Antioxidative Potential of Red Deer Embryos Depends on Reproductive Stage of Hind as a Oocyte Donor
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Oocyte Collection
2.2. In vitro Oocyte Maturation
2.3. Semen Collection, Cryopreservation, and Preparation for in vitro Fertilization
2.4. In vitro Fertilization
2.5. Sample Collection
2.6. Experimental Design
2.6.1. Preliminary Experiment. Concentration of Progesterone and 17-Beta Estradiol in the Blood Plasma
2.6.2. Experiment 1. Microscopic Evaluation of IVF Effectivity, Blastocyst Quality and Development Depending on the Reproductive Status of Hinds
Microscopic Evaluation of IVF Effectivity and Blastocyst Quality
Determination of the mRNA Expression of BCL-2, BAX, PLAC8, OCT4, and SOX2
2.6.3. Experiment 2. Comparison of the Antioxidative Potential of Red Deer Embryos during the Luteal and Follicular Stage of the Estrous Cycle and Pregnancy
2.7. Determinations
2.7.1. RNA Isolation and Reverse Transcription
2.7.2. PCR Amplification
2.7.3. Antioxidative Activity of Embryos
2.7.4. Steroid Concentration
2.8. Statistical Analyses
3. Results
3.1. Preliminary Results. Concentration of Progesterone and 17-Beta Estradiol in Blood Plasma
3.2. Experiment 1. Microscopic Evaluation of IVF Effectivity, Blastocyst Quality and Development Depending on the Reproductive Status of Hinds
3.2.1. Microscopic Evaluation of IVF Effectivity and Blastocyst Quality
3.2.2. Determination of the mRNA Expression of BCL-2, BAX, PLAC8, OCT4, and SOX2
3.3. Experiment 2. Comparison of the Antioxidative Potential of Red Deer Embryos during the Luteal and Follicular Stage of the Estrous Cycle and Pregnancy
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Zachos, F.E.; Hartl, G. Phylogeography, population genetics and conservation of the European red deer. Cervus Elaphus Mammal Rev. 2011, 41, 138–150. [Google Scholar] [CrossRef]
- Griffiths, W.M.; Stevens, D.R.; Archer, J.A.; Asher, G.W.; Littlejohn, R.P. Evaluation of management variables to advance conception and calving date of red deer (Cervus elaphus) in New Zealand venison production systems. Anim. Reprod. Sci. 2010, 118, 279–296. [Google Scholar] [CrossRef] [PubMed]
- Asher, G.W.; Pearse, A.J. Managing reproductive performance of farmed deer: The key to productivity. In Proceedings of the Third World Deer Farming Congress, Austin, TX, USA, 20–23 February 2002; pp. 99–112. [Google Scholar]
- Iniesta-Cuerda, M.; Sánchez-Ajofrín, I.; García-Álvarez, O.; Martín-Maestro, A.; Peris-Frau, P.; Ortiz, J.A.; Fernández-Santos, M.R.; Garde, J.J.; Soler, A.J. Influence of foetal calf serum supplementation during in vitro embryo culture in Iberian red deer. Reprod. Domest. Anim. 2019, 54, 69–71. [Google Scholar] [CrossRef] [PubMed]
- Berg, D.K.; Thongphakdee, A. In Vitro Culture of Deer Embryos. Methods. Mol. Biol. 2006, 191–207. [Google Scholar] [CrossRef]
