Effects of Dietary Protein Concentration on Lipid Metabolism Gene Expression and Fatty Acid Composition in 18–23-Month-Old Hanwoo Steers
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design, Animals, and Diet
2.2. Carcass Evaluation, Blood Collection, and Analysis
2.3. Tissue Biopsies, RNA Extraction, and Real-Time Quantitative PCR
2.4. Chemical and Fatty Acid Analyses
2.5. Statistical Analysis
3. Results
3.1. Feed Intake, Daily Gain, Blood Metabolites, and Fatty Acid Composition of Biopsy Tissues
3.2. Intramuscular Lipid Metabolic Genes Expression and Their Associations
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chung, K.Y.; Lee, S.H.; Cho, S.H.; Kwon, E.G.; Lee, J.H. Current situation and future prospects for beef production in South Korea—A review. Asian-Australas. J. Anim. Sci. 2018, 31, 951–960. [Google Scholar] [CrossRef] [PubMed]
- Park, S.J.; Beak, S.-H.; Jung, D.J.S.; Kim, S.Y.; Jeong, I.H.; Piao, M.Y.; Kang, H.J.; Fassah, D.M.; Na, S.W.; Yoo, S.P.; et al. Genetic, management, and nutritional factors affecting intramuscular fat deposition in beef cattle—A review. Asian-Australas. J. Anim. Sci. 2018, 31, 1043–1061. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.H.; Lee, J.H.; Oh, Y.G.; Kang, S.W.; Lee, S.C.; Park, W.Y.; Ko, Y.D. The Optimal TDN Levels of Concentrates and Slaughter Age in Hanwoo Steers. J. Anim. Sci. Technol. 2005, 47, 731–744. [Google Scholar] [CrossRef]
- NIAS. National Institute of Animal Science. Rural Development Administration. Korean Feeding Standard for Hanwoo. 2017. Available online: https://www.nias.go.kr/english/indexList.do (accessed on 10 July 2017).
- Reddy, K.E.; Jeong, J.Y.; Ji, S.Y.; Baek, Y.-C.; Lee, S.; Kim, M.; Oh, Y.K.; Lee, H.-J. Effects of High Levels of Nutrients on Growth Performance and Carcass Characteristics of Hanwoo Cattle. J. Korean Soc. Grassl. Forage Sci. 2018, 38, 180–189. [Google Scholar] [CrossRef]
- Kim, K.H.; Oh, Y.G.; Lee, S.C.; Shin, K.J.; Chung, W.T.; Kang, S.W.; Hong, S.K.; Ju, J.C.; Baek, B.H. Determination of Net Energy and Protein Requirements for Growth in Hanwoo Steers by Comparative Slaughter Experiment. J. Anim. Sci. Technol. 2007, 49, 41–50. [Google Scholar] [CrossRef]
- Wang, Y.H.; Bower, N.I.; Reverter, A.; Tan, S.H.; De Jager, N.; Wang, R.; McWilliam, S.M.; Cafe, L.M.; Greenwood, P.L.; Lehnert, S.A. Gene expression patterns during intramuscular fat development in cattle. J. Anim. Sci. 2009, 87, 119–130. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Cao, P.; Zhang, L.; Qi, M.; Wang, L.; Li, Z.; Shao, G.; Ding, L.; Zhao, X.; Zhao, X.; et al. Comparisons of adipogenesis- and lipid metabolism-related gene expression levels in muscle, adipose tissue and liver from Wagyu-cross and Holstein steers. PLoS ONE 2021, 16, e0247559. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.; Kwon, E.G.; Im, S.K.; Seo, K.S.; Baik, M. Expression of fat deposition and fat removal genes is associated with intramuscular fat content in longissimus dorsi muscle of Korean cattle steers1. J. Anim. Sci. 2012, 90, 2044–2053. [Google Scholar] [CrossRef]
- Song, Y.H.; Kim, S.J.; Lee, S.K. Evaluation of Ultrasound for Prediction of Carcass Meat Yield and Meat Quality in Korean Native Cattle (Hanwoo). Asian-Australas. J. Anim. Sci. 2002, 15, 591–595. [Google Scholar] [CrossRef]
- Cheah, K.S.; Cheah, A.M.; Just, A. Simple and rapid biopsy technique for obtaining fat and muscle samples from live animals for predicting meat quality. Dan. Vet. 1997, 80, 775–777. [Google Scholar]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- AOAC. AOAC Official Methods of Analysis, 18th ed.; Revision 1; Association of Official Agricultural Chemists: Gaithersburg, MD, USA, 2006; Available online: http://www.eoma.aoac.org (accessed on 10 November 2017).
- Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for Dietary Fiber, Neutral Detergent Fiber, and Nonstarch Polysaccharides in Relation to Animal Nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef]
- Van Soest, P.J. Collaborative Study of Acid-Detergent Fiber and Lignin. J. Assoc. Off. Anal. Chem. 1973, 56, 781–784. [Google Scholar] [CrossRef]
- O’Fallon, J.V.; Busboom, J.R.; Nelson, M.L.; Gaskins, C.T. A direct method for fatty acid methyl ester synthesis: Application to wet meat tissues, oils, and feedstuffs. J. Anim. Sci. 2007, 85, 1511–1521. [Google Scholar] [CrossRef]
- AOCS. Official Methods and Recommended Practices of the AOCS. American Oil Chemists’ Society, Champaign, IL, Method Ce 1j-07. Determination of Cis-, Trans-, Saturated, Monounsaturated and Polyunsaturated Fatty Acids in Dairy and Ruminant Fats by Capillary GLC, 7th ed.; AOCS: Urbana, IL, USA, 2018. [Google Scholar]
- AOCS. AOCS Official Method Ce 1h-05: Determination of Cis-, Trans-, Saturated, Monounsaturated and Polyunsaturated Fatty Acids in Vegetable or Non-Ruminant Animal Oils and Fats by Capillary GLC. Official Methods and Recommended Practices of the AOCS, 6th ed.; AOCS Press: Champaign, IL, USA, 2006. [Google Scholar]
- Gelman, A. Commentary: P values and statistical practice. Epidemiology 2013, 24, 69–72. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Zhu, Y.; Wang, X.; He, Y.; Cao, B. Effects of different dietary energy and protein levels and sex on growth performance, carcass characteristics and meat quality of F1 Angus × Chinese Xiangxi yellow cattle. J. Anim. Sci. Biotechnol. 2014, 5, 21. [Google Scholar] [CrossRef] [PubMed]
- Kamiya, M.; Yamada, T.; Higuchi, M. Influence of dietary crude protein content on fattening performance and nitrogen excretion of Holstein steers. Anim. Sci. J. 2020, 91, e13438. [Google Scholar] [CrossRef] [PubMed]
- Oddy, V.H.; Smith, C.; Dobos, R.; Harper, G.S.; Allingham, P. Effect of Dietary Protein Content on Marbling and Performance of Beef Cattle; Final Report of Project FLOT 210; Meat and Livestock Australia: North Sydney, Australia, 2000. [Google Scholar]
- Pethick, D.W.; McIntyre, B.L.; Tudor, G.E. The Role of Dietary Protein as a Regulator of the Expression of Marbling in Feedlot Cattle (WA); Meat & Livestock Australia: North Sydney, Australia, 2000. [Google Scholar]
- Lee, Y.H.; Ahmadi, F.; Lee, M.; Oh, Y.-K.; Kwak, W.S. Effect of crude protein content and undegraded intake protein level on productivity, blood metabolites, carcass characteristics, and production economics of Hanwoo steers. Asian-Australas. J. Anim. Sci. 2020, 33, 1599–1609. [Google Scholar] [CrossRef] [PubMed]
