Mineral Element Deposition and Gene Expression across Different Tissues of Cherry Valley Ducks
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Animals and Experimental Design
2.3. Sample Collection
2.4. Experimental and Laboratory Procedures
2.4.1. Mineral Element Content Determination
2.4.2. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.5. Statistical Analysis
3. Results
3.1. The Dynamics of Mineral Elements
3.2. Correlations between Depositions of Different Mineral Elements
3.3. Expression Pattern of Mineral Element Related Genes
3.4. Correlations between Gene Expression and Mineral Deposition
4. Discussion
4.1. Dynamics and Correlations of Mineral Elements
4.2. Genes and Depositions of Mineral Elements
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bettger, W.J.; O’Dell, B.L. A critical physiological role of zinc in the structure and function of biomembranes. Life Sci. 1981, 28, 1425–1438. [Google Scholar] [CrossRef] [Scilit]
- Fox, C.; Ramsoomair, D.; Carter, C. Magnesium: Its proven and potential clinical significance. South Med. J. 2001, 94, 1195–1201. [Google Scholar] [CrossRef] [Scilit]
- Kovesdy, C.P.; Appel, L.J.; Grams, M.E.; Gutekunst, L.; McCullough, P.A.; Palmer, B.F.; Pitt, B.; Sica, D.A.; Townsend, R.R. Potassium homeostasis in health and disease: A scientific workshop cosponsored by the National Kidney Foundation and the American Society of Hypertension. J. Am. Soc. Hypertens. 2017, 11, 783–800. [Google Scholar] [CrossRef] [Scilit]
- Scott, M.E.; Koski, K.G. Zinc deficiency impairs immune responses against parasitic nematode infections at intestinal and systemic sites. J. Nutr. 2000, 130, 1412s–1420s. [Google Scholar] [CrossRef] [Scilit]
- Kvicala, J. Selenium and the organism. Casopis Lekaru Ceskych 1999, 138, 99–106. [Google Scholar]
- Hou, S.S.; Liu, L.Z. Current situation, future development trend and suggestions of waterfowl industry in 2019. Chin. J. Anim. Sci. 2020, 56, 130–135. [Google Scholar]
- Schmitz, C.; Perraud, A.L.; Johnson, C.O.; Inabe, K.; Smith, M.K.; Penner, R.; Kurosaki, T.; Fleig, A.; Scharenberg, A.M. Regulation of vertebrate cellular Mg2+ homeostasis by TRPM7. Cell 2003, 114, 191–200. [Google Scholar] [CrossRef] [Scilit]
- Lainez, S.; Schlingmann, K.P.; van der Wijst, J.; Dworniczak, B.; van Zeeland, F.; Konrad, M.; Bindels, R.J.; Hoenderop, J.G. New TRPM6 missense mutations linked to hypomagnesemia with secondary hypocalcemia. Eur. J. Hum. Genet. 2014, 22, 497–504. [Google Scholar] [CrossRef] [Scilit]
- Chubanov, V.; Waldegger, S.; Mederos y Schnitzler, M.; Vitzthum, H.; Sassen, M.C.; Seyberth, H.W.; Konrad, M.; Gudermann, T. Disruption of TRPM6/TRPM7 complex formation by a mutation in the TRPM6 gene causes hypomagnesemia with secondary hypocalcemia. Proc. Natl. Acad. Sci. USA 2004, 101, 2894–2899. [Google Scholar] [CrossRef] [Scilit]