- Sánchez-Ajofrín, I.; Iniesta-Cuerda, M.; Sánchez-Calabuig, M.J.; Peris-Frau, P.; Martín-Maestro, A.; Ortiz, J.A.; Del Rocío Fernández-Santos, M.; Garde, J.J.; Gutiérrez-Adán, A.; Soler, A.J. Oxygen tension during in vitro oocyte maturation and fertilization affects embryo quality in sheep and deer. Anim. Reprod. Sci. 2020, 213, 106279. [Google Scholar] [CrossRef]
- Blaxter, K.L.; Hamilton, W.J. Reproduction in farmed red deer. J. Agric. Sci. 1980, 95, 261–273. [Google Scholar] [CrossRef]
- Lincoln, G.A.; Short, R.V. Seasonal breeding: Nature’s contraceptive. Recent Prog. Horm. Res. 1980, 36, 1–52. [Google Scholar] [CrossRef]
- Karsch, F.J.; Dahl, G.E.; Evans, N.P.; Manning, J.M.; Mayfield, K.P.; Moenter, S.M.; Foster, D.L. Seasonal changes in gonadotropin-releasing hormone secretion in the ewe: Alteration in response to the negative feedback action of estradiol. Biol. Reprod. 1993, 49, 1377–1383. [Google Scholar] [CrossRef]
- Legan, S.J.; Karsch, F.J. Neuroendocrine regulation of the estrous cycle and seasonal breeding in the ewe. Biol. Reprod. 1979, 20, 74–85. [Google Scholar] [CrossRef]
- Bartlewski, P.M.; Beard, A.P.; Cook, S.J.; Rawlings, N.C. Ovarian follicular dynamics during anoestrus in ewes. J. Reprod. Fertil. 1998, 113, 275–285. [Google Scholar] [CrossRef] [PubMed]
- Fennessy, P.F.; Mackintosh, C.G.; Shackell, G.H. Artificial insemination of farmed red deer (Cervus elaphus). Anim. Prod. 1990, 51, 613–621. [Google Scholar] [CrossRef]
- Van Soom, A.; Mateusen, B.; Leroy, J.; De Kruif, A. Assessment of mammalian embryo quality: What can we learn from embryo morphology? Reprod. Biomed. Online 2003, 7, 664–670. [Google Scholar] [CrossRef]
- Boruszewska, D.; Sinderewicz, E.; Kowalczyk-Zieba, I.; Grycmacher, K.; Woclawek-Potocka, I. The effect of lysophosphatidic acid during in vitro maturation of bovine cumulus-oocyte complexes: Cumulus expansion, glucose metabolism and expression of genes involved in the ovulatory cascade, oocyte and blastocyst competence. Reprod. Biol. Endocrinol. 2015, 16, 13–44. [Google Scholar] [CrossRef] [PubMed]
- Gupta, M.K.; Uhm, S.J.; Lee, H.T. Sexual maturity and reproductive phase of oocyte donor influence the developmental ability and apoptosis of cloned and parthenogenetic porcine embryos. Anim. Reprod. Sci. 2008, 108, 107–121. [Google Scholar] [CrossRef] [PubMed]
- Sugimura, S.; Akai, T.; Hashiyada, Y.; Aikawa, Y.; Ohtake, M.; Matsuda, H.; Kobayashi, S.; Kobayashi, E.; Konishi, K.; Imai, K. Effect of embryo density on in vitro development and gene expression in bovine in vitro-fertilized embryos cultured in a microwell system. J. Reprod. Dev. 2013, 59, 115–122. [Google Scholar] [CrossRef]
- Matwee, C.; Betts, D.H.; King, W.A. Apoptosis in the early bovine embryo. Zygote 2000, 8, 57–68. [Google Scholar] [CrossRef]
- Brill, A.; Torchinsky, A.; Carp, H.; Toder, V. The role of apoptosis in normal and abnormal embryonic development. J. Assist. Reprod. Genet. 1999, 16, 512–519. [Google Scholar] [CrossRef]
- Emanuelli, I.P.; Costa, C.B.; Marinho, L.S.R.; Seneda, M.M.; Meirelles, F.V. Cumulus-oocyte interactions and programmed cell death in bovine embryos produced in vitro. Theriogenology 2019, 126, 81–87. [Google Scholar] [CrossRef]
