Evaluation of an Innovative and Sustainable Pre-Commercial Compound as Replacement of Fish Meal in Diets for Rainbow Trout during Pre-Fattening Phase: Effects on Growth Performances, Haematological Parameters and Fillet Quality Traits
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Diets, Sustainability and Economic Assessment
- FMU (g/kg of fish gain) = fish meal share in the diet (g/kg) × (feed intake (g)/body weight gain (g))
- FOU (g/kg of fish gain) = fish oil share in the diet (g/kg) × (feed intake (g)/body weight gain (g))
- The economic conversion ratio (ECR) and economic profit index (EPI) were computed by [18] to measure the economic relative efficiency and advantages of the tested diet cost of feed per unit of fish gain.
- ECR ($/kg of fish gain) = (feed intake (g)/body weight gain (g)) × cost of feed ($/kg)
- EPI ($/fish−1) = [weight gain (kg) × selling price (4 $ kg−1)] − [weight gain (kg) × diet price ($ kg−1)]
- Rainbow trout sale price calculated at 4 $ kg−1.
2.2. Fish and Feeding Trial
2.3. Chemical Analyses of Feed and Fillets
2.4. Blood Sampling and Analyses
2.5. Gene Expression Analysis
2.6. Calculations
2.7. Statistical Analyses
3. Results
3.1. Growth Performance
3.2. Fillet Proximate Composition and Amino Acid Profile
3.3. Hematological and Serum Biochemical Parameters
3.4. Gene Expression
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Parisi, G.; Tulli, F.; Fortina, R.; Marino, R.; Bani, P.; Zotte, A.D.; De Angelis, A.; Piccolo, G.; Pinotti, L.; Schiavone, A.; et al. Protein hunger of the feed sector: The alternatives offered by the plant world. Ital. J. Anim. Sci. 2020, 19, 1204–1225. [Google Scholar] [CrossRef]
- EUMOFA. Fishmeal and Fish Oil, Maritime Affairs and Fisheries, Production and Trade Flows in the EU; EUMOFA: Brussels, Belgium, 2021. [Google Scholar]
- Staessen, T.W.O.; Verdegem, M.; Koletsi, P.; Schrama, J.W. The effect of dietary protein source (fishmeal vs. plant protein) and non-starch polysaccharide level on fat digestibility and faecal bile acid loss in rainbow trout (Oncorhynchus mykiss). Aquac. Res. 2019, 51, 1170–1181. [Google Scholar] [CrossRef] [Green Version]
- Sahin, T.; Yılmaz, S.; Gürkan, M.; Ergün, S. Effects of Rapana venosa meal-supplemented diets on reproduction, histopathology and some blood parameters of rainbow trout (Oncorhynchus mykiss) broodstock. Aquac. Res. 2021, 52, 4897–4910. [Google Scholar] [CrossRef]
- Fréon, P.; Sueiro, J.C.; Iriarte, F.; Evar, O.F.M.; Landa, Y.; Mittaine, J.-F.; Bouchon, M. Harvesting for food versus feed: A review of Peruvian fisheries in a global context. Rev. Fish. Biol. Fish. 2013, 24, 381–398. [Google Scholar] [CrossRef]
- Francis, G.; Makkar, H.P.S.; Becker, K. Antinutritional factors present in plant-derived alternate fish feed ingredients and their effects in fish. Aquaculture 2001, 199, 197–227. [Google Scholar] [CrossRef]
- Papatryphon, E.; Soares, J.H. The effect of dietary feeding stimulants on growth performance of striped bass, Morone saxatilis, fed-a-plant feedstuff-based diet. Aquaculture 2000, 185, 329–338. [Google Scholar] [CrossRef]