- Garmyn, A.J.; Hilton, G.G.; Mateescu, R.G.; Morgan, J.B.; Reecy, J.M.; Tait, R.G., Jr.; Beitz, D.C.; Duan, Q.; Schoonmaker, J.P.; Mayes, M.S.; et al. Estimation of relationships between mineral concentration and fatty acid composition of longissimus muscle and beef palatability traits. J. Anim. Sci. 2011, 89, 2849–2858. [Google Scholar] [CrossRef]
- Moon, H.; Seok, J.H. Price relationship among domestic and imported beef products in South Korea. Empir. Econ. 2021, 61, 3541–3555. [Google Scholar] [CrossRef]
- Troy, D.J.; Tiwari, B.K.; Joo, S.-T. Health Implications of Beef Intramuscular Fat Consumption. Korean J. Food Sci. Anim. Resour. 2016, 36, 577–582. [Google Scholar] [CrossRef]
- Gilmore, L.A.; Walzem, R.L.; Crouse, S.F.; Smith, D.R.; Adams, T.H.; Vaidyanathan, V.; Cao, X.; Smith, S.B. Consumption of High-Oleic Acid Ground Beef Increases HDL-Cholesterol Concentration but Both High- and Low-Oleic Acid Ground Beef Decrease HDL Particle Diameter in Normocholesterolemic Men. J. Nutr. 2011, 141, 1188–1194. [Google Scholar] [CrossRef] [PubMed]
- Nogoy, K.M.C.; Kim, H.J.; Lee, D.H.; Smith, S.B.; Seong, H.A.; Choi, S.H. Oleic acid in Angus and Hanwoo (Korean native cattle) fat reduced the fatty acid synthase activity in rat adipose tissues. J. Anim. Sci. Technol. 2021, 63, 380–393. [Google Scholar] [CrossRef] [PubMed]
- Varga, T.; Czimmerer, Z.; Nagy, L. PPARs are a unique set of fatty acid regulated transcription factors controlling both lipid metabolism and inflammation. Biochim. Biophys. Acta (BBA) Mol. Basis Dis. 2011, 1812, 1007–1022. [Google Scholar] [CrossRef] [PubMed]
- Schoonjans, K.; Peinado-Onsurbe, J.; Lefebvre, A.-M.; Heyman, R.A.; Briggs, M.; Deeb, S.; Staels, B.; Auwerx, J. PPARalpha and PPARgamma activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO J. 1996, 15, 5336–5348. [Google Scholar] [CrossRef]
- Zhang, J.; Phillips, D.I.W.; Wang, C.; Byrne, C.D. Human skeletal muscle PPARα expression correlates with fat metabolism gene expression but not BMI or insulin sensitivity. Am. J. Physiol. Endocrinol. Metab. 2004, 286, E168–E175. [Google Scholar] [CrossRef]
- Murakamia, K.; Idea, T.; Suzukia, M.; Mochizuki, T.; Kadowaki, T. Evidence for Direct Binding of Fatty Acids and Eicosanoids to Human Peroxisome Proliferators-Activated Receptor α. Biochem. Biophys. Res. Commun. 1999, 260, 609–613. [Google Scholar] [CrossRef]
- Boualga, A.; Bouchenak, M.; Belleville, J. Low-protein diet prevents tissue lipoprotein lipase activity increase in growing rats. Br. J. Nutr. 2000, 84, 663–671. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zhang, H.-B.; Wang, Z.S.; Peng, Q.-H.; Tan, C.; Zou, H.-W. Effects of different levels of protein supplementary diet on gene expressions related to intramuscular deposition in early-weaned yaks. Anim. Sci. J. 2014, 85, 411–419. [Google Scholar] [CrossRef]
- Wang, H.; Eckel, R.H. Lipoprotein lipase: From gene to obesity. Am. J. Physiol. Endocrinol. Metab. 2009, 297, E271–E288. [Google Scholar] [CrossRef]