- Sugino, N. Reactive oxygen species in ovarian physiology. Reprod. Med. Biol. 2005, 4, 31–44. [Google Scholar] [CrossRef]
- Saeed-Zidane, M.; Linden, L.; Salilew-Wondim, D.; Held, E.; Neuhoff, C.; Tholen, E.; Hoelker, M.; Schellander, K.; Tesfaye, D. Cellular and exosome mediated molecular defense mechanism in bovine granulosa cells exposed to oxidative stress. PLoS ONE 2017, 12, e0187569. [Google Scholar] [CrossRef]
- Combelles, C.M.; Gupta, S.; Agarwal, A. Could oxidative stress influence the in-vitro maturation of oocytes? Reprod. Biomed. Online 2009, 18, 864–880. [Google Scholar] [CrossRef]
- Dallemagne, M.; Ghys, E.; De Schrevel, C.; Mwema, A.; De Troy, D.; Rasse, C.; Donnay, I. Oxidative stress differentially impacts male and female bovine embryos depending on the culture medium and the stress condition. Theriogenology 2018, 1, 49–56. [Google Scholar] [CrossRef] [PubMed]
- Cagnone, G.L.; Sirard, M.A. Transcriptomic signature to oxidative stress exposure at the time of embryonic genome activation in bovine blastocysts. Mol. Reprod. Dev. 2013, 80, 297–314. [Google Scholar] [CrossRef]
- Gaspar, R.C.; Arnold, D.R.; Correa, C.A.; da Rocha, C.V.; Penteado, J.C.; Del Collado, M.; Vantini, R.; Garcia, A.J.; Landete-Castillejos, T.; Gomez-Brunet, A.; et al. Characteristics of the oestrous cycle of Iberian red deer (Cervus elaphus hispanicus) assessed by progesterone profiles. J. Exp. Zool. A Comp. Exp. Biol. 2003, 1, 143–149. [Google Scholar] [CrossRef]
- Feugang, J.M.; Van Langendonckt, A.; Sayoud, H.; Rees, J.F.; Pampfer, S.; Moens, A.; Dessy, F.; Donnay, I. Effect of prooxidant agents added at the morula/blastocyst stage on bovine embryo development, cell death and glutathione content. Zygote 2003, 11, 107–118. [Google Scholar] [CrossRef]
- Bhabak, K.P.; Mugesh, G. Functional mimics of glutathione peroxidase: Bioinspired synthetic antioxidants. Acc. Chem. Res. 2010, 16, 1408–1419. [Google Scholar] [CrossRef]
- Nozik-Grayck, E.; Suliman, H.B.; Piantadosi, C.A. Extracellular superoxide dismutase. Int. J. Biochem. Cell. Biol. 2005, 37, 2466–2471. [Google Scholar] [CrossRef]
- Haigh, J.C.; Bowen, G. Artificial insemination of red deer (Cervus elaphus) with frozen-thawed wapiti semen. J. Reprod. Fertil. 1991, 93, 119–123. [Google Scholar] [CrossRef]
- Boruszewska, D.; Grycmacher, K.; Kowalczyk-Zieba, I.; Sinderewicz, E.; Staszkiewicz-Chodor, J.; Woclawek-Potocka, I. Expression of enzymes involved in the synthesis of prostaglandin E2 in early- and late-cleaved bovine embryos at different stages of preimplantation development. Theriogenology 2019, 15, 45–55. [Google Scholar] [CrossRef]
- Demianowicz, W.; Gizejewski, Z.; Kubiak, D.; Kowalski, R.; Glogowski, J. Doskonalenie kriokonserwacji nasienia jelenia szlachetnego pobranego metodą sztucznej pochwy. Med. Wet. 2008, 64, 608–612. [Google Scholar]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
- Primer 3 Based Software. Available online: http://bioinfo.ut.ee/primer3/ (accessed on 14 July 2020).
