Next Article in Journal
Using Owner Return as a Reinforcer to Operantly Treat Separation-Related Problem Behavior in Dogs
Next Article in Special Issue
Reproductive Diseases in Farmed Rabbit Does
Previous Article in Journal
Identification of Sarcocystis spp. in One-humped Camels (Camelus dromedarius) from Riyadh and Dammam, Saudi Arabia, via Histological and Phylogenetic Approaches
Previous Article in Special Issue
Causes of Mortality and Disease in Rabbits and Hares: A Retrospective Study
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Marked Presence of Methicillin-Resistant Staphylococcus aureus in Wild Lagomorphs in Valencia, Spain

1
Biomedical Research Institute (PASAPTA-Pathology group), Facultad de Veterinaria, Universidad Cardenal Herrera-CEU, CEU Universities, C/Tirant lo Blanc 7, 46115 Alfara del Patriarca, Valencia, Spain
2
Servicio de Análisis, Investigación, Gestión de Animales Silvestres (SAIGAS), Facultad de Veterinaria, Universidad Cardenal Herrera-CEU, CEU Universities, C/Tirant lo Blanc 7, 46115 Alfara del Patriarca, Valencia, Spain
3
Wildlife Ecology & Health group (WE&H), Universitat Autònoma de Barcelona (UAB), Edifici V, Travessera del Turons, 08193 Bellaterra, Barcelona, Spain
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Animals 2020, 10(7), 1109; https://doi.org/10.3390/ani10071109
Submission received: 19 May 2020 / Revised: 21 June 2020 / Accepted: 26 June 2020 / Published: 29 June 2020
(This article belongs to the Special Issue Disease and Immunology of Rabbits)

Abstract

Simple Summary

The presence of bacteria resistant to antibiotics, such as Staphylococcus aureus resistant to methicillin (MRSA), is becoming an increasing everyday concern for their implications for human and animal health. This is even more alarming when such bacteria are isolated in wild animals which, in principle, should not come into contact with antibiotics. This work studied 353 rabbits and 10 hares hunted in rabbit high-density areas. Of these, 41.3% carried S. aureus in some sampled locations, of which 63.3% were MRSA. These are surprising results given the unexpected high presence of MRSA in the studied animals. This finding is very worrying because these animals tend to enter the food chain with no veterinary control, which implies a risk for human health. Thus it is necessary to extend this study to other, less-populated areas with other animal species (ruminants, rabbit predators, hunting dogs, etc.) or even water sources to obtain further knowledge about the origin of bacterial resistances in nature.

Abstract

The appearance of methicillin-resistant strains of Staphylococcus aureus (MRSA) in several animal species (including rabbits) has set off alarms for their capacity to act as reservoirs for this bacterium. This is especially important in wild animals given its epidemiological implications. The objectives of this study were to identify and characterize S. aureus, specifically MRSA, strains in wild lagomorph high-density areas. Ten hares and 353 wild rabbits from 14 towns with a high rabbit density in the Valencian region (eastern Spanish coast) were sampled. Swabs from the nasal cavity, ears, perineum and lesions (when present) were taken for microbiological studies. The detection of different genes and antibiotic susceptibility studies were also carried out. Of all the animals, 41.3% were positive for S. aureus, of which 63.3% were MRSA. Ears were the anatomical location with more S. aureus and MRSA strains. The more frequently identified MLST type was ST1945 (97.1%, 136/140). The mecA gene was found only in one sample. The rest (n = 139) carried the mecC gene and were included in CC130, except one. Penicillin resistance was detected in 28 mec-negative isolates and, in one case, bacitracin resistance. mecA isolate presented resistance to enrofloxacin and tetracycline, and 10 mecC isolates also showed bacitracin resistance. No MRSA isolate was positive for genes chp, sea, tst and PVL. Two ST1945 isolates contained IEC type E (comprising genes scn and sak). mecA-isolate was positive for blaZ. Of the 28 MSSA strains showing resistance to penicillin, 22 carried the blaZ gene. These surprising results highlight the marked presence of MRSA strains in wild rabbits in high-density areas.