- Glorioso, N.; Herrera, V.L.; Bagamasbad, P.; Filigheddu, F.; Troffa, C.; Argiolas, G.; Bulla, E.; Decano, J.L.; Ruiz-Opazo, N. Association of ATP1A1 and dear single-nucleotide polymorphism haplotypes with essential hypertension: Sex-specific and haplotype-specific effects. Circ. Res. 2007, 100, 1522–1529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cloues, R.; Jones, S.; Brown, D.A. Zn2+ potentiates ATP-activated currents in rat sympathetic neurons. Pflugers Arch. 1993, 424, 152–158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jablonska, E.; Gromadzinska, J.; Reszka, E.; Wasowicz, W.; Sobala, W.; Szeszenia-Dabrowska, N.; Boffetta, P. Association between GPX1 Pro198Leu polymorphism, GPX1 activity and plasma selenium concentration in humans. Eur. J. Nutr. 2009, 48, 383–386. [Google Scholar] [CrossRef] [Scilit]
- Kelner, M.J.; Montoya, M.A. Structural organization of the human selenium-dependent phospholipid hydroperoxide glutathione peroxidase gene (GPX4): Chromosomal localization to 19p13.3. Biochem. Biophys. Res. Commun. 1998, 249, 53–55. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Gao, M.; Nie, W.; Yuan, J.; Zhang, B.; Wang, Z.; Wu, Z. Dietary Magnesium Sulfate Supplementation Protects Heat Stress-Induced Oxidative Damage by Restoring the Activities of Anti-oxidative Enzymes in Broilers. Biol. Trace Elem. Res. 2012, 146, 53–58. [Google Scholar] [CrossRef] [Scilit]
- Attia, Y.A.; Abd Al-Hamid, A.E.; Zeweil, H.S.; Qota, E.M.; Bovera, F.; Monastra, G.; Sahledom, M.D. Effect of dietary amounts of inorganic and organic zinc on productive and physiological traits of White Pekin ducks. Animal 2013, 7, 895–900. [Google Scholar] [CrossRef] [Scilit]
- He, R.F.; Li, S.Y.; Jin, H.T.; Wang, L.Y.; Yan, M.T. Effects of trace mineral on meat quality. China Anim. Husb. Vet. Med. 2008, 35, 12–15. [Google Scholar]
- Ding, B.Y.; Hou, Y.Q.; Wang, C. Effect of compound meat quality improver on duck meat quality. Heilongjiang Anim. Sci. Vet. Med. 2008, 9, 109–110. [Google Scholar]
- Shastak, Y.; Rodehutscord, M. A review of the role of magnesium in poultry nutrition. World’s Poult. Sci. J. 2015, 71, 125–138. [Google Scholar] [CrossRef] [Scilit]
- Estevez, M.; Petracci, M. Benefits of Magnesium Supplementation to Broiler Subjected to Dietary and Heat Stress: Improved Redox Status, Breast Quality and Decreased Myopathy Incidence. Antioxidants 2019, 8, 456. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.H.; Huang, R.L.; Zhang, Z.Y.; Feng, Z.K. An essential mineral element for animals-magnesium. China Feed 2003, 18, 24–25. [Google Scholar]
- Suttle, N.F. Mineral Nutrition of Livestock; CABI Publishing: New York, NY, USA, 2010. [Google Scholar]
- Yao, Y.P.; Feng, H.B.; Zhao, L.P.; Wang, Y.L.; Xu, S.Q. The relationship between the distribution of intracellular and extracellular potassium and human health. J. Public Health Prev. Med. 2006, 17, 57–59. [Google Scholar]
