage of strains showing strong and moderate biofilm production capacity was observed in the species S. hominis (100%), S. xylosus (78.9%), S. sciuri (60%), S. simulans (60%), and S. saprophyticus (47.4%). There are many reports in the literature about the special ability of S. epidermidis to produce a biofilm [23,44,45]. In our study, among the strains belonging to the species S. epidermidis, only 17.6% phenotypically showed strong or moderate biofilm production, whereas as many as 52.9% of these strains were nonadherent. Although biofilms do not appear to contribute to disease severity, they may play a role in the persistence of CoNS in the environment of infection [46]. In a study by Tremblay et al. [46], using a similar test for biofilm production, most of the Staphylococcus isolates from cows with mastitis were able to form a biofilm (85%). In contrast, Simojoki et al. [47] observed that most of the tested CoNS (68.7%) were biofilm-negative. This can be attributed to the use of tryptone soy broth (TSB) by Simojoki et al. [47] for bacterial cultivation and brain heart infusion broth (BHI) by Tremblay et al. [46]. The chemical composition of the growth medium (e.g., plant base versus animal organ base) is known to influence the expression of bacterial genes, including exopolysaccharide synthesis genes, and thus biofilm formation by staphylococcal species [48].
The first step in the biofilm formation process is bacterial adhesion to the host extracellular matrix and plasma proteins, mediated by various proteins of the family of microbial surface components-recognizing adhesive matrix molecules (MSCRAMMs). The second step is the growth-dependent accumulation of bacteria in multilayered cell clusters (intercellular adhesion), where genes involved in biofilm formation play a role [26,35]. However, there are no literature data concerning the presence of MSCRAMM genes in poultry CoNS isolates. In our study, the majority of isolates were positive for the eno gene (70.1%), which was also the dominant gene (75% of isolates) detected by Simojoki et al. [47]. The eno gene was found to be widely distributed, irrespective of species and biofilm-forming ability. It is therefore likely that eno is not a biofilm-specific gene. The percentage of positive results for the intercellular adhesion gene (icaAB), the key factor in the aggregation stage, was 6.9%, which is similar to the rates found by Simojoki et al. [47] and Srednik et al. [49] in staphylococci isolates from cattle with mastitis. In our study, the highest percentage of strains in which the presence of the icaAB gene was detected belonged to the species S. xylosus. The biofilm-associated protein (bap) is vital for the primary attachment of bacteria and biofilm formation [35]. This gene was identified in a small proportion of S. aureus isolates from bovine mastitis. Bap orthologue genes have also been found in other staphylococcal species, including S. epidermidis, S. chromogenes, S. xylosus, S. simulans, and S. hyicus [35]. In our study, the presence of the bap gene was detected in only a few isolates (n = 5), and the highest percentage of strains in which it was detected also belonged to the species S. xylosus, which confirms the observation that bap is rare outside of S. xylosus isolates [46].
A recent study demonstrated that the primary attachment of S. epidermidis to a polystyrene surface is associated with a cell surface protein exhibiting vitronectin-binding activity. This protein is encoded by the chromosomal atlE gene and exhibits high similarity to the major autolysin of S. aureus [32]. The presence of the autolysin (atlE) gene was demonstrated in as many as 19.5% of the tested isolates belonging to the species S. epidermidis, S. saprophyticus, S. chromogenes, and S. haemolyticus. However, the fibrinogen-binding protein gene (fbe) was found in only 8% of the tested isolates belonging to the species S. epidermidis, S. xylosus, and S. simulans. In our study, the fbe and atlE genes were present in five strains of S. epidermidis, which constituted 29.4% of isolates belonging to this species. This result differs significantly from that obtained by Lianhua et al. [50], who detected these genes in 94.6% of human clinical isolates of S. epidermidis.
Notably, there are some limitations in detecting a selected MSCRAMMs genes and associating them with the biofilm phenotype. Our results showed that not all icaAB gene-carrying isolates had the capacity to produce biofilms and that the icaAB gene was not found in most biofilm-producing strains. It was reported that the correlation between ica carriage and the biofilm-forming ability of Staphylococcus bacteria is unpredictable because the expression of biofilm-depending genes and the adhesion on surfaces are complex processes of gene regulation dependent on several factors as well as nutrients, pH value, and surface characteristics [51].