- Okumura, T.; Saito, K.; Sakuma, H.; Nade, T.; Nakayama, S.; Fujita, K.; Kawamura, T. Intramuscular fat deposition in principal muscles from twenty-four to thirty months of age using identical twins of Japanese Black steers. J. Anim. Sci. 2007, 85, 1902–1907. [Google Scholar] [CrossRef]
- Payne, V.A.; Grimsey, N.; Tuthill, A.; Virtue, S.; Gray, S.L.; Nora, E.D.; Semple, R.K.; O’Rahilly, S.; Rochford, J.J. The Human Lipodystrophy Gene BSCL2/Seipin May Be Essential for Normal Adipocyte Differentiation. Diabetes 2008, 57, 2055–2060. [Google Scholar] [CrossRef]
- Igal, R.A.; Wang, S.; Gonzalez-Baró, M.; Coleman, R.A. Mitochondrial Glycerol Phosphate Acyltransferase Directs the Incorporation of Exogenous Fatty Acids into Triacylglycerol. J. Biol. Chem. 2001, 276, 42205–42212. [Google Scholar] [CrossRef]
- Segers, J.R.; Loor, J.J.; Moisá, S.J.; Gonzalez, D.; Shike, D.W. Effects of protein and fat concentration in coproduct-based growing calf diets on adipogenic and lipogenic gene expression, blood metabolites, and carcass composition. J. Anim. Sci. 2017, 95, 2767–2781. [Google Scholar] [CrossRef] [PubMed]
- Smith, S.J.; Cases, S.; Jensen, D.R.; Chen, H.C.; Sande, E.; Tow, B.; Sanan, D.A.; Raber, J.; Eckel, R.H.; Farese, R.V. Obesity resistance and multiple mechanisms of triglyceride synthesis in mice lacking Dgat. Nat. Genet. 2000, 25, 87–90. [Google Scholar] [CrossRef]
- Yu, Y.-H.; Zhang, Y.; Oelkers, P.; Sturley, S.L.; Rader, D.J.; Ginsberg, H.N. Posttranscriptional Control of the Expression and Function of Diacylglycerol Acyltransferase-1 in Mouse Adipocytes. J. Biol. Chem. 2002, 277, 50876–50884. [Google Scholar] [CrossRef]
- Oelkers, P.; Tinkelenberg, A.; Erdeniz, N.; Cromley, D.; Billheimer, J.T.; Sturley, S.L. A Lecithin Cholesterol Acyltransferase-like Gene Mediates Diacylglycerol Esterification in Yeast. J. Biol. Chem. 2000, 275, 15609–15612. [Google Scholar] [CrossRef] [PubMed]
- Shen, W.-J.; Liang, Y.; Hong, R.; Patel, S.; Natu, V.; Sridhar, K.; Jenkins, A.; Bernlohr, D.A.; Kraemer, F. Characterization of the Functional Interaction of Adipocyte Lipid-binding Protein with Hormone-sensitive Lipase. J. Biol. Chem. 2001, 276, 49443–49448. [Google Scholar] [CrossRef] [PubMed]
- Shen, W.-J.; Sridhar, K.; Bernlohr, D.A.; Kraemer, F. Interaction of rat hormone-sensitive lipase with adipocyte lipid-binding protein. Proc. Natl. Acad. Sci. USA 1999, 96, 5528–5532. [Google Scholar] [CrossRef]
- Ntambi, J.M. Regulation of stearoyl-CoA desaturase by polyunsaturated fatty acids and cholesterol. J. Lipid Res. 1999, 40, 1549–1558. [Google Scholar] [CrossRef]
- Enoch, H.G.; Catalá, A.; Strittmatter, P. Mechanism of rat liver microsomal stearyl-CoA desaturase. Studies of the substrate specificity, enzyme-substrate interactions, and the function of lipid. J. Biol. Chem. 1976, 251, 5095–5103. [Google Scholar] [CrossRef]