- Peeters, E.; Driessen, B.; Geers, R. Influence of supplemental magnesium, tryptophan, vitamin C, vitamin E, and herbs on stress responses and pork quality. J. Anim. Sci. 2006, 84, 1827–1838. [Google Scholar] [CrossRef] [Scilit]
- Meyer, T.E.; Verwoert, G.C.; Hwang, S.J.; Glazer, N.L.; Smith, A.V.; van Rooij, F.J.; Ehret, G.B.; Boerwinkle, E.; Felix, J.F.; Leak, T.S.; et al. Genome-wide association studies of serum magnesium, potassium, and sodium concentrations identify six Loci influencing serum magnesium levels. PLoS Genet. 2010, 6, e1001045. [Google Scholar] [CrossRef] [Scilit]
- Hu, C.H.; Qian, Z.C.; Song, J.; Luan, Z.S.; Zuo, A.Y. Effects of zinc oxide-montmorillonite hybrid on growth performance, intestinal structure, and function of broiler chicken. Poult. Sci. 2013, 92, 143–150. [Google Scholar] [CrossRef] [Scilit]
- Tang, Z.G.; Wen, C.; Wang, L.C.; Wang, T.; Zhou, Y.M. Effects of zinc-bearing clinoptilolite on growth performance, cecal microflora and intestinal mucosal function of broiler chickens. Anim. Feed Sci. Technol. 2014, 189, 98–106. [Google Scholar] [CrossRef] [Scilit]
- Rotruck, J.T.; Pope, A.L.; Ganther, H.E.; Swanson, A.B.; Hafeman, D.G.; Hoekstra, W.G. Selenium: Biochemical role as a component of glutathione peroxidase. Science 1973, 179, 588–590. [Google Scholar] [CrossRef] [Scilit]
- Jamier, V.; Ba, L.A.; Jacob, C. Selenium- and tellurium-containing multifunctional redox agents as biochemical redox modulators with selective cytotoxicity. Chemistry 2010, 16, 10920–10928. [Google Scholar] [CrossRef] [Scilit]
- Burk, R.F.; Hill, K.E. Regulation of Selenium Metabolism and Transport. Annu. Rev. Nutr. 2015, 35, 109–134. [Google Scholar] [CrossRef] [Scilit]
- Touyz, R.M. Transient receptor potential melastatin 6 and 7 channels, magnesium transport, and vascular biology: Implications in hypertension. Am. J. Physiol. Heart Circ. Physiol. 2008, 294, H1103–H1118. [Google Scholar] [CrossRef] [Scilit]
- Voets, T.; Nilius, B.; Hoefs, S.; van der Kemp, A.W.; Droogmans, G.; Bindels, R.J.; Hoenderop, J.G. TRPM6 forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. J. Biol. Chem. 2004, 279, 19–25. [Google Scholar] [CrossRef] [Scilit]
- Bates-Withers, C.; Sah, R.; Clapham, D.E. TRPM7, the Mg2+ Inhibited Channel and Kinase. Adv. Exp. Med. Biol. 2011, 704, 173–183. [Google Scholar]
- Jiang, Z.P.; Newell, E.W.; Schlichter, L.C. Regulation of a TRPM7-like current in rat brain microglia. Biophys. J. 2004, 86, 429a. [Google Scholar] [CrossRef] [Scilit]
- Bab-Dinitz, E.; Albeck, S.; Peleg, Y.; Brumfeld, V.; Gottschalk, K.E.; Karlish, S.J. A C-terminal lobe of the beta subunit of Na,K-ATPase and H,K-ATPase resembles cell adhesion molecules. Biochemistry 2009, 48, 8684–8691. [Google Scholar] [CrossRef] [Scilit]
- Sweadner, K.J. Isozymes of the Na+/K+-ATPase. BBA Rev. Biomembr. 1989, 988, 185–220. [Google Scholar] [CrossRef] [Scilit]