- Schader, C.; Muller, A.; El-Hage Scialabba, N.; Hecht, J.; Isensee, A.; Erb, K.H.; Smith, P.; Makkar, H.P.S.; Klocke, P.; Leiber, F.; et al. Impacts of feding less food-competing feedstuffs to livestock on global food system sustainability. J. R. Soc. Interface 2015, 12, 113. [Google Scholar] [CrossRef] [Green Version]
- van Huis, A. Potential of Insects as Food and Feed in Assuring Food Security. Annu. Rev. Èntomol. 2013, 58, 563–583. [Google Scholar] [CrossRef]
- Henry, M.; Gasco, L.; Piccolo, G.; Fountoulaki, E. Review on the use of insects in the diet of farmed fish: Past and future. Anim. Feed. Sci. Technol. 2015, 203, 1–22. [Google Scholar] [CrossRef]
- Gasco, L.; Finke, M.; Van Huis, A. Can diets containing insects promote animal health? J. Insects Food Feed. 2018, 4, 1–4. [Google Scholar] [CrossRef]
- Terova, G.; Rimoldi, S.; Ascione, C.; Gini, E.; Ceccotti, C.; Gasco, L. Rainbow trout (Oncorhynchus mykiss) gut microbiota is modulated by insect meal from Hermetia illucens pre-pupae in the diet. Rev. Fish. Biol. Fish. 2019, 29, 465–486. [Google Scholar] [CrossRef]
- Oonincx, D.G.A.B.; van Itterbeeck, J.; Heetkamp, M.J.W.; Brand, H.V.D.; van Loon, J.J.A.; van Huis, A. An Exploration on Greenhouse Gas and Ammonia Production by Insect Species Suitable for Animal or Human Consumption. PLoS ONE 2010, 5, e14445. [Google Scholar] [CrossRef] [Green Version]
- Oonincx, D.G.; De Boer, I.J. Environmental impact of the production of mealworms as a protein source for humans—A life cycle assessment. PLoS ONE 2012, 7, e51145. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Acar, U.; Kesbic, O.S.; Yilmaz, S.; Kesbic, F.I.; Gultepe, N. Gibel carp (Carassius auratus gibelio) meal as an alternative major protein in feeds for rainbow trout juveniles (Oncorhynchus mykiss). Turk. J. Fish. Aquat. Sci. 2018, 19, 383–390. [Google Scholar]
- Acar, Ü.; Kesbiç, O.S.; Yilmaz, S.; Karabayir, A. Growth performance, haematological and serum biochemical profiles in rainbow trout (Oncorhynchus mykiss) fed diets with varying levels of lupin (Lupinus albus) meal. Aquac. Res. 2018, 49, 2579–2586. [Google Scholar] [CrossRef]
- Sunde, J.; Eiane, S.; Rustad, A.; Jensen, H.; Opstvedt, J.; Nygard, E.; Venturini, G.; Rungruangsak-Torrissen, K. Effect of fish feed processing conditions on digestive protease activities, free amino acid pools, feed conversion efficiency and growth in Atlantic salmon (Salmo salar L.). Aquac. Nutr. 2004, 10, 261–277. [Google Scholar] [CrossRef]
- Stejskal, V.; Tran, H.Q.; Prokesova, M.; Gebauer, T.; Giang, P.T.; Gai, F.; Gasco, L. Partially Defatted Hermetia illucens Larva Meal in Diet of Eurasian Perch (Perca fluviatilis) Juveniles. Animals 2020, 10, 1876. [Google Scholar] [CrossRef]
- Association of Official Analytical Chemists (AOAC). Official Methods of Analysis; AOAC: Rockville, MD, USA, 1988. [Google Scholar]
- Rodrigues, A.P.O.; Bicudo, Á.J.A.; Moro, G.V.; Gominho-Rosa, M.D.C.; Gubiani, É.A. Muscle amino acid profile of wild and farmed pirarucu (Arapaima gigas) in two size classes and an estimation of their dietary essential amino acid requirements. J. Appl. Aquac. 2021, in press. [Google Scholar] [CrossRef]