- Man, W.C.; Miyazaki, M.; Chu, K.; Ntambi, J. Colocalization of SCD1 and DGAT2: Implying preference for endogenous monounsaturated fatty acids in triglyceride synthesis. J. Lipid Res. 2006, 47, 1928–1939. [Google Scholar] [CrossRef]
- Archibeque, S.L.; Lunt, D.K.; Gilbert, C.D.; Tume, R.K.; Smith, S.B. Fatty acid indices of stearoyl-CoA desaturase do not reflect actual stearoyl-CoA desaturase enzyme activities in adipose tissues of beef steers finished with corn-, flaxseed-, or sorghum-based diets1. J. Anim. Sci. 2005, 83, 1153–1166. [Google Scholar] [CrossRef]
- Graugnard, D.E.; Berger, L.L.; Faulkner, D.B.; Loor, J.J. High-starch diets induce precocious adipogenic gene network up-regulation in longissimus lumborum of early-weaned Angus cattle. Br. J. Nutr. 2010, 103, 953–963. [Google Scholar] [CrossRef] [PubMed]
- Moisá, S.J.; Shike, D.W.; Faulkner, D.B.; Meteer, W.T.; Keisler, D.; Loor, J.J. Central Role of the PPARγ Gene Network in Coordinating Beef Cattle Intramuscular Adipogenesis in Response to Weaning Age and Nutrition. Gene Regul. Syst. Biol. 2014, 8, 17–32. [Google Scholar] [CrossRef]
- Zhang, D.; Christianson, J.; Liu, Z.-X.; Tian, L.; Choi, C.S.; Neschen, S.; Dong, J.; Wood, P.A.; Shulman, G.I. Resistance to High-Fat Diet-Induced Obesity and Insulin Resistance in Mice with Very Long-Chain Acyl-CoA Dehydrogenase Deficiency. Cell Metab. 2010, 11, 402–411. [Google Scholar] [CrossRef]
- Kociucka, B.; Jackowiak, H.; Kamyczek, M.; Szydlowski, M.; Szczerbal, I. The relationship between adipocyte size and the transcript levels of SNAP23, BSCL2 and COPA genes in pigs. Meat Sci. 2016, 121, 12–18. [Google Scholar] [CrossRef] [PubMed]
- Vierck, K.R.; O’Quinn, T.G.; Noel, J.A.; Houser, T.A.; Boyle, E.A.E.; Gonzalez, J.M. Effects of Marbling Texture on Muscle Fiber and Collagen Characteristics. Meat Muscle Biol. 2018, 2, 75–82. [Google Scholar] [CrossRef][Green Version]
Items | Concentrates | Ryegrass Hay | |
---|---|---|---|
LCP | HCP | ||
Ingredient (% DM) | |||
Broken corn | 1.36 | 1.02 | |
Wheat bran | 4.44 | 5.56 | |
Soy bean hull | 7.08 | 2.12 | |
Urea | 0.45 | 0.58 | |
NaCl | 0.20 | 0.20 | |
Molasses | 3.00 | 3.00 | |
Baking soda | 1.07 | 0.94 | |
Steam flaked corn | 22.00 | 22.00 | |
Ammonium chloride | 0.15 | 0.15 | |
Corn flour | 1.72 | 0.05 | |
Extruded palm seed | 4.24 | 7.52 | |
CMS | 1.50 | 1.50 | |
Wheat flour | 20.02 | 20.00 | |
DDGS | 10.00 | 13.00 | |
Corn gluten feed | 20.00 | 19.92 | |
Limestone | 2.34 | 2.00 | |
Amaferm 1 | 0.01 | 0.01 | |
Palm oil | 0.20 | 0.20 | |
Mineral/Vitamin premix 2 | 0.23 | 0.23 | |
Nutrient composition (% DM) | |||
DM (%) | 89.0 | 89.0 | 90.0 |
Ash | 6.6 | 6.4 | 4.4 |