- El-Mallakh, R.S.; Wyatt, R.J. The Na,K-ATPase hypothesis for bipolar illness. Biol. Psychiatry 1995, 37, 235–244. [Google Scholar] [CrossRef] [Scilit]
- Blostein, R.; Pu, H.X.; Scanzano, R.; Zouzoulas, A. Structure/function studies of the gamma subunit of the Na,K-ATPase. Ann. N. Y. Acad. Sci. 2003, 986, 420–427. [Google Scholar] [CrossRef] [Scilit]
- Xiao, B.; Zhang, Y.; Niu, W.; Gao, P.; Zhu, D. Association of ATP1B1 single-nucleotide polymorphisms with blood pressure and hypertension in a Chinese population. Clin. Chim. Acta 2009, 407, 47–50. [Google Scholar] [CrossRef] [Scilit]
- Johanning, G.L.; Browning, J.D.; Bobilya, D.J.; Veum, T.L.; O’Dell, B.L. Effect of Zinc Deficiency on Enzyme Activities in Rat and Pig Erythrocyte Membranes. Proc. Soc. Exp. Biol. Med. 1990, 195, 224–229. [Google Scholar] [CrossRef] [Scilit]
- Han, J.H.; Yang, Y.X.; He, M.; Men, J.H. Effect of zinc on the activities of ATPase of erythrocyte membrane. Wei Sheng Yan Jiu 2001, 30, 47–49. [Google Scholar]
- Xu, T.; Pagadala, V.; Mueller, D.M. Understanding structure, function, and mutations in the mitochondrial ATP synthase. Microb. Cell 2015, 2, 105–125. [Google Scholar] [CrossRef] [Scilit]
- Jerome-Morais, A.; Bera, S.; Rachidi, W.; Gann, P.H.; Diamond, A.M. The effects of selenium and the GPx-1 selenoprotein on the phosphorylation of H2AX. Biochim. Biophys. Acta 2013, 1830, 3399–3406. [Google Scholar] [CrossRef] [Scilit]
- Scheerer, P.; Borchert, A.; Krauss, N.; Wessner, H.; Gerth, C.; Hohne, W.; Kuhn, H. Structural basis for catalytic activity and enzyme polymerization of phospholipid hydroperoxide glutathione peroxidase-4 (GPX4). Biochemistry 2007, 46, 9041–9049. [Google Scholar] [CrossRef] [Scilit]


| Item | 0–7 d | 8–21 d | 22–42 d | 43–63 d |
|---|---|---|---|---|
| Ingredient (%) | ||||
| Corn | 10.32 | 10.63 | 47.18 | 21.27 |
| Wheat middling | 15.41 | 15.00 | 6.89 | 20.00 |
| Wheat bran | - | - | 20.00 | 30.01 |
| Rice noodles | 35.21 | 34.99 | - | 10.00 |
| Rice bran | 15.81 | 15.00 | 3.00 | 5.00 |
| Peanut meal | - | - | 3.00 | 2.37 |
| Corn gluten meal | - | - | 5.00 | - |
| Soybean meal | 12.63 | 13.70 | 5.94 | 2.50 |
| Nucleotide slag | 2.00 | 2.00 | - | - |
| Limestone powder | 1.52 | 1.58 | 1.90 | 1.96 |
| Calcium hydrogen phosphate | 1.10 | 1.10 | 1.01 | 0.84 |
| Compound premix a | 6.00 | 6.00 | 6.00 | 6.00 |
| Formulated nutrient profile (g/kg) | ||||
| Crude protein | 185.00 | 190.00 | 170.00 | 170.00 |
| Crude fat | 20.00 | 30.00 | 35.00 | 35.00 |
| Crude fiber | 60.00 | 50.00 | 70.00 | 70.00 |
| Crude ash | 90.00 | 80.00 | 100.00 | 100.00 |
| Calcium | 10.00 | 10.00 | 10.00 | 10.00 |
| Phosphorus | 5.00 | 5.50 | 4.50 | 4.50 |
| Sodium chloride | 6.00 | 6.00 | 6.00 | 6.00 |
| Methionine | 4.00 | 4.00 | 2.80 | 2.80 |
| Moisture | 140.00 | 130.00 | 130.00 | 130.00 |
| Gene | The Sequence of Primer (5′–3′) | Length (bp) | Tm/°C |
|---|---|---|---|
| TRPM6 | F: TTGCAAGGTGTTGGGGAAAAC | 199 | 60 |
| R: GCCTTTCCATTGTGCAGTCG | |||
