Detection and Characterization of Viral Pathogens Associated with Reproductive Failure in Wild Boars in Central Italy
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Molecular Analysis
2.3. Phylogenetic Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Conflicts of Interest
References
- Gethöffer, F.; Sodeikat, G.; Pohlmeyer, K. Reproductive Parameters of Wild Boar (Sus scrofa) in Three Different Parts of Germany. Eur. J. Wildl. Res. 2007, 53, 287–297. [Google Scholar] [CrossRef]
- Pittiglio, C.; Khomenko, S.; Beltran-Alcrudo, D. Wild Boar Mapping Using Population-Density Statistics: From Polygons to High Resolution Raster Maps. PLoS ONE 2018, 13, e0193295. [Google Scholar] [CrossRef] [PubMed]
- Miller, R.; Sweeney, S.; Slootmaker, C.; Reports, D.G.-S. Cross-Species Transmission Potential between Wild Pigs, Livestock, Poultry, Wildlife, and Humans: Implications for Disease Risk Management in North America. Sci. Rep. 2017, 7, 7821. [Google Scholar] [CrossRef]
- Ruiz-Fons, F.; Segalés, J.; Gortázar, C. A Review of Viral Diseases of the European Wild Boar: Effects of Population Dynamics and Reservoir Rôle. Vet. J. 2008, 176, 158–169. [Google Scholar] [CrossRef]
- Meng, X.J.; Lindsay, D.S. Wild Boars as Sources for Infectious Diseases in Livestock and Humans. Philos. Trans. R. Soc. B: Biol. Sci. 2009, 364, 2697–2707. [Google Scholar] [CrossRef]
- Müller, T.; Hahn, E.C.; Tottewitz, F.; Kramer, M.; Klupp, B.G.; Mettenleiter, T.C.; Freuling, C. Pseudorabies Virus in Wild Swine: A Global Perspective. Arch.Virol. 2011, 156, 1691–1705. [Google Scholar] [CrossRef]
- Enquist, L.W. Infection of the Mammalian Nervous System by Pseudorabies Virus (PRV). Semin. Virol. 1994, 5, 221–231. [Google Scholar] [CrossRef]
- Ruiz-Fons, F.; Vidal, D.; Höfle, U.; Vicente, J.; Gortazar, C. Aujeszky’s Disease Virus Infection Patterns in European Wild Boar. Vet. Microbiol. 2007, 120, 241–250. [Google Scholar] [CrossRef]
- Romero, C.H.; Meade, P.N.; Shultz, J.E.; Chung, H.Y.; Gibbs, E.P.; Hahn, E.C.; Lollis, G. Venereal Transmission of Pseudorabies Viruses Indigenous to Feral Swine. J. Wildl. Dis. 2001, 37, 289–296. [Google Scholar] [CrossRef]
- Verin, R.; Varuzza, P.; Mazzei, M.; Poli, A. Serologic, Molecular, and Pathologic Survey of Pseudorabies Virus Infection in Hunted Wild Boars (Sus scrofa) in Italy. J. Wildl. Dis. 2014, 50, 559–565. [Google Scholar] [CrossRef] [PubMed]
- Wittmann, G.; Rziha, H.-J. Aujeszky’s Disease (Pseudorabies) in Pigs. In Herpesvirus Diseases of Cattle, Horses and Pigs; Knipe, D.M., Howley, P.M., Eds.; Kluwer Academic Publishers: Boston, MA, USA, 1989; pp. 230–325. [Google Scholar]
- Papageorgiou, K.V.; Burriel, A.R.; Filioussis, G.; Psychas, V.; Nauwynck, H.J.; Kritas, S.K. Aujeszky’s Disease (Pseudorabies). An Old Threat in Current Pig Industry? Part I. Pathogenetic Information and Implications. J. Hell. Vet. Med. Soc. 2011, 62, 125–131. [Google Scholar] [CrossRef][Green Version]