5. Conclusions

The growing role of coagulase-negative staphylococci in animal infections necessitates their accurate identification, which in turn will enable precise determination of the pathogenic role of particular species. The results of the study indicate that poultry can be a source of coagulase-negative staphylococci capable of forming biofilms, which is considered a clinically important virulence factor of these bacteria. The study showed that almost all CoNS strains from broilers are able to form a biofilm, and over half of the isolates were strong or moderate biofilm producers. This indicates that biofilm formation in CoNS species is unlikely to occur due to a single component and/or process. Furthermore, the ability of these species to form a biofilm limits treatment possibilities and thus may increase the morbidity and mortality rate in poultry. The eno gene was the only MSCRAMM gene commonly detected in CoNS in poultry isolates. Biofilm production by CoNS may occur irrespective of the presence of icaAB genes.
Demonstration of genes that play a role in bacterial biofilm formation may serve as a genetic basis to distinguish between symbiotic and potentially invasive coagulase-negative staphylococcal strains.

Author Contributions

Conceptualization, all authors; data curation, A.M. (mainly), E.P. and D.S.-P.; formal analysis, M.D., Ł.S.J., A.N., and M.S.; writing—original draft, A.M.; editing, all; writing—review and editing, A.M. and E.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Götz, F.; Bannerman, T.; Schleifer, K.L. The genera Staphylococcus and Macrococcus. In The Prokaryotes—A Handbook on the Biology of Bacteria: Firmicutes, Cyanobacteria, 3rd ed.; Dworkin, M., Falkow, S., Rosenberig, E., Schleifer, K.H., Stackebrands, E., Eds.; Springer: New York, NY, USA, 2006; Volume 4, pp. 5–75. [Google Scholar] [CrossRef] [Scilit]
  2. Kmieciak, W.; Szewczyk, E.M. Coagulase-positive species of the genus Staphylococcus—Taxonomy, pathogenicity. Adv. Microbiol. 2017, 56, 233–244. [Google Scholar] [CrossRef] [Scilit]
  3. Marek, A.; Stępień-Pyśniak, D.; Pyzik, E.; Adaszek, Ł.; Wilczyński, J.; Winiarczyk, S. Occurrence and characterization of Staphylococcus bacteria isolated from poultry in Western Poland. Berl. Munch. Tierarztl. Wochenschr. 2016, 129, 147–152. [Google Scholar] [CrossRef] [PubMed]
  4. McNamee, P.T.; Smyth, J.A. Bacterial chondronecrosis with osteomyelitis (“femoral head necrosis”) of broilers chickens: A review. Avian Pathol. 2000, 29, 253–270. [Google Scholar] [CrossRef] [Scilit]
  5. Stępień-Pyśniak, D.; Wilczyński, J.; Marek, A.; Śmiech, A.; Kosikowska, U.; Hauschild, T. Staphylococcus simulans associated with endocarditis in broiler chickens. Avian Pathol. 2017, 46, 44–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Norton, R.A.; Bilgili, S.F.; McMurtrey, B.C. A reproducible model for the induction of avian cellulitis in broiler chickens. Avian Dis. 1997, 41, 422–428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Podkowik, M.; Seo, K.S.; Schubert, J.; Tolo, I.; Robinson, D.A.; Bania, J.; Bystron, J. Genotype and enterotoxigenicity of Staphylococcus epidermidis isolate from ready to eat meat products. Int. J. Food. Microbiol. 2016, 229, 52–59. [Google Scholar] [CrossRef] [Scilit]
  8. Hussain, M.; Wilcox, M.H.; White, P.J. The slime of coagulase-negative staphylococci: Biochemistry and relation to adherence. FEMS Microbiol. Rev. 1993, 10, 191–207. [Google Scholar] [CrossRef]
  9. Piette, A.; Verschraegen, G. Role of coagulase-negative staphylococci in human disease. Vet. Microbiol. 2009, 134, 45–54. [Google Scholar] [CrossRef] [Scilit]