- Sun, Z.; Xing, J.; Khoo, P.Y.; Zhan, Z.A. Combined MRM and SIM Method for Direct Quantitative Determination of Amino Acids in Various Samples on LC/MS/MS. In Proceedings of the American Society for Mass Spectrometry Congress, Sante Fe, NM, USA, 5–9 June 2016. [Google Scholar]
- Roy, C.; Tremblay, P.Y.; Bienvenu, J.F.; Ayotte, P. Quantitative analysis of amino acids and acylcarnitines combined with untargeted metabolomics using ultra-highperformance liquid chromatography and quadrupole time-of-flight mass spectrometry. J. Chromatogr. B 2016, 1027, 40–49. [Google Scholar] [CrossRef]
- Iversen, M.; Finstad, B.; McKinley, M.S.; Eliassen, R.A. The efficacy of metomidate, clove oil, Aqui-STM and Benzoak® as anaesthetics in Atlantic salmon (Salmo salar L.) smolts, and their potential stress-reducing capacity. Aquaculture 2003, 221, 549–566. [Google Scholar] [CrossRef]
- Blaxhall, P.C.; Daisley, K.W. Routine hematological methods for use with fish blood. J. Fish. Biol. 1973, 5, 771–781. [Google Scholar] [CrossRef]
- Kalendar, R.; Lee, D.; Schulman, A.H. FastPCR Software for PCR Primer and Probe Design and Repeat Search. Genes Genomes Genom. 2009, 3, 1–14. [Google Scholar]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acid Res. 2001, 1, 9. [Google Scholar] [CrossRef] [PubMed]
- Hebicha, H.A.; El Naggar, G.O.; Nasr-Allah, A.M. Production Economics of Nile Tilapia (Oreochromis niloticus) Pond Culture in El-Fayum Governorate, Egypt. J. Appl. Aquac. 2013, 25, 227–238. [Google Scholar] [CrossRef]
- Abdel-Tawwab, M.; Khalil, R.H.; Metwally, A.A.; Shakweer, M.S.; Khallaf, M.A.; Abdel-Latif, H.M. Effects of black soldier fly (Hermetia illucens L.) larvae meal on growth performance, organs-somatic indices, body composition, and hemato-biochemical variables of European sea bass, Dicentrarchus labrax. Aquaculture 2020, 522, 735136. [Google Scholar] [CrossRef]
- Rawski, M.; Mazurkiewicz, J.; Kierończyk, B.; Józefiak, D. Black Soldier Fly Full-Fat Larvae Meal Is More Profitable Than Fish Meal and Fish Oil in Siberian Sturgeon Farming: The Effects on Aquaculture Sustainability, Economy and Fish GIT Development. Animals 2021, 11, 604. [Google Scholar] [CrossRef]
- Bondari, K.; Sheppard, D.C. Soldier fly, Hermetia illucens L., larvae as feed for channel catfish, Ictalurus punctatus (Rafinesque), and blue tilapia, Oreochromis aureus (Steindachner). Aquac. Res. 1987, 18, 209–220. [Google Scholar] [CrossRef]
- Li, S.; Ji, H.; Zhang, B.; Zhou, J.; Yu, H. Defatted black soldier fly (Hermetia illucens) larvae meal in diets for juvenile Jian carp (Cyprinus carpio var. Jian): Growth performance, antioxidant enzyme activities, digestive enzyme activities, intestine and hepatopancreas histological structure. Aquaculture 2017, 477, 62–70. [Google Scholar] [CrossRef]