- Yu, X.; Zhou, Z.; Hu, D.; Zhang, Q.; Han, T.; Li, X.; Gu, X.; Yuan, L.; Zhang, S.; Wang, B.; et al. Pathogenic Pseudorabies Virus, China, 2012. Emerg. Infect. Dis. 2014, 20, 102–104. [Google Scholar] [CrossRef]
- Dors, E.C.; Mól, M.P. Aujeszky’s disease. In Emerging and Re-Emerging Infectious Diseases of Livestock; Springer International Publishing: New York, USA, 2017; pp. 251–272. ISBN 9783319474267. [Google Scholar]
- Moreno, A.; Sozzi, E.; Grilli, G.; Gibelli, L.; Lavazza, A.; Cordioli, P. Detection and Molecular Analysis of Pseudorabies Virus Strains Isolated from Dogs and a Wild Boar in Italy. Vet. Microbiol. 2015, 177, 359–365. [Google Scholar] [CrossRef] [PubMed]
- Caruso, C.; Vitale, N.; Prato, R.; Radaelli, M.C.; Zoppi, S.; Possidente, R.; Dondo, A.; Chiavacci, L.; Maria, A.; Martin, M.; et al. Pseudorabies Virus in North-West Italian Wild Boar (Sus scrofa) Populations: Prevalence and Risk Factors to Support a Territorial Risk-Based Surveillance. Vet. Ital. 2018, 54, 337–341. [Google Scholar] [CrossRef]
- José, M. Antibodies to Selected Viral and Bacterial Pathogens in European Wild Boars from Southcentral Spain. Wildl. Dis. Assoc. 2002, 38, 649–652. [Google Scholar] [CrossRef]
- Vicente, J.; Ruiz-Fons, F.; Vidal, D.; Hofle, U.; Acevedo, P.; Villanua, D.; Fernandez-De-Mera, I.G.; Martin, M.P.; Gortazar, C. Serosurvey of Aujeszky’s Disease Virus Infection in European Wild Boar in Spain. Vet. Rec. 2005, 156, 408–412. [Google Scholar] [CrossRef]
- Vengust, G.; Valencak, Z.; Bidovec, A. Presence of Antibodies Against Aujeszky’s Disease Virus in Wild Boar (Sus scrofa) in Slovenia. Wildl. Dis. Assoc. 2005, 41, 800–802. [Google Scholar] [CrossRef][Green Version]
- Denzin, N.; Conraths, F.J.; Mettenleiter, T.C.; Freuling, C.; Müller, T. Monitoring of Pseudorabies in Wild Boar of Germany—A Spatiotemporal Analysis. Pathogens 2020, 9, 276. [Google Scholar] [CrossRef]
- Pannwitz, G.; Freuling, C.; Denzin, N.; Schaarschmidt, U.; Nieper, H.; Hlinak, A.; Burkhardt, S.; Klopries, M.; Dedek, J.; Hoffmann, L.; et al. A Long-Term Serological Survey on Aujeszky’s Disease Virus Infections in Wild Boar in East Germany. Epidemiol. Infect. 2012, 140, 348–353. [Google Scholar] [CrossRef] [PubMed]
- Cano-Manuel, F.; López-Olvera, J.; Granados, J. Long-Term Monitoring of 10 Selected Pathogens in Wild Boar (Sus scrofa) in Sierra Nevada National Park, Southern Spain. Vet. Microbiol. 2014, 174, 148–154. [Google Scholar] [CrossRef]
- Lari, A.; Lorenzi, D.; Faccini, S. Pseudorabies virus in european wild boar from central Italy. Source J. Wildl. Dis. 2006, 42, 319–324. [Google Scholar] [CrossRef] [PubMed]
- Collins, P.J.; McKillen, J.; Allan, G. Porcine Circovirus Type 3 in the UK. Vet. Rec. 2017, 181, 599. [Google Scholar] [CrossRef] [PubMed]