1. Introduction

Staphylococcus aureus is a widely distributed bacterium in nature and is often considered a frequent host of skin [1] and mucous, mainly in the nasal cavity [2]. Studies have shown that about 20% of humans are persistent nasal carriers of S. aureus, and around 30% are intermittent carriers [2]. The percentage of nasal carriers reported in different animal species varies: 7.9% in horses [3], 29% in ewes [4] and 32.1–53% in rabbits [5,6]. Asymptomatic nasal carriers play a key role in the epidemiology and control of staphylococcal diseases, as the nasal cavity allows bacteria to persist over time and to multiply, which constitutes a source of infection [2]. In human medicine, the main problem caused by S. aureus occurs in hospitals, with the most important cause of not only nosocomial infections [7], but also community-acquired infection [8]. S. aureus is also a major pathogen in veterinary medicine that affects various animal species. In commercial rabbits, it has been signaled as one of the main causes of culling on farms [9,10]. In these cases, staphylococcal infections in rabbitries are caused by the international dissemination of the ST121 lineage of S. aureus, and other less frequent lineages like ST96 [11,12].
The increase in bacterial resistance to antibiotics in recent years has become a serious health problem. S. aureus is perfectly capable of acquiring multiple resistance mechanisms to several antimicrobial agents [13,14], which limits their therapeutic effectiveness. One of the most important ones for its clinical repercussions is resistance to methicillin. Methicillin-resistant Staphylococcus aureus (MRSA) evolved from Methicillin-susceptible Staphylococcus aureus (MSSA) by acquiring SSCmec elements containing a mec gene (mecA, mecC), which encodes a protein with a low affinity for β-lactam antibiotics [15].
In animals, livestock-associated MRSA (LA-MRSA) emerged in pigs in 2005 [16] and was later described in other animal species. The most widely related clonal complex (CC) to LA-MRSA is CC398. This CC was also isolated from farmers who had been in close contact with infected animals [17], which indicates that this clone plays an important role as a reservoir of transmission to humans [18]. Therefore, special attention has been paid to the colonization of animals with S. aureus because they may potentially act as a reservoir to humans [15,19,20].
Rabbits are among the animal species in which LA-MRSA CC398 strains have been isolated. The first case in rabbits was reported on a commercial farm in Italy, which also involved farm workers and their families [21]. Recently, LA-MRSA strains have been described to belong to ST2855 (CC96), ST146 (CC5), ST398 (CC398) and ST4774 (CC130) from several rabbitries of the Iberian Peninsula [22]. These CC have been related to illness in humans [18,23,24,25,26].
MRSA strains have been isolated in human hospitals and on animal farms where antibiotics are regularly used. These antibiotic-resistant organisms can spread to communities and the environment [27]. Therefore, free-living animals might be colonized or infected by human and livestock sources, and can be associated with contaminated environments, even though they do not directly come into contact with antimicrobial drugs [28].
In recent studies, a high S. aureus carriage rate has been detected in wild animals, including European wild rabbits. The most relevant finding was that all the isolates were MRSA [29], which suggests a wildlife MRSA reservoir. Additionally MRSA, belonging to CC130, has been detected in diseased European brown hares (Lepus europaeus) [30,31].
The wild rabbit (Oryctolagus cuniculus) is an extremely abundant endemic species of the Iberian Peninsula in some areas, where conservation of endangered predators is essential, but where major crop damage is a problem [32]. Rabbits and wild hares are also subject to hunting and are subsequently consumed domestically, often with no adequate veterinary control or sanitary management.
The role of S. aureus as a possible pathogen or colonizer in wild populations of lagomorphs has not yet been studied in a massive and systematic manner. In high-density areas, the interaction between rabbits and other animals is higher and, therefore, the probability of S. aureus transmission will also be higher. For these reasons, this study sets out the following objectives: (1) to know the role of wild rabbits and hares as a reservoir of S. aureus in wild lagomorph high-density areas; (2) to characterize the S. aureus strains isolated from wild rabbits and hares to compare them with those obtained previously on commercial farms; (3) to study the prevalence of MRSA strains in wild populations.