Crude Protein | 14.5 | 17.0 | 5.7 |
Ether extract | 3.4 | 3.7 | 1.2 |
NDF | 22.0 | 22.0 | 67.1 |
ADF | 8.4 | 8.1 | 40.8 |
TDN | 75.1 | 75.2 | - |
Gene | NCBI Acc. No. | Primer Name | Primer Sequence (5′–3′) | Product Size (bp) |
---|---|---|---|---|
Transcription factors: | ||||
Peroxisome proliferator activated receptors | NM_001034036.1 | PPAR FP | CAATGGAGATGGTGGACACA | 95 |
PPAR RP | TTGTAGGAAGTCTGCCGAGAG | |||
Sterol regulatory element-binding proteins | NM_001113302.1 | SREBP FP | GAGCCACCCTTCAACGAA | 88 |
SREBP RP | TGTCTTCTATGTCGGTCAGCA | |||
Lipogenesis: | ||||
Acetyl-CoA carboxylase | NM_174224.2 | ACACA FP | CGCTCGGTGATTGAAGAGAA | 117 |
ACACA RP | CGTCATGTGGACGATGGAAT | |||
Fatty acid synthase | NM_001012669.1 | FASN FP | ATCGAGTGCATCAGGCAAGT | 92 |
FASN RP | TGTGAGCACATCTCGAAAGCCA | |||
Stearoyl-CoA desaturase | NM_173959.4 | SCD FP | TTATTCCGTTATGCCCTTGG | 83 |
SCD RP | TTGTCATAAGGGCGGTATCC | |||
Fatty acid uptake: | ||||
Lipoprotein lipase | NM_001075120.1 | LPL FP | CTCAGGACTCCCGAAGACAC | 98 |
LPL RP | GTTTTGCTGCTGTGGTTGAA | |||
Fatty acid binding protein 4 | NM_174314.2 | FABP4 FP | GGATGATAAGATGGTGCTGGA | 80 |
FABP4 RP | ATCCCTTGGCTTATGCTCTCT | |||
Fatty acid translocase (CD36) | NM_174010.3 | CD36 FP | GGTCCTTACACATACAGAGTTCG | 115 |
CD36 RP | ATAGCGAGGGTTCAAAGATGG | |||
Fatty acid esterification: | ||||
Glycerol-3-phosphate acyltransferase-1 | NM_001012282.1 | GPAT1 FP | TGTGCTATCTGCTCTCCAATG | 116 |
GPAT1 RP | CTCCGCCACTATAAGAATG | |||
Diacylglycerol acyltransferase-2 | NM_205793.2 | DGAT2 FP | CATTGCCGTGCTCTACTTCA | 86 |
DGAT2 RP | AGTTTCGGACCCACTGTGAC | |||
Lipolysis: | ||||
Adipose triglyceride lipase | NM_001046005.2 | ATGL FP | TGACCACACTCTCCAACA | 100 |
ATGL RP | AAGCGGATGGTGAAGGA | |||
Very long chain acyl-CoA dehydrogenase | U30817.1 | VLCAD FP | TCTTCGAGGGGACAAATGAC | 116 |
VLCAD RP | AGCATTCCCAAAAGGGTTCT | |||
Adipocyte size: | ||||
Synaptosome-associated protein 23 | BT030678.1 | SNAP23 FP | GGAGGGGAGGCAAGAGATAA | 148 |
SNAP23 RP | AAACCAAGCACTGGCCTAAA | |||
Berardinelli-Seip congenital lipodystrophy2-seipin | BC105396.1 | BSCL2 FP | CGAAAGGTCTCTGCCCATC | 140 |
BSCL2 RP | GTTTTCTCCTCCTCGGACAG | |||
Housekeeping: | ||||
Beta-actin | BC142413.1 | β-Actin FP | GTCCACCTTCCAGCAGATGT | 90 |
β -Actin RP | CAGTCCGCCTAGAAGCATTT |
Item | LCP | HCP | SEM | p-Value |
---|---|---|---|---|
DMI (kg/d) | 9.5 | 9.5 | 0.02 | 0.993 |
Concentrate (% DMI) | 81.6 | 82.0 | 0.17 | 0.111 |
Rye grass hay (% DMI) | 17.5 | 17.1 | 0.31 | 0.379 |
Body weight (kg) | ||||
Initial | 484.6 | 487.5 | 9.04 | 0.822 |
Final | 621.2 | 626.7 | 12.44 | 0.756 |
Average daily gain (kg/d) | 0.76 | 0.77 | 0.04 | 0.815 |
Feed conversion ratio 1 | 13.3 | 12.9 | 0.70 | 0.646 |
Serum metabolites | ||||
Cholesterol, mg/dL | 134.9 | 155.4 | 15.90 | 0.377 |