- Magalhães, R.; Sánchez-López, A.; Leal, R.S.; Martínez-Llorens, S.; Oliva-Teles, A.; Peres, H. Black soldier fly (Hermetia illucens) pre-pupae meal as a fish meal replacement in diets for European seabass (Dicentrarchus labrax). Aquaculture 2017, 476, 79–85. [Google Scholar] [CrossRef]
- St-Hilaire, S.; Sheppard, C.; Tomberlin, J.K.; Irving, S.; Newton, L.; McGuire, M.A.; Mosley, E.E.; Hardy, R.W.; Sealey, W. Fly Prepupae as a Feedstuff for Rainbow Trout, Oncorhynchus mykiss. J. World Aquac. Soc. 2007, 38, 59–67. [Google Scholar] [CrossRef]
- Kroeckel, S.; Harjes, A.-G.; Roth, I.; Katz, H.; Wuertz, S.; Susenbeth, A.; Schulz, C. When a turbot catches a fly: Evaluation of a pre-pupae meal of the Black Soldier Fly (Hermetia illucens) as fish meal substitute—Growth performance and chitin degradation in juvenile turbot (Psetta maxima). Aquaculture 2012, 364–365, 345–352. [Google Scholar] [CrossRef]
- Chemello, G.; Renna, M.; Caimi, C.; Guerreiro, I.; Oliva-Teles, A.; Enes, P.; Biasato, I.; Schiavone, A.; Gai, F.; Gasco, L. Partially Defatted Tenebrio molitor Larva Meal in Diets for Grow-Out Rainbow Trout, Oncorhynchus mykiss (Walbaum): Effects on Growth Performance, Diet Digestibility and Metabolic Responses. Animals 2020, 10, 229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tschirner, M.; Simon, A. Influence of different growing substrates and processing on the nutrient composition of black soldier fly larvae destined for animal feed. J. Insects Food Feed. 2015, 1, 249–259. [Google Scholar] [CrossRef]
- Melenchón, F.; Larrán, A.; de Mercado, E.; Hidalgo, M.; Cardenete, G.; Barroso, F.; Fabrikov, D.; Lourenço, H.; Pessoa, M.; Tomás-Almenar, C. Potential use of black soldier fly (Hermetia illucens) and mealworm (Tenebrio molitor) insect meals in diets for rainbow trout (Oncorhynchus mykiss). Aquac. Nutr. 2021, 27, 491–505. [Google Scholar] [CrossRef]
- Belforti, M.; Gai, F.; Lussiana, C.; Renna, M.; Malfatto, V.; Rotolo, L.; De Marco, M.; Dabbou, S.; Schiavone, A.; Zoccarato, I.; et al. Tenebrio molitor meal in rainbow trout (Oncorhynchus mykiss) diets: Effects on animal performance, nutrient digestibility and chemical composition of fillets. Ital. J. Anim. Sci. 2015, 14, 4170. [Google Scholar] [CrossRef] [Green Version]
- Abdel-Tawwab, M. Effect of feed availability on susceptibility of Nile tilapia, Oreochromis niloticus (L.) to environmental zinc toxicity: Growth performance, biochemical response, and zinc bioaccumulation. Aquaculture 2016, 464, 309–315. [Google Scholar] [CrossRef]
- Iaconisi, V.; Secci, G.; Sabatino, G.; Piccolo, G.; Gasco, L.; Papini, A.M.; Parisi, G. Effect of mealworm (Tenebrio molitor L.) larvae meal on amino acid composition of gilthead sea bream (Sparus aurata L.) and rainbow trout (Oncorhynchus mykiss W.) fillets. Aquaculture 2019, 513, 734403. [Google Scholar] [CrossRef]
- Fazio, F.; Marafioti, S.; Torre, A.; Sanfilippo, M.; Panzera, M.; Faggio, C. Haematological and serum protein profiles of Mugil cephalus: Effect of two different habitats. Ichthyol. Res. 2013, 60, 36–42. [Google Scholar] [CrossRef]