- Klaumann, F.; Correa-Fiz, F.; Franzo, G.; Sibila, M.; Núñez, J.I.; Segalés, J. Current Knowledge on Porcine Circovirus 3 (PCV-3): A Novel Virus with a yet Unknown Impact on the Swine Industry. Front. Vet. Sci. 2018, 5, 315. [Google Scholar] [CrossRef]
- Klaumann, F.; Dias-Alves, A.; Cabezón, O.; Mentaberre, G.; Castillo-Contreras, R.; López-Béjar, M.; Casas-Díaz, E.; Sibila, M.; Correa-Fiz, F.; Segalés, J. Porcine Circovirus 3 Is Highly Prevalent in Serum and Tissues and May Persistently Infect Wild Boar (Sus scrofa scrofa). Transbound. Emerg. Dis. 2019, 66, 91–101. [Google Scholar] [CrossRef] [PubMed]
- Franzo, G.; Ruiz, A.; Grassi, L.; Sibila, M.; Drigo, M.; Segalés, J. Lack of Porcine Circovirus 4 Genome Detection in Pig Samples from Italy and Spain. Pathogens 2020, 9, 433. [Google Scholar] [CrossRef]
- Zhang, H.; Hu, W.; Li, J.; Liu, T.; Zhou, J.; Opriessnig, T.; Xiao, C. Novel Circovirus Species Identified in Farmed Pigs Designated as Porcine Circovirus 4, Hunan Province, China. Transbound. Emerg. Dis. 2020, 67, 1057–1061. [Google Scholar] [CrossRef] [PubMed]
- Allan, G.M.; Ellis, J.A. Porcine Circoviruses: A Review. J. Vet. Diagn. Invest. 2000, 12, 3–14. [Google Scholar] [CrossRef]
- Harding, J.C.S. The Clinical Expression and Emergence of Porcine Circovirus 2. Proc. Vet. Microbiol. 2004, 98, 131–135. [Google Scholar] [CrossRef]
- West, K.H.; Bystrom, J.M.; Wojnarowicz, C.; Shantz, N.; Jacobson, M.; Allan, G.M.; Haines, D.M.; Clark, E.G.; Krakowka, S.; McNeilly, F.; et al. Myocarditis and Abortion Associated with Intrauterine Infection of Sows with Porcine Circovirus. J. Vet. Diagn. Investig. 1999, 11, 530–532. [Google Scholar] [CrossRef]
- Kim, J.; Jung, K.; Chae, C. Prevalence of Porcine Circovirus Type 2 in Aborted Fetuses and Stillborn Piglets. Vet. Rec. 2004, 155, 489–492. [Google Scholar] [CrossRef]
- Brunborg, I.M.; Jonassen, C.M.; Moldal, T.; Bratberg, B.; Lium, B.; Koenen, F.; Schönheit, J. Association of Myocarditis with High Viral Load of Porcine Circovirus Type 2 in Several Tissues in Cases of Fetal Death and High Mortality in Piglets. A Case Study. J. Vet. Diagn. Investig. 2007, 19, 368–375. [Google Scholar] [CrossRef] [PubMed]
- Madson, D.M.; Patterson, A.R.; Ramamoorthy, S.; Pal, N.; Meng, X.J.; Opriessnig, T. Reproductive Failure Experimentally Induced in Sows via Artificial Insemination with Semen Spiked with Porcine Circovirus Type 2. Vet. Pathol. 2009, 46, 707–716. [Google Scholar] [CrossRef] [PubMed]
- Rose, N.; Opriessnig, T.; Grasland, B.; Jestin, A. Epidemiology and Transmission of Porcine Circovirus Type 2 (PCV2). Virus Res. 2012, 164, 78–89. [Google Scholar] [CrossRef] [PubMed]