  10. Kloos, W.E.; Bannerman, T.L. Update on clinical significance of coagulase-negative staphylococci. Clin. Microbiol. Rev. 1994, 7, 117–140. [Google Scholar] [CrossRef] [PubMed]
  11. Maskell, R. Importance of coagulase-negative staphylococci as pathogens in the urinary tract. Lancet 1974, 303, 1155–1158. [Google Scholar] [CrossRef] [Scilit]
  12. Taponen, S.; Pyörälä, S. Coagulase-negative staphylococci as cause of bovine mastitis—Not so different from Staphylococcus aureus? Vet. Microbiol. 2009, 134, 29–36. [Google Scholar] [CrossRef] [Scilit]
  13. Devriese, L.A.; Poutrel, B.; Kilpper-Bälz, R.; Schleifer, K.H. Staphylococcus gallinarum and Staphylococcus caprae, two new species from animals. Int. J. Syst. Bacteriol. 1983, 33, 480–486. [Google Scholar] [CrossRef] [Scilit]
  14. Huebner, J.; Goldmann, D.A. Coagulase-negative staphylococci: Role as pathogens. Annu. Rev. Med. 1999, 50, 223–236. [Google Scholar] [CrossRef] [Scilit]
  15. Pyzik, E.; Marek, A.; Stępień-Pyśniak, D.; Urban-Chmiel, R.; Jarosz, Ł.S.; Jagiełło-Podębska, I. Detection of antibiotic resistance and classical enterotoxin genes in coagulase -negative staphylococci isolated from poultry in Poland. J. Vet. Res. 2019, 63, 183–190. [Google Scholar] [CrossRef] [Scilit]
  16. Becker, K.; Heilmann, C.; Peters, G. Coagulasenegative staphylococci. Clin. Microbiol. Rev. 2014, 27, 870–926. [Google Scholar] [CrossRef] [Scilit]
  17. Martineau, F.; Picard, F.J.; Menard, C.; Roy, P.H.; Ouellette, M.; Bergeron, M.G. Development of a rapid PCR assay specific for Staphylococcus saprophyticus and application to direct detection from urine samples. J. Clin. Microbiol. 2000, 38, 3280–3284. [Google Scholar] [CrossRef] [Scilit]
  18. Mateo, M.; Maestre, J.R.; Aguilar, L.; Giménez, M.J.; Granizo, J.J.; Prieto, J. Strong slime production is a marker of clinical significance in Staphylococcus epidermidis isolated from intravascular catheters. Eur. J. Clin. Microbiol. Infect. Dis. 2008, 27, 311–314. [Google Scholar] [CrossRef] [Scilit]
  19. McKenney, D.; Hűbner, J.; Muller, E.; Wang, Y.; Goldnann, D.A.; Pier, G.B. The Ica Locus of Staphylococcus epidermidis Encodes Production of the Capsular Polysaccharide/Adhesin. Infect. Immun. 1998, 66, 4711–4720. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Costerton, J.W.; Stewart, P.S.; Greenberg, E.P. Bacterial biofilms: A common cause of persistent infections. Science 1999, 284, 1318–1322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Götz, F. Staphylococcus and biofilms. Mol. Microbiol. 2002, 43, 1367–1378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Mack, D.; Rohde, H.; Harris, L.G.; Davies, A.P.; Horstkotte, M.A.; Knobloch, J.K.-M. Biofilm formation in medical device-related infection. Int. J. Artif. Organs 2006, 29, 343–359. [Google Scholar] [CrossRef] [Scilit]
  23. Otto, M. Staphylococcus epidermidis—The “accidental” pathogen. Nat. Rev. Microbiol. 2009, 7, 555–567. [Google Scholar] [CrossRef] [Scilit]
  24. Davey, M.E.; O’toole, G.A. Microbial biofilms: From ecology to molecular genetics. Microbiol. Mol. Biol. Rev. 2000, 64, 847–867. [Google Scholar] [CrossRef] [Scilit]
  25. Rosenthal, C.B.; Mootz, J.M.; Horswill, A.R. Staphylococcus aureus, biofilm formation and inhibition. Antibiofilm Agents 2014, 8, 233–255. [Google Scholar] [CrossRef] [Scilit]
  26. Heilmann, C.; Hussain, M.; Peters, G.; Götz, F. Evidence for autolysin-mediated primary attachment of Staphylococcus epidermidis to a polystyrene surface. Mol. Microbiol. 1997, 24, 1013–1024. [Google Scholar] [CrossRef] [Scilit]