2. Materials and Methods

2.1. Sampling, Isolation and Characterization of S. aureus Isolates

2.1.1. Animals and Geographical Locations

Ten hares (Lepus granatensis) and 353 wild rabbits (Oryctolagus cuniculus) from one game range or more located in 14 high-density towns were sampled to check the presence of S. aureus. The 10 hares of the study were included because they were hunted together with rabbits and it was considered interesting to compare the findings observed in another lagomorph from the same geographical locations. Animals were donated by hunters for this study once they were dead. The study was carried out in the Valencian Region, formed by the provinces of Valencia, Castellon and Alicante (each, in turn, formed by several districts) in eastern Spain (Figure 1) in 2019.
The lagomorph high-density towns were defined by the Valencian Regional Government (Order of June 11, 2009 and updated by Resolution of November 20, 2018 [32]). The Valencian Regional Government, in collaboration with professional agricultural organizations, conducts surveys to identify those areas in different regions where the inordinate proliferation of rabbit populations associated with crop damage has been observed, and where hunting is allowed all year long.
The regional Valencian districts were classified as: extreme density (>70 rabbits/100 Has/year), very high density (31–70 rabbits/100 Has/year), high density (21–30 rabbits/100 Has/year), medium density (10–20 rabbits/ 100 Has/year) and low density (<10 rabbits/100 Has/year). This classification was based on the last 5-year (2012–2017) declared annual captures (rabbits per 100 hectares) published by the Fish and Game Service of the Valencian Regional Government [33] (Figure 1).
Samples from the towns of Pedralba and Vinarós were included in this study, which belong to low- and medium-density districts, respectively, and are located on the borders of very high- or high-density districts, respectively, that also host high densities due to the proximity to these districts.
In order to calculate the necessary representative amount of rabbits to be sampled, the average district hunting bag of the last 5 years (2012–2017) was taken as the population data. The premise of an unknown prevalence in the S. aureus carrier condition was included in the analysis (WinEpi 2.0, Zaragoza, Spain). Such a restrictive criterion meant that the initially established number was not reached in several districts, namely El Baix Maestrat, El Camp de Túria, La Plana Utiel-Requena, La Costera and La Vall d’Albaida, as they lacked catches during the study period.

2.1.2. Microbiological Studies

The studied animals were referred to the Universidad CEU Cardenal Herrera (Alfara del Patriarca, Valencia, Spain), where necropsy and sampling were carried out. Swabs from the nasal cavity, ears, perineum and lesions (whenever present) were taken.
Samples were inoculated on blood-agar (Becton–Dickinson, Sparks, MD, USA) and incubated aerobically at 37 °C for 24–48 h. S. aureus strains were identified on the basis of morphological growth characteristics and hemolytic properties [34]. When contamination appeared with other bacteria, Mannitol Salt Agar (Becton–Dickinson, Sparks, MD, USA) was used to obtain isolated S. aureus colonies. Only the plaques with 10 or more S. aureus CFU were considered positive. Those colonies compatible with S. aureus were grown in TSB (Tryptic Soy Broth) at 37 °C for 12 h with shaking. To perform PCRs, genomic DNA was extracted from each isolate by a Genelute Bacterial Genomic DNA kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s protocol, except for bacterial cells, which were lysed by lysostaphin (12.5 μg/mL, Sigma-Aldrich) at 37 °C for 1 h before DNA purification. Isolates were genotyped based on the analysis of the polymorphic regions of genes coa and spa as previously described [35]. Multilocus-sequence typing (MLST) was performed in the selected isolates [36]. According to sequence type (ST), isolates were ascribed to the different clonal complexes (CC). CC were assumed for some isolates according to their specific genotype [22].
All the strains were checked for the presence of mecA/mecC genes by PCR (Table 1), as previously described [37,38]. Isolates were classified into MRSA or MSSA according to the presence or absence results of the mecA/mecC genes obtained by PCR.