- Tippayadara, N.; Dawood, M.; Krutmuang, P.; Hoseinifar, S.; Doan, H.; Paolucci, M. Replacement of Fish Meal by Black Soldier Fly (Hermetia illucens) Larvae Meal: Effects on Growth, Haematology, and Skin Mucus Immunity of Nile Tilapia, Oreochromis niloticus. Animals 2021, 11, 193. [Google Scholar] [CrossRef] [PubMed]
- Kumar, V.; Sahu, N.; Pal, A.; Kumar, S. Immunomodulation of Labeo rohita juveniles due to dietary gelatinized and non-gelatinized starch. Fish. Shellfish. Immunol. 2007, 23, 341–353. [Google Scholar] [CrossRef] [PubMed]
- Fawole, F.J.; Sahu, N.P.; Pal, A.K.; Ravindran, A. Haemato-immunological response of Labeo rohita (Hamilton) fingerlings fed leaf extracts and challenged by Aeromonas hydrophila. Aquac. Res. 2016, 47, 3788–3799. [Google Scholar] [CrossRef]
- Xiao, X.; Jin, P.; Zheng, L.; Cai, M.; Yu, Z.; Yu, J.; Zhang, J. Effects of black soldier fly (Hermetia illucens) larvae meal protein as a fishmeal replacement on the growth and immune index of yellow catfish (Pelteobagrus fulvidraco). Aquac. Res. 2018, 49, 1569–1577. [Google Scholar] [CrossRef]
- Motte, C.; Rios, A.; Lefebvre, T.; Do, H.; Henry, M.; Jintasataporn, O. Replacing Fish Meal with Defatted Insect Meal (Yellow Mealworm Tenebrio molitor) Improves the Growth and Immunity of Pacific White Shrimp (Litopenaeus vannamei). Animals 2019, 9, 258. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Liu, J.; Li, L.; Xia, W. Dietary chitosan improves hypercholesterolemia in rats fed high-fat diets. Nutr. Res. 2008, 28, 383–390. [Google Scholar] [CrossRef] [PubMed]
- Shafaeipour, A.; Yavari, V.; Falahatkar, B.; Maremmazi, J.G.; Gorjipour, E. Effects of canola meal on physiological and biochemical parameters in rainbow trout (Oncorhynchus mykiss). Aquac. Nutr. 2008, 14, 110–119. [Google Scholar] [CrossRef]
- Lu, R.; Chen, Y.; Yu, W.; Lin, M.; Yang, G.; Qin, C.; Meng, X.; Zhang, Y.; Ji, H.; Nie, G. Defatted black soldier fly (Hermetia illucens) larvae meal can replace soybean meal in juvenile grass carp (Ctenopharyngodon idellus) diets. Aquac. Rep. 2020, 18, 100520. [Google Scholar] [CrossRef]
- Raven, P.; Uh, M.; Sakhrani, D.; Beckman, B.; Cooper, K.; Pinter, J.; Leder, E.; Silverstein, J.; Devlin, R. Endocrine effects of growth hormone overexpression in transgenic coho salmon. Gen. Comp. Endocrinol. 2008, 159, 26–37. [Google Scholar] [CrossRef] [PubMed]
- Oakes, J.; Higgs, D.; Eales, J.; Devlin, R. Influence of ration level on the growth performance and body composition of non-transgenic and growth-hormone-transgenic coho salmon (Oncorhynchus kisutch). Aquacuture 2007, 265, 309–324. [Google Scholar] [CrossRef]
- Campbell, B.; Dickey, J.; Beckman, B.; Young, G.; Pierce, A.; Fukada, H.; Swanson, P. Previtellogenic Oocyte Growth in Salmon: Relationships among Body Growth, Plasma Insulin-Like Growth Factor-1, Estradiol-17beta, Follicle-Stimulating Hormone and Expression of Ovarian Genes for Insulin-Like Growth Factors, Steroidogenic-Acute Regulatory Protein and Receptors for Gonadotropins, Growth Hormone, and Somatolactin1. Biol. Reprod. 2006, 75, 34–44. [Google Scholar] [CrossRef] [PubMed]