  27. Tristan, A.; Ying, L.; Bes, M.; Etienne, J.; Vandenesch, F.; Lina, G. Use of multiplex PCR to identify Staphylococcus aureus adhesins involved in human hematogenous infections. J. Clin. Microbiol. 2003, 41, 4465–4467. [Google Scholar] [CrossRef] [Scilit]
  28. Bowden, M.G.; Chen, W.; Horndahl, J.K.; Xu, Y.; Peacock, S.J.; Valtulina, V.; Speziale, P.; Hook, M. Identification and preliminary characterization of cell-wall-anchored proteins of Staphylococcus epidermidis. Microbiology 2005, 151, 1453–1464. [Google Scholar] [CrossRef] [Scilit]
  29. Dubravaka, M.; Lazić, S.; Vidić, B.; Petrović, J.; Bugarski, D.; Šeguljev, Z. Slime production ABD biofilm forming ability by Staphylococcus aureus bovine mastitis isolates. Acta Vet. 2010, 60, 217–226. [Google Scholar]
  30. Stepanovic, S.; Vukovic, D.; Hola, V.; Di Bonaventura, G.; Djukic, S.; Cirkovic, I.; Ruzicka, F. Quantification of biofilm in microtiter plates: Overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS 2007, 115, 891–899. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Frebourg, N.B.; Lefebvre, S.; Baert, S.; Lemeland, J.F. PCR-based assay for discrimination between invasive and contaminating Staphylococcus epidermidis strains. J. Clin. Microbiol. 2000, 38, 877–880. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Heilmann, C.; Schweitzer, O.; Gerke, C.; Vanittanakom, N.; Mack, D.; Götz, F. Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis. Mol. Microbiol. 1996, 20, 1083–1091. [Google Scholar] [CrossRef] [Scilit]
  33. Martin-Lopez, J.V.; Diez-Gil, O.; Morales, M.; Batista, N.; Villar, J.; Claverie-Martin, F.; Mendez-Alvarez, S. Simultaneous PCR detection of ica cluster and methicillin and mupirocin resistancegenes in catheter-isolated Staphylococcus. Int. Microbiol. 2004, 7, 63–66. [Google Scholar] [CrossRef]
  34. Schlegelova, J.; Babak, V.; Holasova, M.; Dendis, M. The biofilm-positive Staphylococcus epidermidis isolates in raw materials, foodstuffs and on contact surfaces in processing plants. Folia. Microbiol. 2008, 53, 500–504. [Google Scholar] [CrossRef] [Scilit]
  35. Cucarella, C.; Tormo, M.A.; Ubeda, C.; Trotonda, M.P.; Monzón, M.; Peris, C.; Amorena, B.; Lasa, I.; Penadés, J.R. Role of biofilm-associated protein bap in the pathogenesis of bovine Staphylococcus aureus. Infect. Immun. 2004, 72, 2177–2185. [Google Scholar] [CrossRef] [Scilit]
  36. Nilsson, M.; Frykberg, L.; Flock, J.I.; Pei, L.; Lindberg, M.; Guss, B. A fibrinogen-binding protein of Staphylococcus epidermidis. Infect. Immun. 1998, 66, 2666–2673. [Google Scholar] [CrossRef] [Scilit]
  37. Vautor, E.; Abadie, G.; Pont, A.; Thiery, R. Evaluation of the presence of the bap gene in Staphylococcus aureus isolates recovered from human and animals species. Vet. Microbiol. 2008, 127, 407–411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Seo, Y.S.; Lee, D.Y.; Rayamahji, N.; Kang, M.L.; Yoo, H.S. Biofilm-forming associated genotypic and phenotypic characteristics of Staphylococcus spp. isolated from animals and air. Res. Vet. Sci. 2008, 85, 433–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Shimizu, A.; Ozaki, J.; Kawano, J.; Saitoh, Y.; Kimura, S. Distribution of Staphylococcus species on animal skin. J. Vet. Med. Sci. 1992, 54, 355–357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Boamah, V.E.; Agyare, C.; Odoi, H.; Adu, F.; Gbedema, S.Y.; Dalsgaard, A. Prevalence and antibiotic resistance of coagulase-negative Staphylococci isolated from poultry farms in three regions of Ghana. Infect. Drug Resist. 2017, 10, 175–183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Simjee, S.; McDermott, P.F.; White, D.G.; Hofacre, C.; Berghaus, R.D.; Carter, P.J.; Stewart, L.; Liu, T.; Maier, M.; Maurer, J.J. Antimicrobial susceptibility and distribution of antimicrobial-resistance genes among enterococcus and coagulase-negative Staphylococcus isolates recovered from poultry litter. Avian Dis. 2007, 51, 884–892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. El-Nagar, S.; El-Azeem, M.W.A.; Nasef, S.A.; Sultan, S. Prevalence of toxigenic and methicillin resistant staphylococci in poultry chain production. J. Adv. Vet. Res. 2017, 7, 33–38. [Google Scholar]