2.1.3. Detection of chp, sak, scn, blaZ, tst, sea, and PVL-encoding Genes, and agr Typing

An MRSA strain of each ST type was selected from all the towns. These selected MRSA isolates were subjected to a PCR assay (Table 1) to detect the lukF/S-PV genes encoding the PVL toxin, and genes sea and tst that encode the SEA and TSST-1 toxin and agr typing, as previously described [39]. Strains were also checked for the presence of immune-evasion cluster (IEC) genes (sak, chp, and scn) by PCR, as described elsewhere [40]. blaZ gene detection was investigated by PCR [41].

2.1.4. Antibiotic Susceptibility Testing

The antibiotic susceptibility of the all isolates was determined by the disk diffusion method on Mueller–Hinton agar (Becton–Dickinson, Sparks, MD, USA) according to the recommendations of the Clinical and Laboratory Standards Institute (CLSI). The disk diffusion assay was run with 15 antibiotics: bacitracin (10 U), enrofloxacin (5 μg) (OXOID), streptomycin (10 μg), spiramycin (100 μg), sulfadiazine (25 μg), chloramphenicol (30 μg) (BD), doxycycline (30 μg), erythromycin (15 μg), gentamicin (10 μg), neomycin (30 μg), penicillin (10 U), tetracycline (30 μg), cefoxitin (30 μg), trimethoprim/sulfamethoxazole (1.25 μg/23.75 μg, respectively), and vancomycin (30 µg and 5 µg) (BIO-RAD, Hercules, CA, USA). S. aureus strain ATCC 25923 and Enterococcus faecalis strain ATCC 29212 were used as controls in the susceptibility test.

2.2. Statistical Analysis

In order to know if the number of animals positive for S. aureus was statistically representative in relation to the number of studied animals in each district, the following statistical analysis was carried out. Categorical data were compared by the Fisher exact test. All the reported p values were two-tailed and analyses were performed using the GraphPad software. The variables with p < 0.01 were considered statistically significant.

3. Results

3.1. Identification of S. aureus, MRSA and Lesions

S. aureus was isolated in 41.3% (150/363) of all the wild rabbits and hares included in this study in at least one of the sampled locations (nasal cavity, ears or perineum). Of the 150 animals positive for S. aureus, the mecC gene was detected in 94 (62.7% of the positive animals) and the mecA gene was observed in one animal (0.7% of the positive animals) (Table 2).
Of the 10 hares included in this study, only one from the town of Cheste carried S. aureus in its nostrils. The strain isolated from this hare was MSSA, and it had a different CC (CC121) to the isolated strains of rabbits hunted in the same district (CC5, CC130, CC398 and CC425).
The number of animals carrying S. aureus varied among the different sampled towns (Table 2). The towns with more animals carrying S. aureus were Pedralba (n = 37), Castellón de Rugat (n = 26) and Alfafara (n = 19). In addition, Alfafara, Pedralba and Cheste were the towns where a high percentage of animals with MRSA was detected (100%, 86.5% and 69.2%, respectively) and they all carried the mecC gene, except for one from the town of Cheste for which mecA was identified.
In all the following were found: 244 S. aureus isolates (244/1100; 22.2%) from the swabs taken from the nasal cavity, ears and perineum (n = 1089) in the 363 animals; additional swabs of six rabbits and two hares presenting one lesion or more (n = 11); 57.4% (140/244) of the S. aureus isolates were MRSA (Table 3). Of the 140 MRSA isolates, mecA was detected in only one isolate, and mecC was amplified in the 139 remaining isolates.
When considering the anatomical location of sampling, ears were by far the place from which more positive samples were isolated and where a higher percentage of MRSA was found. S. aureus was isolated in 33.3% (121/363) of the swabs taken from ears, and 66.1% of them were MRSA (80/121). In nasal cavity and perineum, fewer swabs were positive for S. aureus (70 and 45, respectively), but MRSA strains were also detected (48.6% and 44.4%, respectively) (Table 3). In general, very few lesions were observed after the necropsy of animals, except for traumatic lesions caused by animal hunting with firearms. However, S. aureus had evolved in many of them because of the 11 samples taken from lesions (dermatitis, hepatic abscesses, conjunctivitis), eight were positive for S. aureus and six carried the mecC gene.
In some animals, S. aureus strains were isolated in different locations at the same time. Therefore, the number of animals carrying S. aureus and the number of positive samples differed. Eighty-five animals carried S. aureus only in one location; in 45, 16 and 4 rabbits, the bacterium was isolated in 2, 3 or 4 different locations, respectively. Another interesting result was that two different S. aureus strains were found in the same anatomical location in five animals.