| TRPM7 | F: TGATTGATGTGGGGCTGGTT | 124 | 60 |
| R: GCACCAGTGTCAATCCGACT | |||
| ATP1A1 | F: TGAGCCTACTGCAACATCCG | 168 | 60 |
| R: GCAGTAGTCAAACCCCGACT | |||
| ATP1B1 | F: TGTGCTCCCAAGAGAGACGA | 112 | 60 |
| R: GAAGCTTGCCGTAGTAGGGG | |||
| GPX1 | F: ACTTCCTGCAGCTCAACGAG | 103 | 60 |
| R: TTGGTGGCATTCTCCTGGTG | |||
| GPX4 | F: GACAACGCGCAGATTAAGGC | 152 | 60 |
| R: TTTATGGCATTGCCCAGGGT | |||
| ATP6 | F: TTGGCATCCCCCTGATCCTA | 167 | 60 |
| R: GGCTCATTTGTGGCCGTTTT | |||
| ATP8 | F: CCTGACTAACCCTCGCACTC | 114 | 60 |
| R: ATGGTCAGGCTCATGGTGTG | |||
| β-actin | F: GTGCTATGTCGCCCTGGATT | 171 | 60 |
| R: CCACAGGACTCCATACCCAAG |
| Day | 0 d | Day | 21 d | Day | 35 d | ||||||||||||
| Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | |||
| 0 d | Mg | 1 | 21 d | Mg | 1 | 35 d | Mg | 1 | |||||||||
| K | 0.86 ** | 1 | K | 0.86 ** | 1 | K | 0.62 * | 1 | |||||||||
| Se | 0.25 | −0.01 | 1 | Se | −0.40 | −0.40 | 1 | Se | 0.40 | 0.41 | 1 | ||||||
| Zn | 0.39 | 0.17 | 0.10 | 1 | Zn | −0.34 | −0.20 | −0.10 | 1 | Zn | −0.05 | 0.21 | 0.07 | 1 | |||
| Day | 49 d | Day | 63 d | ||||||||||||||
| Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | ||||||||
| 49 d | Mg | 1 | 63 d | Mg | 1 | ||||||||||||
| K | 0.85 * | 1 | K | 0.72 * | 1 | ||||||||||||
| Se | −0.18 | −0.10 | 1 | Se | 0.22 | 0.14 | 1 | ||||||||||
| Zn | −0.63 | −0.20 | 0.52 | 1 | Zn | 0.13 | 0.53 | 0.10 | 1 | ||||||||
| Day | 0 d | Day | 21 d | Day | 35 d | ||||||||||||
| Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | |||
| 0 d | Mg | 1 | 21 d | Mg | 1 | 35 d | Mg | 1 | |||||||||
| K | 0.68 * | 1 | K | 0.76 * | 1 | K | 0.81 ** | 1 | |||||||||
| Se | 0.02 | −0.30 | 1 | Se | −0.12 | −0.63 | 1 | Se | 0.49 | 0.49 | 1 | ||||||
| Zn | −0.10 | −0.60 | 0.36 | 1 | Zn | −0.85 ** | −0.60 | 0.18 | 1 | Zn | 0.17 | 0.39 | 0.74 | 1 | |||
| Day | 49 d | Day | 63 d | ||||||||||||||
| Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | ||||||||
| 49 d | Mg | 1 | 63 d | Mg | 1 | ||||||||||||
| K | 0.81 ** | 1 | K | 0.67 * | 1 | ||||||||||||
| Se | −0.37 | −0.60 * | 1 | Se | 0.17 | 0.30 | 1 | ||||||||||
| Zn | −0.58 | −0.37 | −0.10 | 1 | Zn | −0.46 | −0.40 | 0.50 | 1 | ||||||||
| Day | 0 d | Day | 21 d | Day | 35 d | ||||||||||||
| Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | |||
| 0 d | Mg | 1 | 21 d | Mg | 1 | 35 d | Mg | 1 | |||||||||
| K | 0.76 * | 1 | K | 0.68 * | 1 | K | 0.34 | 1 | |||||||||
| Se | 0.14 | −0.20 | 1 | Se | 0.87 ** | 0.84 ** | 1 | Se | 0.38 | 0.20 | 1 | ||||||
| Zn | 0.15 | 0.07 | −0.60 | 1 | Zn | 0.34 | 0.29 | 0.22 | 1 | Zn | 0.52 | 0.56 | 0.67 * | 1 | |||
| Day | 49 d | Day | 63 d | ||||||||||||||
| Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | ||||||||
| 49 d | Mg | 1 | 63 d | Mg | 1 | ||||||||||||
| K | 0.69 * | 1 | K | 0.73 * | 1 | ||||||||||||
| Se | 0.22 | −0.40 | 1 | Se | −0.30 | 0.10 | 1 | ||||||||||
| Zn | 0.08 | 0.11 | −0.10 | 1 | Zn | 0.87 ** | 0.67 * | 0.10 | 1 | ||||||||
