First Molecular Detection and Characterization of Hemotropic Mycoplasma Species in Cattle and Goats from Uganda
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Study Area
2.3. Study Design
2.4. DNA Extraction and PCR Amplification Procedures for Detection of Hemoplasmas
2.5. Cloning, Sequencing, and Phylogenetic Analysis
2.6. Statistical Analysis
3. Results
3.1. Detection Rates in Cattle and Goats
3.2. Risk Factors
3.3. Identities of Obtained Sequences
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Messick, J.B. Hemotrophic mycoplasmas (hemoplasmas): A review and new insights into pathogenic potential. Vet. Clin. Pathol. 2004, 33, 2–13. [Google Scholar] [CrossRef] [Scilit]
- Maggi, R.G.; Compton, S.M.; Trull, C.L.; Mascarelli, P.E.; Mozayeni, B.R.; Breitschwerdt, E.B. Infection with hemotropic Mycoplasma species in patients with or without extensive arthropod or animal contact. J. Clin. Microbiol. 2013, 51, 3237–3241. [Google Scholar] [CrossRef] [Scilit]
- Neimark, H.; Johansson, K.E.; Rikihisa, Y.; Tully, J.G. Proposal to transfer some members of the genera Haemobartonella and Eperythrozoon to the genus Mycoplasma with descriptions of ‘Candidatus Mycoplasma haemofelis’, ‘Candidatus Mycoplasma haemomuris’, ‘Candidatus Mycoplasma haemosuis’ and ‘Candidatus Mycoplasma wenyonii’. Int. J. Syst. Evol. Microbiol. 2001, 51, 891–899. [Google Scholar]
- Neimark, H.; Johansson, K.E.; Rikihisa, Y.; Tully, J.G. Revision of haemotrophic Mycoplasma species names. Int. J. Syst. Evol. Microbiol. 2002, 52, 683. [Google Scholar] [CrossRef] [Scilit]
- Parker, A.M.; Sheehy, P.A.; Hazelton, M.S.; Bosward, K.L.; House, J.K. A review of Mycoplasma diagnostics in cattle. J. Vet. Intern. Med. 2018, 32, 1241–1252. [Google Scholar] [CrossRef] [Scilit]
- Biondo, A.W.; Santos, A.P.D.; Guimarães, A.M.S.; Vieira, R.F.D.C.; Vidotto, O.; Macieira, D.D.B.; Diáz González, F.H. A review of the occurrence of hemoplasmas (hemotrophic mycoplasmas) in Brazil. Rev. Bras. Parasitol. Vet. 2009, 18, 1–7. [Google Scholar] [CrossRef] [Scilit]
- dos Santos, A.P.; dos Santos, R.P.; Biondo, A.W.; Dora, J.M.; Goldani, L.Z.; De Oliveira, S.T.; Messick, J.B. Hemoplasma infection in HIV-positive patient, Brazil. Emerg. Infect. Dis. 2008, 14, 1922–1924. [Google Scholar] [CrossRef] [Scilit]
- Adler, S.; Ellenbogen, V. A note on two new blood parasites of cattle, Eperythrozoon and Bartonella. J. Comp. Pathol. Ther. 1934, 47, 219–221. [Google Scholar] [CrossRef] [Scilit]
- Tagawa, M.; Matsumoto, K.; Inokuma, H. Molecular detection of Mycoplasma wenyonii and ‘Candidatus Mycoplasma haemobos’ in cattle in Hokkaido, Japan. Vet. Microbiol. 2008, 132, 177–180. [Google Scholar] [CrossRef] [Scilit]
- Hofmann-Lehmann, R.; Meli, M.L.; Dreher, U.M.; Gönczi, E.; Deplazes, P.; Braun, U.; Engels, M.; Schüpbach, J.; Jörger, K.; Thoma, R.; et al. Concurrent infections with vector-borne pathogens associated with fatal hemolytic anemia in a cattle herd in Switzerland. J. Clin. Microbiol. 2004, 42, 3775–3780. [Google Scholar] [CrossRef] [Scilit]