3.2. Characterization of S. aureus Isolates

The MLST typing analysis revealed 13 different STs (Table 4). The MLST type with the most isolates was ST1945 (n = 177), followed immediately by ST425 (n = 42) and ST121 (n = 7). Other less frequent STs were ST5821 (n = 4), ST5826 (n = 3), ST398 (n = 3), ST5 (n = 2) and ST5822, ST5823, ST5824, ST5825, ST5844 and ST5845 (n = 1, each).
Most of the strains isolated from animals belonged to CC130 (74.2%; 181/244). The next most prevalent CC was CC425 (19.3%; 47/244). The other found CCs were CC121 (7/244), CC398 (3/244) and CC5 (2/244), but they were infrequently isolated.
The 140 MRSA isolates belonged mostly to ST1945 (97.1%, 136/140). The remaining four isolates corresponded to ST398, ST5822, ST5823 and ST5824. The mecA gene was found only in one sample, the only MRSA belonging to ST398 (CC398). The other samples (n = 139) carried the mecC gene and were included in CC130, except for one (ST5824), which was a CC that has not yet been described.
Four rabbits presented lesions and carried S. aureus in some anatomical locations simultaneously. The genotypic analysis showed that the S. aureus strains isolated from nostrils/ear/perineum and lesions were clonally related in 100% animals. In a single case, corresponding to OC19006, a strain different from those from rostril/perineum was identified in the lesion (Table 5).

3.3. Antibiotic Resistance Profile

Antibiograms were performed of all the S. aureus positive isolates obtained in each studied town (244 isolates: 140 MRSA and 104 MSSA). Penicillin resistance was detected in 28 mec negative isolates and, in one case, bacitracin resistance. mecA isolate presented resistance to enrofloxacin and tetracycline, and 10 mecC isolates also showed bacitracin resistance. Of the 140 MRSA strains, 49 were sensitive to cefoxitin and 34 to penicillin. None of the 104 MSSA strains showed resistance to cefoxitin, but 28 strains resisted penicillin. Eleven isolates were Bacitracin-resistant (10 MRSA and 1 MSSA). The strain isolated with the mecA gene was also resistant to enrofloxacin and tetracycline (Table 6).

3.4. Detection of the IEC Cluster (scn, chp, sak and sea), blaZ, tst and the PVL Genes among MRSA Isolates

The PCR detection of the IEC genes, blaZ, tst, and the PVL-encoding genes was carried out to select MRSA isolates. None of these isolates were positive for genes chp, sea, tst and PVL. Two ST1945 isolates contained the IEC type E (comprising genes scn and sak). The mecA-isolate was positive for blaZ (Table 6). Of the 28 MSSA strains displaying resistance to penicillin, 20 carried the blaZ gene. Figure 2 shows the positive and negative controls of the genes tested in this study, and the size of the PCR amplified fragments of each gene.