  43. Van Meervenne, E.; Weirdt, R.; Coillie, E.; Devlieghere, F.; Herman, L.; Boon, N. Biofilm models for the food industry: Hot spots for plasmid transfer? Pathog. Dis. 2014, 70, 332–338. [Google Scholar] [CrossRef] [Scilit]
  44. Christner, M.; Franke, G.C.; Schommer, N.N.; Wendt, U.; Wegert, K.; Pehle, P.; Kroll, G.; Schulze, C.; Buck, F.; Mack, D.; et al. The giant extracellular matrix-binding protein of Staphylococcus epidermidis mediates biofilm accumulation and attachment to fibronectin. Mol. Microbiol. 2010, 75, 187–207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Qin, Z.; Yang, X.; Yang, L.; Jiang, J.; Ou, Y.; Molin, S.; Qu, D. Formation and properties of in vitro biofilms of ica-negative Staphylococcus epidermidis clinical isolates. J. Med. Microbiol. 2007, 56, 83–93. [Google Scholar] [CrossRef] [Scilit]
  46. Tremblay, Y.D.N.; Lamarche, D.; Chever, P.; Haine, D.; Messier, S.; Jacques, M. Characterizationof the ability of coagulase-negative staphylococci isolatedfrom the milk of Canadian farms to form biofilms. J. Dairy. Sci. 2013, 96, 234–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Simojoki, H.; Hyvonen, P.; Plumed Ferrer, C.; Taponen, S.; Pyörälä, S. Is the biofilm formation and slime producing ability of coagulase-negative staphylococci associated with the persistence and severity of intrammamary infection? Vet. Microbiol. 2012, 158, 344–352. [Google Scholar] [CrossRef] [Scilit]
  48. Fredheim, E.G.A.; Klingenberg, C.; Rodhe, H.; Frankenberger, S.; Gaustad, P.; Flaegstad, T.; Sollid, J.E. Biofilm formation by Staphylococcus haemolyticus. J. Clin. Microbiol. 2009, 47, 1172–1180. [Google Scholar] [CrossRef] [Scilit]
  49. Srednik, M.E.; Trembla, Y.D.N.; Labrie, J.; Archambault, M.; Jacques, M.; Fernandez Cirelli, A.; Gentilini, E.R. Biofilm formation and antimicrobial resistance genes of coagulase-negative staphylococci isolated from cows with mastitis in Argentina. FEMS Microbiol. Lett. 2017, 364, fnx001. [Google Scholar] [CrossRef] [Scilit]
  50. Lianhua, Y.; Yunchao, H.; Guangqiang, Z.; Kun, Y.; Xing, L.; Fengli, G. The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces. Surg. Infect. 2014, 15, 768–773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Stewart, E.J.; Ganesan, M.; Younger, J.G.; Solomon, M.J. Artificial biofilms establish the role of matrix interactions in staphylococcal biofilm assembly and disassembly. Sci. Rep. 2015, 5, 13081. [Google Scholar] [CrossRef] [Scilit]
Table 1. Nucleotide sequences and sizes of PCR products of amplified genes.
Table 1. Nucleotide sequences and sizes of PCR products of amplified genes.
Gene *Oligonucleotide Sequence (5′-3′) **Amplicon Size (bp)PCR ConditionsReferences
icaABTTATCAATGCCGCAGTTGTC
GTTTAACGCGAGTGCGCTAT
54694 °C, 5 min; 30 cycles of 94 °C for 30 s, 55 °C, 1 min, 72 °C, 1 min, final extension 72 °C, 5 min.[34]
atlECAACTGCTCAACCGAGAACA
TTTGTAGATGTTGTGCCCCA
68294 °C, 2 min; 30 cycles of 94 °C for 1 min, 55 °C, 1 min, 72 °C, 2 min, final extension 72 °C, 5 min.[35]
fbeTAAACACCGACGATAATAACCAAA
GGTCTAGCCTTATTTTCATATTCA
49594 °C, 3 min; 30 cycles of: 94 °C, 1 min; 62 °C, 1 min; 72 °C, 1 min; final extension 72 °C, 5 min[36]
bapCCCTATATCGAAGGTGTAGAATTG