- Baggenstos, R.; Wenzinger, B.; Meli, M.L.; Hofmann-Lehmann, R.; Knubben-Schweizer, G. Haemoplasma infection in a dairy cow. Tierarztl Prax Ausg G Grosstiere Nutztiere 2012, 40, 397–400. [Google Scholar]
- Hornok, S.; Meli, M.L.; Perreten, A.; Farkas, R.; Willi, B.; Beugnet, F.; Hofmann-Lehmann, R. Molecular investigation of hard ticks (Acari: Ixodidae) and fleas (Siphonaptera: Pulicidae) as potential vectors of rickettsial and mycoplasmal agents. Vet. Microbial. 2010, 140, 98–104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, Q.; Wang, L.; Fang, R.; Khan, M.K.; Zhou, Y.; Zhao, J. Detection of Mycoplasma wenyonii in cattle and transmission vectors by the loop-mediated isothermal amplification (LAMP) assay. Trop. Anim. Health. Prod. 2012, 45, 247–250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hornok, S.; Meli, M.L.; Erdős, A.; Hajtós, I.; Lutz, H.; Hofmann-Lehmann, R. Molecular characterization of two different strains of haemotropic mycoplasmas from a sheep flock with fatal haemolytic anaemia and concomitant Anaplasma ovis infection. Vet. Microbiol. 2009, 136, 372–377. [Google Scholar] [CrossRef] [Scilit]
- Tagawa, M.; Takeuchi, T.; Fujisawa, T.; Konno, Y.; Yamamoto, S.; Matsumoto, K.; Inokuma, H.A. A clinical case of severe anemia in a sheep coinfected with Mycoplasma ovis and ‘Candidatus Mycoplasma haemovis’ in Hokkaido, Japan. J. Vet. Med. Sci. 2011, 74, 99–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aktas, M.; Ozubek, S. A molecular survey of small ruminant hemotropic mycoplasmosis in Turkey, including first laboratory confirmed clinical cases caused by Mycoplasma ovis. Vet. Microbiol. 2017, 208, 217–222. [Google Scholar] [CrossRef] [Scilit]
- Daddow, K.N. The transmission of a sheep strain of Eperythrozoon ovis to goats and the development of a carrier state in the goats. Aust. Vet. J. 1979, 55, 605–606. [Google Scholar] [CrossRef] [Scilit]
- Machado, C.A.; Vidotto, O.; Conrado, F.O.; Santos, N.J.; Valente, J.D.; Barbosa, I.C.; Vieira, R.F. Mycoplasma ovis infection in goat farms from northeastern Brazil. Comp. Immunol. Microbiol. Infect. Dis. 2017, 55, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Neimark, H.; Hoff, B.; Ganter, M. Mycoplasma ovis comb. nov. (formerly Eperythrozoon ovis), an epierythrocytic agent of haemolytic anaemia in sheep and goats. Int. J. Syst. Evol. Microbiol. 2004, 54, 365–371. [Google Scholar] [CrossRef] [Scilit]
- Shi, H.; Hu, Y.; Leng, C.; Shi, H.; Jiao, Z.; Chen, X.; Yao, L. Molecular investigation of “Candidatus Mycoplasma haemobos” in goats and sheep in central China. Transbound. Emerg. Dis. 2019, 66, 22–27. [Google Scholar] [CrossRef] [Scilit]
- FAO in Uganda. FAO, Government of Uganda and Stakeholders Commit to Tackling Tick Vector Related Challenges in Uganda. Ticks, Tick Acaricide Resistance and Tick-Borne Diseases of Livestock in Uganda. 2018. Available online: http://www.fao.org/uganda/news/detail-events/fr/c/1151610/ (accessed on 10 September 2020).
- Uganda Bureau of Statistics (UBOS). Agriculture. Livestock in Numbers—Last Updated on 9th November. 2018. Available online: https://www.ubos.org/explore-statistics/2/ (accessed on 10 September 2020).