- Pensaert, M.; Sanchez, R.E.; Ladekjær-Mikkelsen, A.S.; Allan, G.M.; Nauwynck, H.J. Viremia and Effect of Fetal Infection with Porcine Viruses with Special Reference to Porcine Circovirus 2 Infection. Vet. Microbiol. 2004, 98, 175–183. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Madson, D.M.; Opriessnig, T. Effect of Porcine Circovirus Type 2 (PCV2) Infection on Reproduction: Disease, Vertical Transmission, Diagnostics and Vaccination. Anim. Health Res. Rev. Conf. Res. Work. Anim. Dis. 2011, 12, 47–65. [Google Scholar] [CrossRef]
- Segalés, J. Porcine Circovirus Type 2 (PCV2) Infections: Clinical Signs, Pathology and Laboratory Diagnosis. Virus Res. 2012, 164, 10–19. [Google Scholar] [CrossRef]
- Toplak, I.; Grom, J.; Hostnik, P.; Barlič-Maganja, D. Phylogenetic Analysis of Type 2 Porcine Circoviruses Indentified in Wild Boar in Slovenia. Vet. Rec. 2004, 155, 178–180. [Google Scholar] [CrossRef]
- Vicente, J.; Segalés, J.; Höfle, U.; Balasch, M.; Plana-Durán, J.; Domingo, M.; Gortázar, C. Epidemiological Study on Porcine Circovirus Type 2 (PCV2) Infection in the European Wild Boar (Sus scrofa). Vet. Res. 2004, 35, 243–253. [Google Scholar] [CrossRef]
- Knell, S.; Willems, H.; Hertrampf, B.; Reiner, G. Comparative Genetic Characterization of Porcine Circovirus Type 2 Samples from German Wild Boar Populations. Vet. Microbiol. 2004, 98, 175–183. [Google Scholar] [CrossRef]
- Corrêa, A.M.R.; Zlotowski, P.; Rozza, D.B.; Borba, M.R.; Leal, J.D.S.; da Cruz, C.E.F.; Driemeier, D. Postweaning Multisystemic Wasting Syndrome in Farmed Wild Boars (Sus scrofa) in Rio Grande Do Sul. Pesqui. Vet. Bras. 2006, 26, 154–156. [Google Scholar] [CrossRef]
- Cságola, A.; Kecskeméti, S.; Kardos, G.; Kiss, I.; Tuboly, T. Genetic Characterization of Type 2 Porcine Circoviruses Detected in Hungarian Wild Boars. Arch. Virol. 2006, 151, 495–507. [Google Scholar] [CrossRef] [PubMed]
- Lipej, Z.; Segalés, J.; Jemeršić, L.; Olvera, A.; Roić, B.; Novosel, D.; Mihaljević, Ž.; Manojlović, L. First Description of Postweaning Multisystemic Wasting Syndrome (PMWS) in Wild Boar (Sus scrofa) in Croatia and Phylogenetic Analysis of Partial PCV2 Sequences. Acta Vet. Hung. 2007, 55, 389–404. [Google Scholar] [CrossRef] [PubMed]
- Sofia, M.; Billinis, C.; Psychas, V.; Birtsas, P.; Sofianidis, G.; Leontides, L.; Knowles, N.; Spyrou, V. Detection and genetic characterization of porcine circovirus 2 isolates from the first cases of postweaning multisystemic and wasting syndrome in wild boars in greece. Source J. Wildl. Dis. 2008, 44, 864–870. [Google Scholar] [CrossRef]
- Morandi, F.; Verin, R.; Sarli, G.; Canetti, N.; Scacco, M.; Panarese, S.; Poli, A. Porcine Circovirus Type 2 (PCV2) Antigen Localisation and Post-Weaning Multisystemic Wasting Syndrome (PMWS) in Free-Ranging Wild Boar (Sus scrofa Ssp scrofa) in Italy. Eur. J. Wildl. Res. 2010, 56, 717–724. [Google Scholar] [CrossRef]
- Sedlak, K.; Bartova, E.; Machova, J. Antibodies to Selected Viral Disease Agents in Wild Boars from the Czech Republic. Wildl. Dis. Assoc. 2008, 44, 777–780. [Google Scholar] [CrossRef] [PubMed]