| Day | 0 d | Day | 21 d | Day | 35 d | ||||||||||||
| Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | |||
| 0 d | Mg | 1 | 21 d | Mg | 1 | 35 d | Mg | 1 | |||||||||
| K | 0.68 * | 1 | K | 0.79 ** | 1 | K | 0.71 * | 1 | |||||||||
| Se | 0.61 | 0.87 ** | 1 | Se | 0.30 | 0.28 | 1 | Se | 0.59 | 0.17 | 1 | ||||||
| Zn | 0.21 | 0.63 | 0.68 * | 1 | Zn | 0.41 | 0.22 | −0.10 | 1 | Zn | 0.24 | 0.02 | 0.44 | 1 | |||
| Day | 49 d | Day | 63 d | ||||||||||||||
| Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | ||||||||
| 49 d | Mg | 1 | 63 d | Mg | 1 | ||||||||||||
| K | 0.98 ** | 1 | K | 0.66 * | 1 | ||||||||||||
| Se | 0.58 | 0.65 | 1 | Se | 0.19 | −0.10 | 1 | ||||||||||
| Zn | 0.32 | 0.35 | 0.74 * | 1 | Zn | 0.82 ** | 0.63 | −0.10 | 1 | ||||||||
| Day | 0 d | Day | 21 d | Day | 35 d | ||||||||||||
| Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | |||
| 0 d | Mg | 1 | 21 d | Mg | 1 | 35 d | Mg | 1 | |||||||||
| K | 0.85 * | 1 | K | 0.61 * | 1 | K | 0.59 * | 1 | |||||||||
| Se | 0.18 | 0.37 | 1 | Se | 0.44 | 0.46 | 1 | Se | 0.08 | −0.70 | 1 | ||||||
| Zn | −0.10 | 0.09 | 0.07 | 1 | Zn | −0.10 | −0.96 ** | −0.30 | 1 | Zn | 0.73 | 0.60 | −0.40 | 1 | |||
| Day | 49 d | Day | 63 d | ||||||||||||||
| Element | Mg | K | Se | Zn | Element | Mg | K | Se | Zn | ||||||||
| 49 d | Mg | 1 | 63 d | Mg | 1 | ||||||||||||
| K | 0.51 | 1 | K | 0.81 * | 1 | ||||||||||||
| Se | 0.49 | −0.20 | 1 | Se | 0.71 | 0.79 | 1 | ||||||||||
| Zn | −0.50 | 0.39 | −0.10 | 1 | Zn | 0.71 | 0.88 * | 0.78 | 1 | ||||||||
| Gene | Mineral Elements | |||
|---|---|---|---|---|
| Mg | K | Zn | Se | |
| TRPM6 | −0.806 | - | - | - |
| TRPM7 | −0.424 | - | - | - |
| ATP1A1 | - | −0.957 * | - | - |
| ATP1B1 | - | −0.339 | - | - |
| ATP6 | - | - | −0.671 | - |
| ATP8 | - | - | −0.905 * | - |
| GPX1 | - | - | - | −0.025 |
| GPX4 | - | - | - | −0.496 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, Q.; Zhang, Y.; Bai, H.; Zhong, L.; Li, X.; Zhao, W.; Chang, G.; Chen, G. Mineral Element Deposition and Gene Expression across Different Tissues of Cherry Valley Ducks. Animals 2021, 11, 238. https://doi.org/10.3390/ani11010238
Song Q, Zhang Y, Bai H, Zhong L, Li X, Zhao W, Chang G, Chen G. Mineral Element Deposition and Gene Expression across Different Tissues of Cherry Valley Ducks. Animals. 2021; 11(1):238. https://doi.org/10.3390/ani11010238
Chicago/Turabian StyleSong, Qianqian, Yi Zhang, Hao Bai, Li Zhong, Xiaofan Li, Wenming Zhao, Guobin Chang, and Guohong Chen. 2021. "Mineral Element Deposition and Gene Expression across Different Tissues of Cherry Valley Ducks" Animals 11, no. 1: 238. https://doi.org/10.3390/ani11010238
APA StyleSong, Q., Zhang, Y., Bai, H., Zhong, L., Li, X., Zhao, W., Chang, G., & Chen, G. (2021). Mineral Element Deposition and Gene Expression across Different Tissues of Cherry Valley Ducks. Animals, 11(1), 238. https://doi.org/10.3390/ani11010238