4. Discussion

In the present study, 244 S. aureus isolates obtained from 150 wild rabbits and hares, located in 10 high-density population areas (districts) of the Valencia Region in Spain, were analyzed. As far as the authors are aware, this is the first time that a study with such a large number of animals, conducted in high-density areas of animals, has been carried out. The reason why this study was performed in rabbit high-density areas was because the probability of detecting S. aureus carrier animals was believed to be higher in these areas. In total, 41.3% (150 of 363) of the animals carried S. aureus and positive animals were detected in all the studied geographical areas. Apparently, there was no clear geographical distribution of towns with more positive animals, although they were mainly located in the center and south (La Vall d’Albaida and El Comtat) of the Valencian region. Further studies in areas with lower rabbit density would be necessary to assess the relationship between S. aureus prevalence and rabbit density of animal.
Sixty-five animals carried S. aureus in more than one location; and two different S. aureus strains were identified in the same anatomical location in five rabbits. This agrees with previous studies which have reported how several different S. aureus strains can simultaneously colonize individual rabbits [42]. This is an important issue because it could affect the diagnosis of this condition if only one colony is selected during the microbiological identification of staphylococcal infections or only one anatomical site is selected for sampling
In humans, the nose is the main ecological niche where S. aureus resides [2]. However, in this study, the highest percentage of S. aureus was detected in ears (49.6%). This finding has also been observed in commercial rabbitries where the presence of S. aureus was isolated from mainly samples taken from the ears and perineum among nine different anatomical locations [42]. The percentage of nasal carriers (28.7%) was lower than previously described in farm rabbits with staphylococcal problems (56%) [6], but was higher than other wild mammals (22.3%), and was substantially higher than recently described for wild rabbits (8%) [29].
In the present study, only eight animals (6 rabbits, 2 hares) showed lesions; S. aureus was isolated from the lesions presented by the 6 rabbits. The high percentage of samples (8 of 11) obtained from the animals positive for S. aureus (72.7%) was surprising, especially when considering the different characteristics of the observed lesions compared to commercial rabbits [43]. Four of the six animals with positive S. aureus lesions (66.7%) also carried this bacterium in their noses. In humans, it is reported that nasal carriers of S. aureus are at increased risk of acquiring infection with this pathogen [2]. This has also been found in animals, specifically rabbits, where the colonization capacity of this bacterium plays an important role in spreading the disease [42]. There are reports that S. aureus carriage in rabbits can be a risk for developing clinical infections [6]. These results agree with this asseveration because the S. aureus strains isolated from nostrils/ear/perineum and lesions were clonally related in 100% animals. Only in one case, corresponding to rabbit OC19006, was a strain different from those from rostril/perineum identified in the lesion.
In order to understand the diffusion and possible origin of S. aureus (especially MRSA), correctly identifying the involved strain is vital. The most frequently detected CC herein was CC130, followed by CC425. The ST121 (CC121) lineage has been identified in most nasal carriers [6] and chronic staphylococcal infections [12,22,44] in commercial rabbits. Therefore, these results indicate that the S. aureus strains which affect commercial and wild rabbits are different, which reinforces recently observed findings in wild rabbits in Aragón (a region in north Spain), where three strains were typed as t843 (ascribed to CC130). This finding has also been observed in samples from other wild species, such as reed deer (Dama dama) and wild boar (Sus scrofa) [29]. Only one hare carried S. aureus, isolated from its nostril (MSSA), and it differed (CC121) from the strains isolated in the rabbits from the same district (CC5, CC130, CC398 and CC425). However, this number was not big enough to collect data on possible species specificity.
In the present study, 138 of the 181 CC130 strains carried mecC and the rest were methicillin-sensitive. The isolates reported to date carrying mecC belong mainly to common lineages in cattle, namely CC130, CC1943, and CC425, which suggests a zoonotic reservoir [19]. Besides cattle, mecC has been found in other farm animals, with isolates ST130 in sheep [45,46], ST4774 (a novel tpi single locus variant of ST130) in rabbits [22] and isolate ST425, which caused highly virulent infection, in one rabbit [47]. ST425 is a lineage that has been found in both wild and domestic animals, and has been previously noted in wild boar from Germany [48], red deer from Spain [49] and also in humans. In this work, all the ST425 strains were methicillin-sensitive. The appearance of ST425-MRSA-XI, from cattle in the UK in 2011 [50], in wildlife (fallow deer, wild boar), and in an environmental sample from Spain [51], should put us on alert and to follow up these lineages in the future.