- Closa-Sebastià, F.; Casas-Díaz, E.; Cuenca, R.; Lavín, S.; Mentaberre, G.; Marco, I. Antibodies to Selected Pathogens in Wild Boar (Sus scrofa) from Catalonia (NE Spain). Eur. J. Wildl. Res. 2011, 57, 977–981. [Google Scholar] [CrossRef]
- Reiner, G.; Bronnert, B.; Hohloch, C.; Fresen, C.; Haack, I.; Willems, H.; Reinacher, M. Qualitative and Quantitative Distribution of PCV2 in Wild Boars and Domestic Pigs in Germany. Vet. Microbiol. 2010, 145, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Delogu, M.; Ostanello, F.; Martin, A.M.; Lelli, D.; Frasnelli, M.; Marzadori, F.; Raffini, E.; De Marco, M.A. Infezione da PCV2 nel cinghiale: Dinamica anticorpale in una popolazione monitorata in un’area protetta (2002–2006). In Proceedings of the IV Workshop Nazionale di Epidemiologia Veterinaria, Rome, Italy, 11–12 December 2008; p. 91. (In Italian). [Google Scholar]
- Mengeling, W.L.; Lager, K.M.; Vorwald, A.C. The Effect of Porcine Parvovirus and Porcine Reproductive and Respiratory Syndrome Virus on Porcine Reproductive Performance. Anim. Reprod. Sci. 2000, 60–61, 199–210. [Google Scholar] [CrossRef]
- Miłek, D.; Woźniak, A.; Stadejek, T. The Detection and Genetic Diversity of Novel Porcine Parvovirus 7 (PPV7) on Polish Pig Farms. Res. Vet. Sci. 2018, 120, 28–32. [Google Scholar] [CrossRef] [PubMed]
- Miłek, D.; Woźniak, A.; Guzowska, M.; Stadejek, T. Detection Patterns of Porcine Parvovirus (PPV) and Novel Porcine Parvoviruses 2 through 6 (PPV2–PPV6) in Polish Swine Farms. Viruses 2019, 11, 474. [Google Scholar] [CrossRef]
- Cutlip, R.C.; Mengeling, W.L. Pathogenesis of in Utero Infection: Experimental Infection of Eight- and Ten-Week-Old Porcine Fetuses with Porcine Parvovirus. Am. J. Vet. Res. 1975, 36, 1751–1754. [Google Scholar] [PubMed]
- Mengeling, W.L.; Lager, K.M.; Zimmerman, J.K.; Samarikermani, N.; Beran, G.W. A Current Assessment of the Role of Porcine Parvovirus as a Cause of Fetal Porcine Death. J. Vet. Diagn. Investig. 1991, 3, 33–35. [Google Scholar] [CrossRef] [PubMed]
- Soares, R.M.; Durigon, E.L.; Bersano, J.G.; Richtzenhain, L.J. Detection of Porcine Parvovirus DNA by the Polymerase Chain Reaction Assay Using Primers to the Highly Conserved Nonstructural Protein Gene, NS-1. J. Virol. Methods 1999, 78, 191–198. [Google Scholar] [CrossRef]
- Pérez, L.J.; Díaz de Arce, H.; Percedo, M.I.; Domínguez, P.; Frías, M.T. First report of porcine circovirus type 2 infections in Cuba. Res. Vet. Sci. 2010, 88, 528–530. [Google Scholar] [CrossRef] [PubMed]
- Joo, H.; Donaldson-Wood, C.R.; Johnson, R. Observations on the Pathogenesis of Porcine Parvovirus Infection. Arch. Virol. 1976, 51, 123–129. [Google Scholar] [CrossRef]