- Hender, A.; Siddik, M.; Howieson, J.; Fotedar, R. Black Soldier Fly, Hermetia illucens as an Alternative to Fishmeal Protein and Fish Oil: Impact on Growth, Immune Response, Mucosal Barrier Status, and Flesh Quality of Juvenile Barramundi, Lates calcarifer (Bloch, 1790). Biology 2021, 10, 505. [Google Scholar] [CrossRef]
- Zarantoniello, M.; Randazzo, B.; Truzzi, C.; Giorgini, E.; Marcellucci, C.; Vargas-Abúndez, J.A.; Zimbelli, A.; Annibaldi, A.; Parisi, G.; Tulli, F.; et al. A six-months study on Black Soldier Fly (Hermetia illucens) based diets in zebrafish. Sci. Rep. 2019, 9, 8598. [Google Scholar] [CrossRef] [PubMed]
- Kumar, V.; Fawole, F.J.; Romano, N.; Hossain, S.; Labh, S.N.; Overturf, K.; Small, B.C. Insect (black soldier fly, Hermetia illucens) meal supplementation prevents the soybean meal-induced intestinal enteritis in rainbow trout and health benefits of using insect oil. Fish. Shellfish. Immunol. 2021, 109, 116–124. [Google Scholar] [CrossRef] [PubMed]
Ingredients Composition (g kg−1) | ITT0 | ITT25 | ITT50 | ITT75 | ITT100 | ||
---|---|---|---|---|---|---|---|
Fish meal 1 | 470 | 352.5 | 235 | 117.5 | - | ||
ITTINSECT® meal | - | 117.5 | 235 | 352.5 | 470 | ||
Soybean meal 2 | 200 | 200 | 200 | 200 | 200 | ||
Wheat meal 2 | 110 | 110 | 110 | 110 | 110 | ||
Corn starch 2 | 75 | 75 | 75 | 75 | 75 | ||
Fish oil 3 | 125 | 125 | 125 | 125 | 125 | ||
Vitamin–Mineral 4 | 20 | 20 | 20 | 20 | 20 | ||
Total | 1000 | 1000 | 1000 | 1000 | 1000 | ||
Gross composition (g kg−1 DM) | |||||||
AFM | ITTM | ITT0 | ITT25 | ITT50 | ITT75 | ITT100 | |
Protein | 67.02 | 66.4 | 384.0 | 388.7 | 389.4 | 382.4 | 381.8 |
Lipid | 13.76 | 14.8 | 155.3 | 153.9 | 154.7 | 151.4 | 153.2 |
Ash | 5.44 | 4.8 | 111.7 | 122.1 | 136.6 | 120.12 | 134.7 |
Arginine | 3.16 | 3.48 | 1.62 | 1.65 | 1.60 | 1.57 | 1.70 |
Threonine | 2.98 | 6.06 | 2.23 | 2.20 | 2.36 | 2.41 | 2.62 |
Tryptophan | 2.02 | 3.12 | 1.98 | 2.02 | 2.33 | 2.40 | 2.57 |
Histidine | 1.50 | 0.27 | 0.69 | 0.68 | 0.68 | 0.58 | 0.53 |
Valine | 2.47 | 0.89 | 2.29 | 2.26 | 2.22 | 1.72 | 1.22 |
Methionine | 1.05 | 1.01 | 0.95 | 0.93 | 0.98 | 0.90 | 0.90 |
Phenylalanine | 1.42 | 2.40 | 1.88 | 1.99 | 1.99 | 2.02 | 2.04 |
Isoleucine | 1.63 | 2.01 | 1.57 | 1.67 | 1.73 | 1.75 | 1.74 |
Leucine | 0.31 | 2.87 | 1.84 | 1.91 | 1.97 | 1.95 | 1.99 |
Lysine | 6.83 | 10.67 | 1.57 | 1.97 | 2.07 | 2.85 | 2.91 |
Gene | Oligonucleotide Sequence | Product Size (bp) | Gene Bank No. |
---|---|---|---|
β-actin | F: GCCGCGACCTCACAGACTACC | 126 | NP_001117707.1 |
R: CAAAGTCCAGCGCCACGTAGCA | |||
IL1-β | F: GGAGAGGTTAAAGGGTGGCGA | 106 | AJ223954 |
R: TGCCGACTCCAACTCCAACA | |||
IL-8 | F: GAATGTCAGCCAGCCTTGTC | 226 | AJ279069.1 |
R: TCCAGACAAATCTCCTGACCG | |||
TNF-α | F: GGGGACAAACTGTGGACTGA | 1056 | NM_001124357.1 |
R: GAAGTTCTTGCCCTGCTCTG | |||
GH | F: GTACCCTAGCCAGACCCTGATC | 5508 | NM_001124689 |
R: TCTTGAAGCAAGCCAACAACTC | |||
IGF-1 | F: TGGACACGCTGCAGTTTGTGTGT | 863 | M95183 |
R: CACTCGTCCACAATACCACGGT |
ITTM0 | ITTM25 | ITTM50 | ITTM75 | ITTM100 | |
---|---|---|---|---|---|
Initial weight (g) | 64.62 ± 1.35 | 66.77 ± 1.60 | 66.13 ± 0.92 | 66.08 ± 0.07 | 65.47 ± 1.38 |