- Happi, A.N.; Osifade, O.; Oluniyi, P.E.; Ogunro, B.N. Comparison of light microscopy and polymerase chain reaction for the detection of Haemoparasites in Cattle in Nigeria. Acta Parasitol. 2020, 65, 44–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonçalves, L.R.; Teixeira, M.M.G.; Rodrigues, A.C.; Mendes, N.S.; Matos, C.A.; Pereira, C.L.; André, M.R. Molecular detection of Bartonella species and haemoplasmas in wild African buffalo (Syncerus caffer) in Mozambique, Africa. Parasitol. Open. 2018, 4, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Jensen, W.A.; Lappin, M.R.; Kamkar, S.; Reagan, W.J. Use of a polymerase chain reaction assay to detect and differentiate two strains of Haemobartonella felis in naturally infected cats. Am. J. Vet. Res. 2001, 62, 604–608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Criado-Fornelio, A.; Martinez-Marcos, A.; Buling-Sarana, A.; Barba-Carretero, J.C. Presence of Mycoplasma haemofelis, Mycoplasma haemominutum and piroplasmids in cats from southern Europe: A molecular study. Vet. Microbiol. 2003, 93, 307–317. [Google Scholar] [CrossRef] [Scilit]
- Galon, E.M.S.; Adjou Moumouni, P.F.; Ybanez, R.H.D.; Macalanda, A.M.C.; Liu, M.; Efstratiou, A.; Li, J. Molecular evidence of hemotropic mycoplasmas in goats from Cebu, Philippines. J. Vet. Med. Sci. 2019, 81, 869–873. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Díaz-Sánchez, A.A.; Corona-González, B.; Meli, M.L.; Álvarez, D.O.; Cañizares, E.V.; Rodríguez, O.F.; Hofmann-Lehmann, R. First molecular evidence of bovine hemoplasma species (Mycoplasma spp.) in water buffalo and dairy cattle herds in Cuba. Parasit. Vectors. 2019, 12, 78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Witter, R.; Melo, A.L.T.; Pacheco, T.D.A.; Meneguzzi, M.; Boas, R.V.; Dutra, V.; Pacheco, R.C. Prevalence of ‘Candidatus Mycoplasma haemobos’ detected by PCR, in dairy cattle from Ji-Paraná in the north region of Brazil. Cienc. Rural 2017, 47, 1678–4596. [Google Scholar] [CrossRef] [Scilit]
- Tagawa, M.; Ybanez, A.P.; Matsumoto, K.; Yokoyama, N.; Inokuma, H. Prevalence and risk factor analysis of bovine hemoplasma infection by direct PCR in Eastern Hokkaido, Japan. J. Vet. Med. Sci. 2012, 74, 1171–1176. [Google Scholar] [CrossRef] [Scilit]
- Johnson, K.A.; do Nascimento, N.C.; Bauer, A.E.; Weng, H.Y.; Hammac, G.K.; Messick, J.B. Detection of hemoplasma infection of goats by use of a quantitative polymerase chain reaction assay and risk factor analysis for infection. Am. J. Vet. Res. 2016, 77, 882–889. [Google Scholar] [CrossRef] [Scilit]
- Tagawa, M.; Yamakawa, K.; Aoki, T.; Matsumoto, K.; Ishii, M.; Inokuma, H. Effect of chronic hemoplasma infection on cattle productivity. J. Vet. Med. Sci. 2013, 75, 1271–1275. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Cui, Y.; Zhang, Y.; Shi, K.; Yan, Y.; Jian, F.; Ning, C. Molecular characterization of hemotropic mycoplasmas (Mycoplasma ovis and ‘Candidatus Mycoplasma haemovis’) in sheep and goats in China. BMC Vet. Res. 2017, 13, 142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Urie, N.J.; Highland, M.A.; Knowles, D.P.; Branan, M.A.; Herndon, D.R.; Marshall, K.L. Mycoplasma ovis infection in domestic sheep (Ovis aries) in the United States: Prevalence, distribution, associated risk factors, and associated outcomes. Prev. Vet. Med. 2019, 171, 104750. [Google Scholar] [CrossRef] [Scilit]
- de Oliveira Conrado, F.; do Nascimento, N.C.; dos Santos, A.P.; Zimpel, C.K.; Messick, J.B.; Biondo, A.W. Occurrence and identification of hemotropic mycoplasmas (Hemoplasmas) in free ranging and laboratory rats (Rattus norvegicus) from two Brazilian zoos. BMC Vet. Res. 2015, 11, 1–10. [Google Scholar]