One interesting finding was that the only strain to carry the mecA gene belonged to the ST398 lineage. The first LA-MRSA case reported in rabbits for meat production belonged to this lineage [21]. Moreover, the first case of LA-MRSA in rabbits in Spain showed limited genetic diversity (ST2855, ST146, ST398, ST4774), with ST2855 being the predominant clone [22]. It is notorious that this study found neither this lineage nor ST146 strains. This ST belongs to CC5, which has been previously described in S. aureus isolates from rabbit carcasses, but were not resistant to methicillin [52].
Of all the strains, 72.5% belonged to the ST1945 lineage, which is included in CC130. ST1945, a single-locus variant of ST130, has been reported as an mecC-carrying MRSA in humans in the UK [50], Germany [53], France [54] and Spain [55]. This lineage has been described in fecal samples taken from free-ranging wild small mammals in southern Spain, specifically in two wood mice. MRSA were detected in 7% of the analyzed wood mice [56]. The MRSA percentage herein observed was much higher, as 57.4% of S. aureus isolates had MRSA.
Another technique used to characterize the MRSA strains included the identification of the agr and staphylococcal cassette chromosome mec (SCCmec). In our study, all the isolates belonged to agr type III, as reported in other series [53], except for isolate ST398, which was agrI. CC130 presented SCCmecXI and ST398 SCCmecV, as previously described [50,57,58].
Two mecC-positive MRSA isolates ST1945 carried genes scn and sak from the IEC system, and were consequently ascribed to IEC-type E. The origin of the mecC gene is unclear, but it has been detected in staphylococci from humans and animals [56]. Very little research has determined the presence of IEC genes in mecC-positive isolates, and all the available research works found isolates lacking genes sak, chp and scn [31,53,59], which supports the hypothesis of the possible animal origin of these isolates. The detection of genes sak and scn in these two strains is relevant and poses questions about the potential origin of these isolates.
The possible origin of the MRSA strains remains an interesting enigma. In Spain, some wild animals (wild boars and fallow deer) located on a game estate had similar mecC-MRSA isolates detected in river water. Therefore, it was proposed that water could be a source that disseminates this type of strain in nature [51]. The colonization of wild animals with S. aureus lineages from humans has been confirmed in a zoological park [60]. The transmission of MRSA strains between animals and persons is relatively easy, because it has been observed how 22% of students who visited pork farms (30% prevalence of MRSA) became MRSA nasal carriers [18]. It has also demonstrated that the most prevalent S. aureus strain in commercial rabbits in Spain (ST121) has a human origin. This host adaptation took place 45 years ago when a single nucleotide mutation was sufficient to convert a human-specific S. aureus strain into one that could infect rabbits [61]. However, close contact between humans and animals has been assumed in all these cases, and the animals on commercial farms lived in high-density communities with interactions between animals. These conditions are not, a priori, those that take place in wild lagomorphs. However, it is worth considering that the present study entails the peculiarity of being conducted in rabbit high-density areas that could increase the probability of contact between animals and favor S. aureus spreading through rabbit populations. Additionally, CC130 (the most isolated CC in this study) is a lineage associated mainly with cattle, with transmission patterns that might be assumed in which wild rabbits could be infected by ingesting contaminated feces from wild ruminants in the same area. Our study did not analyze water or other animals that could interact with wild rabbits (predators, ruminants, etc.). Therefore, it would be interesting to extend this study along this line in the future to know the epidemiological origin of these bacteria.
Most MRSA isolates show resistance to cefoxitin. As previously reported for mecC-carrying MRSA, most isolates were susceptible to all the tested antibiotics, except for β-lactams [55], and 10 strains were Bacitracin-resistant. However, the ST398-MRSA-mecA strain also shows resistance to enrofloxacin and tetracycline, and carried the blaZ gene. Resistance to tetracycline has also been associated with livestock-related ST398 [62].
Food-producing animals, both livestock and wildlife, and derived products are considered potential sources of MRSA in humans [63]. However in that study, which included 1365 wild animals, S. aureus was detected in only 2.0% of wild animal carcasses and in 3.2% of wild boar lymph nodes, and none had MRSA. Therefore, the authors concluded that the risk of transmission to humans was limited. Conversely, in our study, the high presence of S. aureus (41.3% of animals), of which 63.3% had MRSA, indicates an alarming situation for wild rabbits in our study area, because these animals can be consumed directly by hunters, or even be donated to charities, without undergoing adequate veterinary inspections.