- Korzekwa, A.J.; Szczepańska, A.; Bogdaszewski, M.; Nadolski, P.; Malż, P.; Giżejewski, Z. Production of prostaglandins in placentae and corpus luteum in pregnant hinds of red deer (Cervus elaphus). Theriogenology 2016, 85, 762–768. [Google Scholar] [CrossRef] [PubMed]
- De Roover, R.; Feugang, J.M.; Bols, P.E.; Genicot, G.; Hanzen, C. Effects of ovum pick-up frequency and FSH stimulation: A retrospective study on seven years of beef cattle in vitro embryo production. Reprod. Domest. Anim. 2008, 43, 239–245. [Google Scholar] [CrossRef] [PubMed]
- Soler, J.P.; Mucci, N.; Kaiser, G.G.; Aller, J.; Hunter, J.W.; Dixon, T.E.; Alberio, R.H. Multiple ovulation and embryo transfer with fresh, frozen and vitrified red deer (Cervus elaphus) embryos in Argentina. Anim. Reprod. Sci. 2007, 102, 322–327. [Google Scholar] [CrossRef] [PubMed]
- Asher, G.W.; Scott, I.C.; O’Neill, K.T.; Smith, J.F.; Inskeep, E.K.; Townsend, E.C. Ultrasonographic monitoring of antral follicle development in red deer (Cervus elaphus). J. Reprod. Fertil. 1997, 111, 91–99. [Google Scholar] [CrossRef]
- Ireland, J.J.; Smith, G.W.; Scheetz, D.; Jimenez-Krassel, F.; Folger, J.K.; Ireland, J.L.; Mossa, F.; Lonergan, P.; Evans, A.C. Does size matter in females? An overview of the impact of the high variation in the ovarian reserve on ovarian function and fertility, utility of anti-Müllerian hormone as a diagnostic marker for fertility and causes of variation in the ovarian reserve in cattle. Reprod. Fertil. Dev. 2011, 23, 1–14. [Google Scholar] [CrossRef]
- Sakaguchi, K.; Tanida, T.; Abdel-Ghani, M.A.; Kanno, C.; Yanagawa, Y.; Katagiri, S.; Nagano, M. Relationship between the antral follicle count in bovine ovaries from a local abattoir and steroidogenesis of granulosa cells cultured as oocyte-cumulus-granulosa complexes. J. Reprod. Dev. 2018, 64, 503–510. [Google Scholar] [CrossRef]
- Davachi, N.D.; Shahneh, A.Z.; Kohram, H.; Zhandi, M.; Dashti, S.; Shamsi, H.; Moghadam, R. In vitro ovine embryo production: The study of seasonal and oocyte recovery method effects. Iran. Red Crescent Med. J. 2014, 16, e20749. [Google Scholar] [CrossRef]
- Locatelli, Y.; Vallet, J.C.; Huyghe, F.P.; Cognié, Y.; Legendre, X.; Mermillod, P. Laparoscopic ovum pick-up and in vitro production of sika deer embryos: Effect of season and culture conditions. Theriogenology 2006, 66, 1334–1342. [Google Scholar] [CrossRef]
- Gutiérrez-Adán, A.; Rizos, D.; Fair, T.; Moreira, P.N.; Pintado, B.; de la Fuente, J.; Boland, M.P.; Loner-Gan, P. Effect of speed of development on mRNA expression pattern in early bovine embryos cultured in vivo or in vitro. Mol. Reprod. Dev. 2004, 68, 441–448. [Google Scholar] [CrossRef]
- Munoz, M.; Rodrıguez, A.; De Frutos, C.; Caamano, J.N.; Dıez, C.; Facal, N.; Gomez, E. Conventional pluripotency markers are unspecific for bovine embryonic-derived cell-lines. Theriogenology 2008, 69, 1159–1164. [Google Scholar] [CrossRef]
- Lee, K.C.; Wong, W.K.; Feng, B. Decoding the Pluripotency Network: The Emergence of New Transcription Factors. Biomedicines 2013, 16, 49–78. [Google Scholar] [CrossRef] [PubMed]
- Sanna, D.; Sanna, A.; Mara, L.; Pilichi, S.; Mastinu, A.; Chessa, F.; Pani, L.; Dattena, M. Oct4 expression in in-vitro-produced sheep blastocysts and embryonic-stem-like cells. Cell Biol. Int. 2009, 1, 53–60. [Google Scholar] [CrossRef] [PubMed]