- Mengeling, W.L.; Paul, P.S.; Brow, T.T. Transplacental Infection and Embryonic Death Followinq Maternal Exposure to Porcine Parvovirus Near the Time of Conception. Arch. Virol. 1980, 65, 55–62. [Google Scholar] [CrossRef] [PubMed]
- Kresse, J.I.; Taylor, W.D.; Stewart, W.W.; Eernisse, K.E.-V. Parvovirus Infection in Pigs with Necrotic and Vesicle-like Lesions. Vet. Microbiol. 1985, 10, 525–531. [Google Scholar] [CrossRef]
- Zeeuw, E.J.L.; Leinecker, N.; Herwig, V.; Selbitz, H.J.; Truyen, U. Study of the Virulence and Cross-Neutralization Capability of Recent Porcine Parvovirus Field Isolates and Vaccine Viruses in Experimentally Infected Pregnant Gilts. J. Gen. Virol. 2007, 88, 420–427. [Google Scholar] [CrossRef]
- Mészáros, I.; Olasz, F.; Cságola, A.; Tijssen, P.; Zádori, Z. Biology of Porcine Parvovirus (Ungulate Parvovirus 1). Viruses 2017, 9, 393. [Google Scholar] [CrossRef]
- Roic, B.; Jemersic, L.; Terzic, S.; Keros, T.; Balatinec, J.; Florijancic, T. Prevalence of Antibodies to Selected Viral Pathogens in Wild Boars (Sus scrofa) in Croatia in 2005–06 and 2009–10. J. Wildl. Dis. 2012, 48, 131–137. [Google Scholar] [CrossRef][Green Version]
- Ruiz-Fons, F.; Vicente, J.; Vidal, D.; Höfle, U.; Villanúa, D.; Gauss, C.; Segalés, J.; Almería, S.; Montoro, V.; Gortázar, C. Seroprevalence of Six Reproductive Pathogens in European Wild Boar (Sus scrofa) from Spain: The Effect on Wild Boar Female Reproductive Performance. Theriogenology 2006, 65, 731–743. [Google Scholar] [CrossRef]
- Vengust, G.; Valencak, Z.; Bidovec, A. A Serological Survey of Selected Pathogens in Wild Boar in Slovenia. J. Vet. Med. Ser. B: Infect. Dis. Vet. Public Health 2006, 53, 24–27. [Google Scholar] [CrossRef] [PubMed]
- Lelešius, R.; Sereika, V.; Zienius, D.; Michalskienė, I. Serosurvey of wild boar population for porcine parvovirus and other selected infectious diseases in Lithuania. Bull. Vet. Inst. Pulawy. 2006, 50, 143–147. [Google Scholar]
- Kaden, V.; Lange, E.; Hänel, A.; Hlinak, A.; Mewes, L.; Hergarten, G.; Irsch, B.; Dedek, J.; Bruer, W. Retrospective Serological Survey on Selected Viral Pathogens in Wild Boar Populations in Germany. Eur. J. Wildl. Res. 2009, 55, 153–159. [Google Scholar] [CrossRef] [PubMed]
- Malmsten, A.; Magnusson, U.; Ruiz-Fons, F.; González-Barrio, D.; Dalin, A.M. A Serologic Survey of Pathogens in Wild Boar (Sus scrofa) in Sweden. J. Wildl. Dis. 2018, 54, 229–237. [Google Scholar] [CrossRef] [PubMed]
- Cordioli, P.; Callegari, S.; Berlinzani, A.; Foni, E.; Candotti, P.; Barigazzi, G. Indagine sierologica su cinghiali selvatici dell’Appennino parmense (Serological survey in wild boars from “Appennino parmense” area). Atti. Soc. Ital. Sci. Vet. 1993, 47, 1159–1162. (In Italian) [Google Scholar]
- Ercolini, C.; Ferrari, A.; Fisichella, S.; Guerci, L.P.; Mandola, M.L.; Masoero, L.; Mignone, W.; Perruchon, M.; Poggi, M. Serological Survey of Wild Boar (Sus scrofa) in Liguria, Italy. J. Mt. Ecol. 2014, 3, 83–84. [Google Scholar]