Final weight (g) | 132.20 ± 2.80 b | 147.44 ± 1.17 a | 145.31 ± 1.30 a | 123.89 ± 1.84 c | 106.78 ± 2.99 d |
Relative growth rate (%) | 104.60 ± 3.90 b | 120.86 ± 3.58 a | 119.75 ± 3.80 a | 87.46 ± 3.00 c | 63.09 ± 2.12 d |
Specific growth rate (% day−1) | 1.19 ± 0.03 b | 1.32 ± 0.02 a | 1.31 ± 0.03 a | 1.04 ± 0.03 c | 0.81 ± 0.02 d |
Feed conversion | 0.88 ± 0.03 c | 0.74 ± 0.01 d | 0.75 ± 0.02 d | 1.03 ± 0.03 b | 1.45 ± 0.06 a |
Feed cost (US $/kg diet) | 1.36 | 1.32 | 1.27 | 1.22 | 1.17 |
FCE | 1.13 ± 0.04 b | 1.34 ± 0.01 a | 1.32 ± 0.03 a | 0.96 ± 0.03 c | 0.69 ± 0.03 d |
FMU | 417.61 ± 14.02 a | 262.20 ± 1.51 b | 178.10 ± 3.78 c | 122.06 ± 3.97 d | 0.00 ± 0.00 e |
FOU | 111.07 ± 3.73 c | 91.97 ± 0.53 d | 94.75 ± 2.01 d | 129.85 ± 4.22 b | 181.80 ± 8.23 a |
ECR | 1.20 ± 0.04 b | 0.98 ± 0.08 c | 0.92 ± 0.02 c | 1.27 ± 0.04 b | 1.70 ± 0.08 a |
EPI | 0.18 ± 0.01 b | 0.22 ± 0.01 a | 0.22 ± 0.01 a | 0.16 ± 0.01 c | 0.12 ± 0.01 d |
PRO | 2.79 ± 0.04 b | 3.02 ± 0.01 a | 3.08 ± 0.02 a | 2.73 ± 0.04 b | 2.30 ± 0.08 c |
ITTM0 | ITTM25 | ITTM50 | ITTM75 | ITTM100 | |
---|---|---|---|---|---|
Moisture (%) | 74.68 ± 0.16 | 74.51 ± 0.65 | 74.48 ± 0.61 | 75.21 ± 0.28 | 75.50 ± 0.47 |
Crude protein (%) | 22.91 ± 0.65 a | 20.15 ± 0.97 b | 20.60 ± 0.54 b | 19.28 ± 0.78 b | 19.64 ± 0.66 b |
Crude lipid (%) | 0.58 ± 0.20 b | 2.66 ± 0.30 a | 2.28 ± 0.44 a | 2.83 ± 1.06 a | 2.86 ± 0.73 a |
Crude ash (%) | 1.60 ± 0.08 | 1.95 ± 0.26 | 1.66 ± 0.01 | 1.85 ± 0.35 | 1.62 ± 0.13 |
Amino acid concentration (% of protein) | |||||
Arg (Arginine) | 1.32 ± 0.02 | 1.18 ± 0.05 | 1.14 ± 0.01 | 1.30 ± 0.16 | 1.16 ± 0.01 |
His (Histidine) | 0.64 ± 0.02 | 0.59 ± 0.07 | 0.57 ± 0.01 | 0.56 ± 0.07 | 0.60 ± 0.02 |
Ile (Isoleucine) | 1.84 ± 0.05 | 1.80 ± 0.01 | 1.51 ± 0.06 | 1.68 ± 0.24 | 1.60 ± 0.21 |
Leu (Leucine) | 1.02 ± 0.03 ab | 1.08 ± 0.01 a | 0.91 ± 0.02 b | 0.98 ± 0.11 ab | 0.95 ± 0.02 ab |
Lys (Lysine) | 1.87 ± 0.02 a | 1.91 ± 0.01 a | 1.46 ± 0.02 b | 1.54 ± 0.26 ab | 1.57 ± 0.21 ab |
Met (Methionine) | 0.71 ± 0.06 | 0.65 ± 0.05 | 0.56 ± 0.09 | 0.73 ± 0.08 | 0.61 ± 0.03 |
Phe (Phenylalanine) | 0.75 ± 0.03 | 0.75 ± 0.02 | 0.65 ± 0.01 | 0.71 ± 0.08 | 0.68 ± 0.06 |
Thr (Threonine) | 11.54 ± 0.25 | 10.65 ± 0.41 | 10.78 ± 0.31 | 10.56 ± 0.45 | 10.71 ± 0.83 |
Val (Valine) | 2.95 ± 0.06 a | 2.87 ± 0.02 a | 2.41 ± 0.12 b | 2.62 ± 0.13 ab | 2.39 ± 0.20 b |
∑EAA | 22.66 ± 0.39 a | 21.44 ± 0.36 ab | 20.01 ± 0.27 b | 20.69 ± 0.71 b | 20.28 ± 0.79 b |
Ala (Alanine) | 15.89 ± 0.06 | 17.40 ± 0.26 | 17.52 ± 0.46 | 15.22 ± 0.36 | 15.23 ± 2.43 |
Asp (Aspargine + Aspartic acid) | 17.46 ± 0.40 | 15.28 ± 0.23 | 15.59 ± 0.32 | 15.97 ± 0.79 | 15.89 ± 2.34 |
Cys (Cystine) | 0.10 ± 0.00 | 0.10 ± 0.00 | 0.09 ± 0.00 | 0.11 ± 0.01 | 0.10 ± 0.00 |
Glu (Glutamic acid) | 29.45 ± 0.76 | 31.16 ± 0.18 | 30.85 ± 1.24 | 30.74 ± 0.43 | 30.05 ± 1.33 |
Gln (Glutamine) | 2.06 ± 0.05 a | 2.02 ± 0.02 ab | 1.71 ± 0.06 b | 1.82 ± 0.08 ab | 1.83 ± 0.23 ab |
Pro (Proline) | 4.83 ± 0.05 a | 3.79 ± 0.15 b | 3.66 ± 0.21 b | 4.05 ± 0.19 b | 4.05 ± 0.23 b |