- Rekik, W.; Dufort, I.; Sirard, M.A. Analysis of the gene expression pattern of bovine blastocysts at three stages of development. Mol. Reprod. Dev. 2011, 78, 226–240. [Google Scholar] [CrossRef] [PubMed]
- Pang, Y.; Zhao, S.; Sun, Y.; Jiang, X.; Hao, H.; Du, W.; Zhu, H. Protective effects of melatonin on the in vitro developmental competence of bovine oocytes. Anim. Sci. J. 2018, 89, 648–660. [Google Scholar] [CrossRef]
- Abecia, J.A.; Forcada, F.; Zúñiga, O. The effect of melatonin on the secretion of progesterone in sheep and on the development of ovine embryos in vitro. Vet. Res. Commun. 2002, 26, 151–158. [Google Scholar] [CrossRef]
- Paszkowski, T.; Clarke, R.N. Antioxidative capacity of preimplantation embryo culture medium declines following the incubation of poor quality embryos. Hum. Reprod. 1996, 11, 2493–2495. [Google Scholar] [CrossRef]




| Gene | Oligonucleotide Sequences | Product Size (bp) | GeneBank |
|---|---|---|---|
| GPX | CCACTGGCAGGAACTTTGAT-3′ TTCCTCTTCAGGGATGGTTG-3′ | 137 | AF080228.1 |
| MnSOD | TCCTGTTCAATCGCAGTTACAGA-3′ ACGGGGTGGTGACTATCAGA-3′ | 162 | NM_201527.2 |
| CuSOD | ACACAAGGCTGTACCAGTGC-3′ TGTCACATTGCCCAGGTCTC-3′ | 105 | NM_174615.2 |
| ACTB | CCAAGGCCAACCGTGAGAAAAT-3′ CCACATTCCGTGAGGATCTTCA-3′ | 256 | K00622 |
| RN18S | AAGTCTTTGGGTTCCGGG-3′ GGACATCTAAGGGCATCACA-3′ | 365 | AF176811 |
| GAPDH | CACCCTCAAGATTGTCAGCA-3′ GGTCATAAGTCCCTCCACGA-3′ | 103 | BC102589 |
| BAX | GTGCCCGAGTTGATCAGGAC CCATGTGGGTGTCCCAAAGT | 126 | NM_173894.1 |
| BCL2 | GAGTTCGGAGGGGTCATGTG GCCTTCAGAGACAGCCAGGA | 203 | NM_001166486.1 |
| SOX2 | TGGATCGGCCAGAAGAGGAG CAGGCGAAGAATAATTTGGGGG | 89 | NM_001105463.2 |
| OCT4 | GAGAAAGACGTGGTCCGAGTG GACCCAGCAGCCTCAAAATC | 101 | NM_174580.2 |
| PLAC8 | TTTACCGCTCTGTGCCCTTT CCATGTGAACTTGACCAAGCAT | 95 | NM_001025325.2 |
| Experimental Groups—Ovaries Collected from Hinds: | Total Number of Collected Oocytes | Total COCs Number | Total Number of Blastocysts/ Development Rate | Number of Blastocysts Collected on Particular Days Post in vitro Fertilization |
|---|---|---|---|---|
| 4th day of the cycle (n = 6) | 165 | 84 | 36 21.82 % | Day 6th – 17 Day 7th – 7 Day 8th – 7 Day 9th – 5 |
| 13th day of the cycle (n = 6) | 182 | 72 | 24 13.19 % | Day 6 – 7 Day 7 – 5 Day 8 – 11 Day 9 – 1 |
| pregnant (n = 6) | 57 | 48 | 7 12,28 % | Day 5 – 3 Day 6 –2 Day 7 – 1 Day 8 – 1 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Korzekwa, A.J.; Kotlarczyk, A.M.; Szczepańska, A.A.; Grzyb, M.; Siergiej, A.; Wocławek-Potocka, I. Antioxidative Potential of Red Deer Embryos Depends on Reproductive Stage of Hind as a Oocyte Donor. Animals 2020, 10, 1190. https://doi.org/10.3390/ani10071190
Korzekwa AJ, Kotlarczyk AM, Szczepańska AA, Grzyb M, Siergiej A, Wocławek-Potocka I. Antioxidative Potential of Red Deer Embryos Depends on Reproductive Stage of Hind as a Oocyte Donor. Animals. 2020; 10(7):1190. https://doi.org/10.3390/ani10071190
Chicago/Turabian StyleKorzekwa, Anna J., Angelika M. Kotlarczyk, Agata A. Szczepańska, Martyna Grzyb, Alicja Siergiej, and Izabela Wocławek-Potocka. 2020. "Antioxidative Potential of Red Deer Embryos Depends on Reproductive Stage of Hind as a Oocyte Donor" Animals 10, no. 7: 1190. https://doi.org/10.3390/ani10071190
APA StyleKorzekwa, A. J., Kotlarczyk, A. M., Szczepańska, A. A., Grzyb, M., Siergiej, A., & Wocławek-Potocka, I. (2020). Antioxidative Potential of Red Deer Embryos Depends on Reproductive Stage of Hind as a Oocyte Donor. Animals, 10(7), 1190. https://doi.org/10.3390/ani10071190