- Fenati, M.; Armaroli, E.; Corrain, R.; Guberti, V. Indirect Estimation of Porcine Parvovirus Maternal Immunity Decay in Free-Living Wild Boar (Sus scrofa) Piglets by Capture-Recapture Data. Vet. J. 2009, 180, 262–264. [Google Scholar] [CrossRef] [PubMed]
- Yoon, H.A.; Eo, S.K.; Aleyas, A.G.; Park, S.O.; Lee, J.H.; Chae, J.S.; Cho, J.G.; Song, H.J. Molecular Survey of Latent Pseudorabies Virus Infection in Nervous Tissues of Slaughtered Pigs by Nested and Real-Time PCR. Artic. J. Microbiol. 2005, 43, 430–436. [Google Scholar]
- Giammarioli, M.; Pellegrini, C.; Casciari, C.; de Mia, G.M. Development of a Novel Hot-Start Multiplex PCR for Simultaneous Detection of Classical Swine Fever Virus, African Swine Fever Virus, Porcine Circovirus Type 2, Porcine Reproductive and Respiratory Syndrome Virus and Porcine Parvovirus. Vet. Res. Commun. 2008, 32, 255–262. [Google Scholar] [CrossRef] [PubMed]
- Cadar, D.; Dán, Á.; Tombácz, K.; Lorincz, M.; Kiss, T.; Becskei, Z.; Spînu, M.; Tuboly, T.; Cságola, A. Phylogeny and evolutionary genetics of porcine parvovirus in wild boars. Infect. Genet. Evol. 2012, 12, 1163–1171. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.; Hung, J.J.; Wu, C.Y.; Chien, M.S. Multiplex PCR for rapid detection of pseudorabies virus, porcine parvovirus and porcine circoviruses. Vet. Microbiol. 2004, 101, 209–214. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
- Henry, V.G. Fetal Development in European Wild Hogs. J. Wildl. Manag. 1968, 32, 966. [Google Scholar] [CrossRef]
- Dei Giudici, S.; lo Presti, A.; Bonelli, P.; Angioi, P.P.; Sanna, G.; Zinellu, S.; Balzano, F.; Salis, F.; Ciccozzi, M.; Oggiano, A. Phylogenetic Analysis of Porcine Circovirus Type 2 in Sardinia, Italy, Shows Genotype 2d Circulation among Domestic Pigs and Wild Boars. Infect. Genet. Evol. 2019, 71, 189–196. [Google Scholar] [CrossRef] [PubMed]
- Pacini, M.I.; Forzan, M.; Cilia, G.; Bernardini, L.; Marzoli, F.; Pedonese, F.; Bandecchi, P.; Fratini, F.; Mazzei, M. Detection of Pseudorabies Virus in Wild Boar Foetus. Animals 2020, 10, 366. [Google Scholar] [CrossRef]
- Sozzi, E.; Moreno, A.; Lelli, D.; Cinotti, S.; Alborali, G.L.; Nigrelli, A.; Luppi, A.; Bresaola, M.; Catella, A.; Cordioli, P. Genomic Characterization of Pseudorabies Virus Strains Isolated in Italy. Transbound. Emerg. Dis. 2014, 61, 334–340. [Google Scholar] [CrossRef]
- Franzo, G.; Segalés, J. Porcine Circovirus 2 (PCV-2) Genotype Update and Proposal of a New Genotyping Methodology. PLoS ONE 2018, 13, e0208585. [Google Scholar] [CrossRef]
- Franzo, G.; Tinello, S.; Grassi, L.; Tucciarone, C.M.; Legnardi, M.; Cecchinato, M.; Dotto, G.; Mondin, A.; Martini, M.; Pasotto, D.; et al. Free to Circulate: An Update on the Epidemiological Dynamics of Porcine Circovirus 2 (PCV-2) in Italy Reveals the Role of Local Spreading, Wild Populations, and Foreign Countries. Pathogens 2020, 9, 221. [Google Scholar] [CrossRef]