Ser (Serine) | 7.62 ± 0.30 b | 7.97 ± 0.02 ab | 8.05 ± 0.19 ab | 8.82 ± 0.34 a | 6.52 ± 0.55 c |
Tyr (Tyrosine) | 0.74 ± 0.04 | 0.65 ± 0.01 | 0.63 ± 0.01 | 0.67 ± 0.08 | 0.67 ± 0.06 |
∑NEAA | 78.16 ± 1.45 | 78.0.03 | 78.12 ± 1.94 | 77.40 ± 1.47 | 74.35 ± 4.79 |
∑EAA/∑NEAA | 0.29 ± 0.00 a | 0.27 ± 0.00 ab | 0.25 ± 0.00 b | 0.26 ± 0.00 ab | 0.27 ± 0.02 ab |
Groups | Rbc (×106 per mm3) | Hct (%) | Hgb (g/dL)) | TPROT (g/dL) | ALB (g/dL) | GLO (g/dL) | GLU (mg/dL) | CHOL (mg/dL) | TRIG (mg/dL) |
---|---|---|---|---|---|---|---|---|---|
ITTM0 | 1.46 ± 0.21 | 25.15 ± 3.20 | 8.80 ± 0.77 | 11.54 ± 1.26 a | 0.80 ± 0.06 | 10.74 ± 1.23 a | 81.08 ± 12.93 b | 95.10 ± 27.7 | 37.63 ± 12.28 |
ITTM25 | 1.37 ± 0.13 | 24.60 ± 3.45 | 8.03 ± 1.09 | 12.25 ± 0.98 a | 0.78 ± 0.13 | 12.30 ± 1.80 a | 82.20 ± 16.83 b | 105.47 ± 11.31 | 35.16 ± 7.26 |
ITTM50 | 1.46 ± 0.09 | 24.95 ± 2.15 | 7.98 ± 0.48 | 10.87 ± 1.98 ab | 0.85 ± 0.21 | 9.95 ± 1.88 ab | 91.84 ± 17.58 ab | 100.53 ± 7.54 | 41.15 ± 3.86 |
ITTM75 | 1.32 ± 0.12 | 22.12 ± 1.84 | 7.71 ± 0.56 | 8.77 ± 0.91 b | 0.73 ± 0.23 | 6.73 ± 2.31 b | 114.30 ± 15.62 a | 116.80 ± 7.28 | 37.86 ± 6.81 |
ITTM100 | 1.41 ± 0.19 | 23.60 ± 3.47 | 7.77 ± 0.79 | 10.80 ± 1.63 ab | 0.64 ± 0.17 | 10.16 ± 1.48 a | 101.47 ± 14.18 ab | 102.05 ± 19.63 | 43.67 ± 7.57 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Acar, Ü.; Giannetto, A.; Giannetto, D.; Kesbiç, O.S.; Yılmaz, S.; Romano, A.; Tezel, R.; Türker, A.; Güllü, K.; Fazio, F. Evaluation of an Innovative and Sustainable Pre-Commercial Compound as Replacement of Fish Meal in Diets for Rainbow Trout during Pre-Fattening Phase: Effects on Growth Performances, Haematological Parameters and Fillet Quality Traits. Animals 2021, 11, 3547. https://doi.org/10.3390/ani11123547
Acar Ü, Giannetto A, Giannetto D, Kesbiç OS, Yılmaz S, Romano A, Tezel R, Türker A, Güllü K, Fazio F. Evaluation of an Innovative and Sustainable Pre-Commercial Compound as Replacement of Fish Meal in Diets for Rainbow Trout during Pre-Fattening Phase: Effects on Growth Performances, Haematological Parameters and Fillet Quality Traits. Animals. 2021; 11(12):3547. https://doi.org/10.3390/ani11123547
Chicago/Turabian StyleAcar, Ümit, Alessia Giannetto, Daniela Giannetto, Osman Sabri Kesbiç, Sevdan Yılmaz, Alessandro Romano, Rifat Tezel, Ali Türker, Kenan Güllü, and Francesco Fazio. 2021. "Evaluation of an Innovative and Sustainable Pre-Commercial Compound as Replacement of Fish Meal in Diets for Rainbow Trout during Pre-Fattening Phase: Effects on Growth Performances, Haematological Parameters and Fillet Quality Traits" Animals 11, no. 12: 3547. https://doi.org/10.3390/ani11123547
APA StyleAcar, Ü., Giannetto, A., Giannetto, D., Kesbiç, O. S., Yılmaz, S., Romano, A., Tezel, R., Türker, A., Güllü, K., & Fazio, F. (2021). Evaluation of an Innovative and Sustainable Pre-Commercial Compound as Replacement of Fish Meal in Diets for Rainbow Trout during Pre-Fattening Phase: Effects on Growth Performances, Haematological Parameters and Fillet Quality Traits. Animals, 11(12), 3547. https://doi.org/10.3390/ani11123547