- Meunier, N.V.; Sebulime, P.; White, R.G.; Kock, R. Wildlife-livestock interactions and risk areas for cross-species spread of bovine tuberculosis. Onderstepoort J. Vet. Res. 2017, 84, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tagawa, M.; Matsumoto, K.; Yokoyama, N.; Inokuma, H. Prevalence and molecular analyses of hemotrophic Mycoplasma spp. (hemoplasmas) detected in sika deer (Cervus nippon yesoensis) in Japan. J. Vet. Med. Sci. 2014, 76, 401–407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sykes, J.E.; Lindsay, L.L.; Maggi, R.G.; Breitschwerdt, E.B. Human coinfection with Bartonella henselae and two hemotropic mycoplasma variants resembling Mycoplasma ovis. J. Clin. Microbiol. 2010, 48, 3782–3785. [Google Scholar] [CrossRef] [Scilit]


| Organism | Target Gene | Primer Sequence (5′→3′) | Annealing Temperature (°C) | Amplicon Size (bp) | Reference |
|---|---|---|---|---|---|
| Mycoplasma spp. (HBT) | 16S rRNA | ATACGGCCCATATTCCTACG | 60 | 595 | [26] |
| TGCTCCACCACTTGTTCA | |||||
| Mycoplasma spp. (F2R2) | 16S rRNA | CGAAAGTCTGATGGAGCAATA | 60 | 170–-195 | [25] |
| CGCCCAATAAATCCGR(A/G)ATAAT |
| Host | N | No. of Positives (%) | p-Value |
|---|---|---|---|
| Cattle | 208 | 67 (32.2%) | 0.019 |
| Goats | 201 | 88 (43.8%) | |
| Total | 409 | 155 (37.9%) |
| N | No. of Positives (%) | p-Value | ||
|---|---|---|---|---|
| Sex | Female cattle | 193 | 58 (30.1%) | 0.017 |
| Male cattle | 15 | 6 (40.0%) | ||
| Total | 208 | 64 (30.8%) | ||
| Cattle | Karusandara subcounty | 113 | 39 (34.5%) | 0.459 |
| Kichwamba subcounty | 95 | 28 (29.5%) | ||
| Total | 208 | 67 (32.2%) | ||
| Goats | Karusandara subcounty | 103 | 56 (54.3%) | 0.002 |
| Kichwamba subcounty | 98 | 32 (32.6%) | ||
| Total | 201 | 88 (43.8%) |
| Pathogen | Host | GenBank Accession Numbers |
|---|---|---|
| Candidatus Mycoplasma haemobos | Cattle | CMh1-7 |
| Mycoplasma wenyonii | Cattle | Mw1-6 |
| Candidatus Mycoplasma erythrocervae | Goat | CMe1 |
| Mycoplasma ovis | Goat | Mo1-8 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Byamukama, B.; Tumwebaze, M.A.; Tayebwa, D.S.; Byaruhanga, J.; Angwe, M.K.; Li, J.; Galon, E.M.; Liu, M.; Li, Y.; Ji, S.; et al. First Molecular Detection and Characterization of Hemotropic Mycoplasma Species in Cattle and Goats from Uganda. Animals 2020, 10, 1624. https://doi.org/10.3390/ani10091624
Byamukama B, Tumwebaze MA, Tayebwa DS, Byaruhanga J, Angwe MK, Li J, Galon EM, Liu M, Li Y, Ji S, et al. First Molecular Detection and Characterization of Hemotropic Mycoplasma Species in Cattle and Goats from Uganda. Animals. 2020; 10(9):1624. https://doi.org/10.3390/ani10091624
Chicago/Turabian StyleByamukama, Benedicto, Maria Agnes Tumwebaze, Dickson Stuart Tayebwa, Joseph Byaruhanga, Martin Kamilo Angwe, Jixu Li, Eloiza May Galon, Mingming Liu, Yongchang Li, Shengwei Ji, and et al. 2020. "First Molecular Detection and Characterization of Hemotropic Mycoplasma Species in Cattle and Goats from Uganda" Animals 10, no. 9: 1624. https://doi.org/10.3390/ani10091624
APA StyleByamukama, B., Tumwebaze, M. A., Tayebwa, D. S., Byaruhanga, J., Angwe, M. K., Li, J., Galon, E. M., Liu, M., Li, Y., Ji, S., Moumouni, P. F. A., Ringo, A., Lee, S.-H., Vudriko, P., & Xuan, X. (2020). First Molecular Detection and Characterization of Hemotropic Mycoplasma Species in Cattle and Goats from Uganda. Animals, 10(9), 1624. https://doi.org/10.3390/ani10091624