Triglycerides, mg/dL | 17.3 | 20.5 | 1.47 | 0.141 |
Glucose, mg/dL | 40.5 | 38.9 | 2.67 | 0.674 |
NEFA, mmol/L | 0.1 | 0.1 | 0.01 | 0.226 |
Item | LCP | HCP | SEM | p-Value |
---|---|---|---|---|
Back fat thickness (mm) | 7.08 | 6.90 | 0.48 | 0.799 |
Rib eye area (cm2) | 82.13 | 81.83 | 1.20 | 0.860 |
Yield grade (A:B:C, head) 1 | 17:3:0 | 18:2:0 | ||
Yield grade score 2 | 2.85 | 2.90 | 0.08 | 0.643 |
Marbling score 3 | 3.00 | 2.95 | 0.24 | 0.883 |
Quality grade (1+:1:2:3, head) 4 | 0:7:12:1 | 1:3:16:0 | ||
Quality grade score 5 | 2.35 | 2.25 | 0.13 | 0.582 |
Fatty Acid (mg/100 g FAME) | LCP | HCP | SEM | p-Value |
---|---|---|---|---|
Myristic acid (C14:0) | 3571 | 3476 | 283.7 | 0.815 |
Palmitic acid (C16:0) | 26339 | 26921 | 1213.7 | 0.639 |
Palmitoleic acid (C16:1n7) | 4062 | 4382 | 495.8 | 0.656 |
Stearic acid (C18:0) | 10123 | 10606 | 572.7 | 0.560 |
Oleic acid (cis 9 C18:1) | 37192 | 39747 | 990.7 | 0.090 |
Linoleic acid (C18:2n6c) | 2283 | 2861 | 393.3 | 0.316 |
Gamma-linolenic acid (C18:3n6) | 34 | 34 | 2.5 | 0.816 |
Alpha linolenic acid (C18:3n3) | 114 | 129 | 7.9 | 0.218 |
Eicosenoic acid (C20:1n9) | 147 | 217 | 19.0 | 0.008 |
Arachidonic acid (C20:4n6) | 424 | 672 | 225.3 | 0.449 |
Others 1 | 5843 | 6169 | 693.2 | 0.621 |
SFA 2 | 41758 | 42705 | 1482.2 | 0.659 |
MUFA 3 | 45201 | 48442 | 1261.0 | 0.091 |
PUFA 4 | 3173 | 4067 | 666.3 | 0.359 |
Total fatty acids (mg/100 g FAME) | 90132 | 95214 | 1842.4 | 0.071 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bharanidharan, R.; Thirugnanasambantham, K.; Ibidhi, R.; Bang, G.; Jang, S.S.; Baek, Y.C.; Kim, K.H.; Moon, Y.H. Effects of Dietary Protein Concentration on Lipid Metabolism Gene Expression and Fatty Acid Composition in 18–23-Month-Old Hanwoo Steers. Animals 2021, 11, 3378. https://doi.org/10.3390/ani11123378
Bharanidharan R, Thirugnanasambantham K, Ibidhi R, Bang G, Jang SS, Baek YC, Kim KH, Moon YH. Effects of Dietary Protein Concentration on Lipid Metabolism Gene Expression and Fatty Acid Composition in 18–23-Month-Old Hanwoo Steers. Animals. 2021; 11(12):3378. https://doi.org/10.3390/ani11123378
Chicago/Turabian StyleBharanidharan, Rajaraman, Krishnaraj Thirugnanasambantham, Ridha Ibidhi, Geumhwi Bang, Sun Sik Jang, Youl Chang Baek, Kyoung Hoon Kim, and Yea Hwang Moon. 2021. "Effects of Dietary Protein Concentration on Lipid Metabolism Gene Expression and Fatty Acid Composition in 18–23-Month-Old Hanwoo Steers" Animals 11, no. 12: 3378. https://doi.org/10.3390/ani11123378
APA StyleBharanidharan, R., Thirugnanasambantham, K., Ibidhi, R., Bang, G., Jang, S. S., Baek, Y. C., Kim, K. H., & Moon, Y. H. (2021). Effects of Dietary Protein Concentration on Lipid Metabolism Gene Expression and Fatty Acid Composition in 18–23-Month-Old Hanwoo Steers. Animals, 11(12), 3378. https://doi.org/10.3390/ani11123378