- Franzo, G.; Cortey, M.; Segalés, J.; Hughes, J.; Drigo, M. Phylodynamic analysis of porcine circovirus type 2 reveals global waves of emerging genotypes and the circulation of recombinant forms. Mol. Phylogenetics Evol. 2016, 100, 269–280. [Google Scholar] [CrossRef] [PubMed]



| Virus | PCR Assay | Target | Primer Sequence (5′–3′) | Expected Product (bp) | References |
|---|---|---|---|---|---|
| PCV2 | Diagnostic and Phylogenetic | ORF2 | Fw: CGGATATTGTAGTCCTGGTCG Rw: ACTGTCAAGGCTACCACAGTC | 481 | Giammarioli et al., 2008 [73] |
| PPV1 | Diagnostic | VP2 | Fw: GCAGTACCAATTCATCTTCT Rw: TGGTCTCCTTCTGTGGTAGG | 158 | Giammarioli et al., 2008 [73] |
| Phylogenetic | VP1 | Fw: ACCAACCTGCACTTAACTCC Rw: GTGTGTGTGCATCGTCTTGT | 970 | Cadar et al., 2012 [74] | |
| Phylogenetic | VP1/VP2 | Fw: GAGGTAAGAAGATCG CCGAG Rw: TCCTACCTGAGCTGGCCTAA | 1136 | ||
| Phylogenetic | VP2 | Fw: CT ACCACAGAAGGAGACCAA Rw: ATTGAAGTATACAATGATAGTAGT | 928 | ||
| SuHV-1 | Diagnostic Nested | gB | Fw1: ATGGCCATCTCGCGGTGC Rw1: ACTCGCGGTCCTCCAGCA | 334 | Yoon et al., 2005 [72] |
| Fw2: ACGGCACGGGCGTGATC Rw2: GGTTCAGGGTACCCCGC | 195 | ||||
| Phylogenetic | gE | Fw: CCGCGGGCCGTGTTCTTTGT Rw: CGTGGCCGTTGTGGGTCAT | 500 | Huang et al., 2004 [75] |
| Sample Year Municipality | Sample Type | PCV2 | PPV1 | SuHV-1 |
|---|---|---|---|---|
| WB.1091 2019 Grosseto | Pregnant sow | − | + | + |
| Pooled foetuses (3) | − | − | + | |
| WB.111 2019 Grosseto | Pregnant sow | − | + | − |
| Pooled foetuses (4) | − | − | − | |
| WB.211 2019 Lucca | Pregnant sow | + | − | − |
| Pooled foetuses (1) | + | − | − |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pacini, M.I.; Forzan, M.; Cilia, G.; Bertelloni, F.; Fratini, F.; Mazzei, M. Detection and Characterization of Viral Pathogens Associated with Reproductive Failure in Wild Boars in Central Italy. Animals 2021, 11, 304. https://doi.org/10.3390/ani11020304
Pacini MI, Forzan M, Cilia G, Bertelloni F, Fratini F, Mazzei M. Detection and Characterization of Viral Pathogens Associated with Reproductive Failure in Wild Boars in Central Italy. Animals. 2021; 11(2):304. https://doi.org/10.3390/ani11020304
Chicago/Turabian StylePacini, Maria Irene, Mario Forzan, Giovanni Cilia, Fabrizio Bertelloni, Filippo Fratini, and Maurizio Mazzei. 2021. "Detection and Characterization of Viral Pathogens Associated with Reproductive Failure in Wild Boars in Central Italy" Animals 11, no. 2: 304. https://doi.org/10.3390/ani11020304
APA StylePacini, M. I., Forzan, M., Cilia, G., Bertelloni, F., Fratini, F., & Mazzei, M. (2021). Detection and Characterization of Viral Pathogens Associated with Reproductive Failure in Wild Boars in Central Italy. Animals, 11(2), 304. https://doi.org/10.3390/ani11020304