GCTGTTGAAGTTAATACTGTACCTGC
97194 °C, 2 min; 40 cycles of 94 °C, 30 s, 55 °C, 30 s, 72 °C, 75 s; final extension 72 °C, 5 min.[37]
enoACGTGCAGCAGCTGACT
CAACAGCATYCTTCAGTACCTTC
30294 °C, 5 min; 35 cycles of 94 °C, 1 min, 56 °C, 1 min, 72 °C, 1 min, final extension 72 °C, 10 min.[38]
* The sets of primers were synthesized by Genomed S.A, Poland; ** The concentration of primers was 0.04 μmol; F—forward primer; R—reverse primer.
Table 2. The distribution of isolated Staphylococcus species in various tissues and organs of broilers.
Table 2. The distribution of isolated Staphylococcus species in various tissues and organs of broilers.
CoNS Source
n (%)
S. epidermidis
17
(19.6)
S. hominis
4
(4.6)
S. saprophyticus
19
(21.8) A
S. xylosus
19
(21.8) A
S. haemolyticus
4
(4.6) *BC
S. sciuri
10
(11.5)
S. simulans
5
(5.8) *BC
S. chromogenes
9
(10.3)
Total Strains (%)
87
(100)
heart5-52314222 (25.3)
liver2--5-3-313 (14.9)
spleen414-131418 (20.7)
tarsal joints6389-1--27 (31.0)
bone marrow--23-2--7 (8.1)
Statistically significant difference (p < 0.005) between * the analyzed species and S. epidermidis, A the analyzed species and S. hominis, B the analyzed species and S. saprophyticus, and c between the analyzed species and S. xylosus. CoNS, coagulase-negative staphylococci
Table 3. Biofilm formation on polystyrene 96-well plates and biofilm-associated genes among CoNS species.
Table 3. Biofilm formation on polystyrene 96-well plates and biofilm-associated genes among CoNS species.
ItemS. epidermidisS. hominisS. saprophyticusS. xylosusS. haemolyticusS. sciuriS. simulansS. chromogenesTotal Strains (%)
n
(%)
17
(19.6)
4
(4.6)
19
(21.8)
19
(21.8)
4
(4.6)
10
(11.5)
5
(5.8)
9
(10.3)
87
(100)
Biofilm
Nonadherent9 33 318 (20.7)
Weak5 71142424 (27.6)
Moderate213635 222 (25.3)
Strong1369 13 23 (26.4)
Biofilm genes
icaAB 14 1 6 (6.9)
bap 13 15 (5.7)
fbe5 1 1 7 (8.0)
atlE5 5 1 617 (19.5)
eno1141816353161 (70.1)
Table 4. Biofilm-associated gene patterns.
Table 4. Biofilm-associated gene patterns.
Biofilm-Associated Gene CombinationsNumber of Isolates (%)
eno40 (46) *
atlE8 (9.2)
fbe2 (2.3)
bap1 (1.2)
icaAB-eno6 (6.9)
atlE-eno6 (6.9)
fbe-eno3 (3.4)
bap-eno3 (3.4)
atlE-eno-bap1(1.2)
atlE-fbe-eno2 (2.3)
* Statistically significant difference (p < 0.001) between the eno gene and the other studied genes.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Marek, A.; Pyzik, E.; Stępień-Pyśniak, D.; Dec, M.; Jarosz, Ł.S.; Nowaczek, A.; Sulikowska, M. Biofilm-Formation Ability and the Presence of Adhesion Genes in Coagulase-Negative Staphylococci Isolates from Chicken Broilers. Animals 2021, 11, 728. https://doi.org/10.3390/ani11030728

AMA Style

Marek A, Pyzik E, Stępień-Pyśniak D, Dec M, Jarosz ŁS, Nowaczek A, Sulikowska M. Biofilm-Formation Ability and the Presence of Adhesion Genes in Coagulase-Negative Staphylococci Isolates from Chicken Broilers. Animals. 2021; 11(3):728. https://doi.org/10.3390/ani11030728

Chicago/Turabian Style

Marek, Agnieszka, Ewelina Pyzik, Dagmara Stępień-Pyśniak, Marta Dec, Łukasz S. Jarosz, Anna Nowaczek, and Magdalena Sulikowska. 2021. "Biofilm-Formation Ability and the Presence of Adhesion Genes in Coagulase-Negative Staphylococci Isolates from Chicken Broilers" Animals 11, no. 3: 728. https://doi.org/10.3390/ani11030728

APA Style

Marek, A., Pyzik, E., Stępień-Pyśniak, D., Dec, M., Jarosz, Ł. S., Nowaczek, A., & Sulikowska, M. (2021). Biofilm-Formation Ability and the Presence of Adhesion Genes in Coagulase-Negative Staphylococci Isolates from Chicken Broilers. Animals, 11(3), 728. https://doi.org/10.3390/ani11030728

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop