Biofilm-Formation Ability and the Presence of Adhesion Genes in Coagulase-Negative Staphylococci Isolates from Chicken Broilers
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Identification of Bacterial Strains
2.2. Biofilm Detection by the Microtiter Plate (MTP) Method
- (1)
- non-biofilm producers (OD ≤ ODc);
- (2)
- weak biofilm producers (ODc < OD ≤ 2 × ODc);
- (3)
- moderate biofilm producers (2 × ODc < OD ≤ 4 × ODc);
- (4)
- strong biofilm producers (4 × ODc < OD).
2.3. Bacterial DNA Extraction and Detection of Biofilm-Associated Genes
2.4. Statistical Analysis
3. Results
3.1. Bacterial Strains
3.2. Biofilm Detection by the Microtiter Plate (MTP) Method
3.3. Detection of the icaAB, atlE, fbe, bap, and eno Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Götz, F.; Bannerman, T.; Schleifer, K.L. The genera Staphylococcus and Macrococcus. In The Prokaryotes—A Handbook on the Biology of Bacteria: Firmicutes, Cyanobacteria, 3rd ed.; Dworkin, M., Falkow, S., Rosenberig, E., Schleifer, K.H., Stackebrands, E., Eds.; Springer: New York, NY, USA, 2006; Volume 4, pp. 5–75. [Google Scholar] [CrossRef] [Scilit]
- Kmieciak, W.; Szewczyk, E.M. Coagulase-positive species of the genus Staphylococcus—Taxonomy, pathogenicity. Adv. Microbiol. 2017, 56, 233–244. [Google Scholar] [CrossRef] [Scilit]
- Marek, A.; Stępień-Pyśniak, D.; Pyzik, E.; Adaszek, Ł.; Wilczyński, J.; Winiarczyk, S. Occurrence and characterization of Staphylococcus bacteria isolated from poultry in Western Poland. Berl. Munch. Tierarztl. Wochenschr. 2016, 129, 147–152. [Google Scholar] [CrossRef] [PubMed]
- McNamee, P.T.; Smyth, J.A. Bacterial chondronecrosis with osteomyelitis (“femoral head necrosis”) of broilers chickens: A review. Avian Pathol. 2000, 29, 253–270. [Google Scholar] [CrossRef] [Scilit]
- Stępień-Pyśniak, D.; Wilczyński, J.; Marek, A.; Śmiech, A.; Kosikowska, U.; Hauschild, T. Staphylococcus simulans associated with endocarditis in broiler chickens. Avian Pathol. 2017, 46, 44–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Norton, R.A.; Bilgili, S.F.; McMurtrey, B.C. A reproducible model for the induction of avian cellulitis in broiler chickens. Avian Dis. 1997, 41, 422–428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Podkowik, M.; Seo, K.S.; Schubert, J.; Tolo, I.; Robinson, D.A.; Bania, J.; Bystron, J. Genotype and enterotoxigenicity of Staphylococcus epidermidis isolate from ready to eat meat products. Int. J. Food. Microbiol. 2016, 229, 52–59. [Google Scholar] [CrossRef] [Scilit]
- Hussain, M.; Wilcox, M.H.; White, P.J. The slime of coagulase-negative staphylococci: Biochemistry and relation to adherence. FEMS Microbiol. Rev. 1993, 10, 191–207. [Google Scholar] [CrossRef]
- Piette, A.; Verschraegen, G. Role of coagulase-negative staphylococci in human disease. Vet. Microbiol. 2009, 134, 45–54. [Google Scholar] [CrossRef] [Scilit]
- Kloos, W.E.; Bannerman, T.L. Update on clinical significance of coagulase-negative staphylococci. Clin. Microbiol. Rev. 1994, 7, 117–140. [Google Scholar] [CrossRef] [PubMed]
- Maskell, R. Importance of coagulase-negative staphylococci as pathogens in the urinary tract. Lancet 1974, 303, 1155–1158. [Google Scholar] [CrossRef] [Scilit]
- Taponen, S.; Pyörälä, S. Coagulase-negative staphylococci as cause of bovine mastitis—Not so different from Staphylococcus aureus? Vet. Microbiol. 2009, 134, 29–36. [Google Scholar] [CrossRef] [Scilit]
- Devriese, L.A.; Poutrel, B.; Kilpper-Bälz, R.; Schleifer, K.H. Staphylococcus gallinarum and Staphylococcus caprae, two new species from animals. Int. J. Syst. Bacteriol. 1983, 33, 480–486. [Google Scholar] [CrossRef] [Scilit]
- Huebner, J.; Goldmann, D.A. Coagulase-negative staphylococci: Role as pathogens. Annu. Rev. Med. 1999, 50, 223–236. [Google Scholar] [CrossRef] [Scilit]
- Pyzik, E.; Marek, A.; Stępień-Pyśniak, D.; Urban-Chmiel, R.; Jarosz, Ł.S.; Jagiełło-Podębska, I. Detection of antibiotic resistance and classical enterotoxin genes in coagulase -negative staphylococci isolated from poultry in Poland. J. Vet. Res. 2019, 63, 183–190. [Google Scholar] [CrossRef] [Scilit]
- Becker, K.; Heilmann, C.; Peters, G. Coagulasenegative staphylococci. Clin. Microbiol. Rev. 2014, 27, 870–926. [Google Scholar] [CrossRef] [Scilit]
- Martineau, F.; Picard, F.J.; Menard, C.; Roy, P.H.; Ouellette, M.; Bergeron, M.G. Development of a rapid PCR assay specific for Staphylococcus saprophyticus and application to direct detection from urine samples. J. Clin. Microbiol. 2000, 38, 3280–3284. [Google Scholar] [CrossRef] [Scilit]
- Mateo, M.; Maestre, J.R.; Aguilar, L.; Giménez, M.J.; Granizo, J.J.; Prieto, J. Strong slime production is a marker of clinical significance in Staphylococcus epidermidis isolated from intravascular catheters. Eur. J. Clin. Microbiol. Infect. Dis. 2008, 27, 311–314. [Google Scholar] [CrossRef] [Scilit]
- McKenney, D.; Hűbner, J.; Muller, E.; Wang, Y.; Goldnann, D.A.; Pier, G.B. The Ica Locus of Staphylococcus epidermidis Encodes Production of the Capsular Polysaccharide/Adhesin. Infect. Immun. 1998, 66, 4711–4720. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Costerton, J.W.; Stewart, P.S.; Greenberg, E.P. Bacterial biofilms: A common cause of persistent infections. Science 1999, 284, 1318–1322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Götz, F. Staphylococcus and biofilms. Mol. Microbiol. 2002, 43, 1367–1378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mack, D.; Rohde, H.; Harris, L.G.; Davies, A.P.; Horstkotte, M.A.; Knobloch, J.K.-M. Biofilm formation in medical device-related infection. Int. J. Artif. Organs 2006, 29, 343–359. [Google Scholar] [CrossRef] [Scilit]
- Otto, M. Staphylococcus epidermidis—The “accidental” pathogen. Nat. Rev. Microbiol. 2009, 7, 555–567. [Google Scholar] [CrossRef] [Scilit]
- Davey, M.E.; O’toole, G.A. Microbial biofilms: From ecology to molecular genetics. Microbiol. Mol. Biol. Rev. 2000, 64, 847–867. [Google Scholar] [CrossRef] [Scilit]
- Rosenthal, C.B.; Mootz, J.M.; Horswill, A.R. Staphylococcus aureus, biofilm formation and inhibition. Antibiofilm Agents 2014, 8, 233–255. [Google Scholar] [CrossRef] [Scilit]
- Heilmann, C.; Hussain, M.; Peters, G.; Götz, F. Evidence for autolysin-mediated primary attachment of Staphylococcus epidermidis to a polystyrene surface. Mol. Microbiol. 1997, 24, 1013–1024. [Google Scholar] [CrossRef] [Scilit]
- Tristan, A.; Ying, L.; Bes, M.; Etienne, J.; Vandenesch, F.; Lina, G. Use of multiplex PCR to identify Staphylococcus aureus adhesins involved in human hematogenous infections. J. Clin. Microbiol. 2003, 41, 4465–4467. [Google Scholar] [CrossRef] [Scilit]
- Bowden, M.G.; Chen, W.; Horndahl, J.K.; Xu, Y.; Peacock, S.J.; Valtulina, V.; Speziale, P.; Hook, M. Identification and preliminary characterization of cell-wall-anchored proteins of Staphylococcus epidermidis. Microbiology 2005, 151, 1453–1464. [Google Scholar] [CrossRef] [Scilit]
- Dubravaka, M.; Lazić, S.; Vidić, B.; Petrović, J.; Bugarski, D.; Šeguljev, Z. Slime production ABD biofilm forming ability by Staphylococcus aureus bovine mastitis isolates. Acta Vet. 2010, 60, 217–226. [Google Scholar]
- Stepanovic, S.; Vukovic, D.; Hola, V.; Di Bonaventura, G.; Djukic, S.; Cirkovic, I.; Ruzicka, F. Quantification of biofilm in microtiter plates: Overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS 2007, 115, 891–899. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frebourg, N.B.; Lefebvre, S.; Baert, S.; Lemeland, J.F. PCR-based assay for discrimination between invasive and contaminating Staphylococcus epidermidis strains. J. Clin. Microbiol. 2000, 38, 877–880. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heilmann, C.; Schweitzer, O.; Gerke, C.; Vanittanakom, N.; Mack, D.; Götz, F. Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis. Mol. Microbiol. 1996, 20, 1083–1091. [Google Scholar] [CrossRef] [Scilit]
- Martin-Lopez, J.V.; Diez-Gil, O.; Morales, M.; Batista, N.; Villar, J.; Claverie-Martin, F.; Mendez-Alvarez, S. Simultaneous PCR detection of ica cluster and methicillin and mupirocin resistancegenes in catheter-isolated Staphylococcus. Int. Microbiol. 2004, 7, 63–66. [Google Scholar] [CrossRef]
- Schlegelova, J.; Babak, V.; Holasova, M.; Dendis, M. The biofilm-positive Staphylococcus epidermidis isolates in raw materials, foodstuffs and on contact surfaces in processing plants. Folia. Microbiol. 2008, 53, 500–504. [Google Scholar] [CrossRef] [Scilit]
- Cucarella, C.; Tormo, M.A.; Ubeda, C.; Trotonda, M.P.; Monzón, M.; Peris, C.; Amorena, B.; Lasa, I.; Penadés, J.R. Role of biofilm-associated protein bap in the pathogenesis of bovine Staphylococcus aureus. Infect. Immun. 2004, 72, 2177–2185. [Google Scholar] [CrossRef] [Scilit]
- Nilsson, M.; Frykberg, L.; Flock, J.I.; Pei, L.; Lindberg, M.; Guss, B. A fibrinogen-binding protein of Staphylococcus epidermidis. Infect. Immun. 1998, 66, 2666–2673. [Google Scholar] [CrossRef] [Scilit]
- Vautor, E.; Abadie, G.; Pont, A.; Thiery, R. Evaluation of the presence of the bap gene in Staphylococcus aureus isolates recovered from human and animals species. Vet. Microbiol. 2008, 127, 407–411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seo, Y.S.; Lee, D.Y.; Rayamahji, N.; Kang, M.L.; Yoo, H.S. Biofilm-forming associated genotypic and phenotypic characteristics of Staphylococcus spp. isolated from animals and air. Res. Vet. Sci. 2008, 85, 433–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimizu, A.; Ozaki, J.; Kawano, J.; Saitoh, Y.; Kimura, S. Distribution of Staphylococcus species on animal skin. J. Vet. Med. Sci. 1992, 54, 355–357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boamah, V.E.; Agyare, C.; Odoi, H.; Adu, F.; Gbedema, S.Y.; Dalsgaard, A. Prevalence and antibiotic resistance of coagulase-negative Staphylococci isolated from poultry farms in three regions of Ghana. Infect. Drug Resist. 2017, 10, 175–183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simjee, S.; McDermott, P.F.; White, D.G.; Hofacre, C.; Berghaus, R.D.; Carter, P.J.; Stewart, L.; Liu, T.; Maier, M.; Maurer, J.J. Antimicrobial susceptibility and distribution of antimicrobial-resistance genes among enterococcus and coagulase-negative Staphylococcus isolates recovered from poultry litter. Avian Dis. 2007, 51, 884–892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Nagar, S.; El-Azeem, M.W.A.; Nasef, S.A.; Sultan, S. Prevalence of toxigenic and methicillin resistant staphylococci in poultry chain production. J. Adv. Vet. Res. 2017, 7, 33–38. [Google Scholar]
- Van Meervenne, E.; Weirdt, R.; Coillie, E.; Devlieghere, F.; Herman, L.; Boon, N. Biofilm models for the food industry: Hot spots for plasmid transfer? Pathog. Dis. 2014, 70, 332–338. [Google Scholar] [CrossRef] [Scilit]
- Christner, M.; Franke, G.C.; Schommer, N.N.; Wendt, U.; Wegert, K.; Pehle, P.; Kroll, G.; Schulze, C.; Buck, F.; Mack, D.; et al. The giant extracellular matrix-binding protein of Staphylococcus epidermidis mediates biofilm accumulation and attachment to fibronectin. Mol. Microbiol. 2010, 75, 187–207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, Z.; Yang, X.; Yang, L.; Jiang, J.; Ou, Y.; Molin, S.; Qu, D. Formation and properties of in vitro biofilms of ica-negative Staphylococcus epidermidis clinical isolates. J. Med. Microbiol. 2007, 56, 83–93. [Google Scholar] [CrossRef] [Scilit]
- Tremblay, Y.D.N.; Lamarche, D.; Chever, P.; Haine, D.; Messier, S.; Jacques, M. Characterizationof the ability of coagulase-negative staphylococci isolatedfrom the milk of Canadian farms to form biofilms. J. Dairy. Sci. 2013, 96, 234–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simojoki, H.; Hyvonen, P.; Plumed Ferrer, C.; Taponen, S.; Pyörälä, S. Is the biofilm formation and slime producing ability of coagulase-negative staphylococci associated with the persistence and severity of intrammamary infection? Vet. Microbiol. 2012, 158, 344–352. [Google Scholar] [CrossRef] [Scilit]
- Fredheim, E.G.A.; Klingenberg, C.; Rodhe, H.; Frankenberger, S.; Gaustad, P.; Flaegstad, T.; Sollid, J.E. Biofilm formation by Staphylococcus haemolyticus. J. Clin. Microbiol. 2009, 47, 1172–1180. [Google Scholar] [CrossRef] [Scilit]
- Srednik, M.E.; Trembla, Y.D.N.; Labrie, J.; Archambault, M.; Jacques, M.; Fernandez Cirelli, A.; Gentilini, E.R. Biofilm formation and antimicrobial resistance genes of coagulase-negative staphylococci isolated from cows with mastitis in Argentina. FEMS Microbiol. Lett. 2017, 364, fnx001. [Google Scholar] [CrossRef] [Scilit]
- Lianhua, Y.; Yunchao, H.; Guangqiang, Z.; Kun, Y.; Xing, L.; Fengli, G. The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces. Surg. Infect. 2014, 15, 768–773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stewart, E.J.; Ganesan, M.; Younger, J.G.; Solomon, M.J. Artificial biofilms establish the role of matrix interactions in staphylococcal biofilm assembly and disassembly. Sci. Rep. 2015, 5, 13081. [Google Scholar] [CrossRef] [Scilit]
| Gene * | Oligonucleotide Sequence (5′-3′) ** | Amplicon Size (bp) | PCR Conditions | References |
|---|---|---|---|---|
| icaAB | TTATCAATGCCGCAGTTGTC GTTTAACGCGAGTGCGCTAT | 546 | 94 °C, 5 min; 30 cycles of 94 °C for 30 s, 55 °C, 1 min, 72 °C, 1 min, final extension 72 °C, 5 min. | [34] |
| atlE | CAACTGCTCAACCGAGAACA TTTGTAGATGTTGTGCCCCA | 682 | 94 °C, 2 min; 30 cycles of 94 °C for 1 min, 55 °C, 1 min, 72 °C, 2 min, final extension 72 °C, 5 min. | [35] |
| fbe | TAAACACCGACGATAATAACCAAA GGTCTAGCCTTATTTTCATATTCA | 495 | 94 °C, 3 min; 30 cycles of: 94 °C, 1 min; 62 °C, 1 min; 72 °C, 1 min; final extension 72 °C, 5 min | [36] |
| bap | CCCTATATCGAAGGTGTAGAATTG GCTGTTGAAGTTAATACTGTACCTGC | 971 | 94 °C, 2 min; 40 cycles of 94 °C, 30 s, 55 °C, 30 s, 72 °C, 75 s; final extension 72 °C, 5 min. | [37] |
| eno | ACGTGCAGCAGCTGACT CAACAGCATYCTTCAGTACCTTC | 302 | 94 °C, 5 min; 35 cycles of 94 °C, 1 min, 56 °C, 1 min, 72 °C, 1 min, final extension 72 °C, 10 min. | [38] |
| CoNS Source n (%) | S. epidermidis 17 (19.6) | S. hominis 4 (4.6) | S. saprophyticus 19 (21.8) A | S. xylosus 19 (21.8) A | S. haemolyticus 4 (4.6) *BC | S. sciuri 10 (11.5) | S. simulans 5 (5.8) *BC | S. chromogenes 9 (10.3) | Total Strains (%) 87 (100) |
|---|---|---|---|---|---|---|---|---|---|
| heart | 5 | - | 5 | 2 | 3 | 1 | 4 | 2 | 22 (25.3) |
| liver | 2 | - | - | 5 | - | 3 | - | 3 | 13 (14.9) |
| spleen | 4 | 1 | 4 | - | 1 | 3 | 1 | 4 | 18 (20.7) |
| tarsal joints | 6 | 3 | 8 | 9 | - | 1 | - | - | 27 (31.0) |
| bone marrow | - | - | 2 | 3 | - | 2 | - | - | 7 (8.1) |
| Item | S. epidermidis | S. hominis | S. saprophyticus | S. xylosus | S. haemolyticus | S. sciuri | S. simulans | S. chromogenes | Total Strains (%) |
|---|---|---|---|---|---|---|---|---|---|
| n (%) | 17 (19.6) | 4 (4.6) | 19 (21.8) | 19 (21.8) | 4 (4.6) | 10 (11.5) | 5 (5.8) | 9 (10.3) | 87 (100) |
| Biofilm | |||||||||
| Nonadherent | 9 | 3 | 3 | 3 | 18 (20.7) | ||||
| Weak | 5 | 7 | 1 | 1 | 4 | 2 | 4 | 24 (27.6) | |
| Moderate | 2 | 1 | 3 | 6 | 3 | 5 | 2 | 22 (25.3) | |
| Strong | 1 | 3 | 6 | 9 | 1 | 3 | 23 (26.4) | ||
| Biofilm genes | |||||||||
| icaAB | 1 | 4 | 1 | 6 (6.9) | |||||
| bap | 1 | 3 | 1 | 5 (5.7) | |||||
| fbe | 5 | 1 | 1 | 7 (8.0) | |||||
| atlE | 5 | 5 | 1 | 6 | 17 (19.5) | ||||
| eno | 11 | 4 | 18 | 16 | 3 | 5 | 3 | 1 | 61 (70.1) |
| Biofilm-Associated Gene Combinations | Number of Isolates (%) |
|---|---|
| eno | 40 (46) * |
| atlE | 8 (9.2) |
| fbe | 2 (2.3) |
| bap | 1 (1.2) |
| icaAB-eno | 6 (6.9) |
| atlE-eno | 6 (6.9) |
| fbe-eno | 3 (3.4) |
| bap-eno | 3 (3.4) |
| atlE-eno-bap | 1(1.2) |
| atlE-fbe-eno | 2 (2.3) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marek, A.; Pyzik, E.; Stępień-Pyśniak, D.; Dec, M.; Jarosz, Ł.S.; Nowaczek, A.; Sulikowska, M. Biofilm-Formation Ability and the Presence of Adhesion Genes in Coagulase-Negative Staphylococci Isolates from Chicken Broilers. Animals 2021, 11, 728. https://doi.org/10.3390/ani11030728
Marek A, Pyzik E, Stępień-Pyśniak D, Dec M, Jarosz ŁS, Nowaczek A, Sulikowska M. Biofilm-Formation Ability and the Presence of Adhesion Genes in Coagulase-Negative Staphylococci Isolates from Chicken Broilers. Animals. 2021; 11(3):728. https://doi.org/10.3390/ani11030728
Chicago/Turabian StyleMarek, Agnieszka, Ewelina Pyzik, Dagmara Stępień-Pyśniak, Marta Dec, Łukasz S. Jarosz, Anna Nowaczek, and Magdalena Sulikowska. 2021. "Biofilm-Formation Ability and the Presence of Adhesion Genes in Coagulase-Negative Staphylococci Isolates from Chicken Broilers" Animals 11, no. 3: 728. https://doi.org/10.3390/ani11030728
APA StyleMarek, A., Pyzik, E., Stępień-Pyśniak, D., Dec, M., Jarosz, Ł. S., Nowaczek, A., & Sulikowska, M. (2021). Biofilm-Formation Ability and the Presence of Adhesion Genes in Coagulase-Negative Staphylococci Isolates from Chicken Broilers. Animals, 11(3), 728. https://doi.org/10.3390/ani11030728