5. Conclusion

In conclusion, the results suggest that wild lagomorphs can constitute a reservoir of MRSA isolates in nature. Our report confirms the high presence of the MRSA CC130 lineage containing the mecC gene in wild rabbits and hares in east Spain, which could be transmitted to domestic animals or humans with major public health implications. It would be advisable to conduct similar studies in low-density areas of animals and in other regions of Spain and Europe to determine the degree of dissemination of MRSA isolates in lagomorphs and other wild species.

Author Contributions

Conceptualization: L.S. and J.M.C. Formal analysis: L.S. and J.M.C. Funding acquisition: J.C. and J.M.C. Methodology: E.M.-G., S.P.-F., D.V., J.C., V.L., J.A., L.S. and J.M.C. Project administration: J.M.C. Supervision: L.S. and J.M.C. Writing—original draft: E.M., V.L., D.V., L.S. and J.M.C. Writing—review and editing: D.V., L.S. and J.M.C. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Universidad CEU Cardenal Herrera. Fellowships support Sara Pérez-Fuentes from the Generalitat Valenciana (grant number ACIF/2016/085) and Elena Moreno from the Spanish Ministry of Education, Culture and Sport (grant number FPU17/02708).

Acknowledgments

We especially wish to thank the collaboration of the hunters who contributed the studied animals.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Kloos, W.E. Natural populations of the genus Staphylococcus. Annu. Rev. Microbiol. 1980, 34, 559–592. [Google Scholar] [CrossRef]
  2. Wertheim, H.F.L.; Melles, D.C.; Vos, M.C.; van Leeuwen, W.; van Belkum, A.; Verbrugh, H.A.; Nouwen, J.L. The role of nasal carriage in Staphylococcus aureus infections. Lancet Infect. Dis. 2005, 5, 751–762. [Google Scholar] [CrossRef]
  3. Burton, S.; Reid-Smith, R.; McClure, J.T.; Weese, J.S. Staphylococcus aureus colonization in healthy horses in Atlantic Canada. Can. Vet. J. 2008, 49, 797–799. [Google Scholar]
  4. Vautor, E.; Abadie, G.; Guibert, J.-M.; Chevalier, N.; Pépin, M. Nasal carriage of Staphylococcus aureus in dairy sheep. Vet. Microbiol. 2005, 106, 235–239. [Google Scholar] [CrossRef]
  5. Hermans, K.; De Herdt, P.; Devriese, L.A.; Godard, C.; Haesebrouck, F. Colonisation of rabbits with Staphylococcus aureus after experimental infection with high and low virulence strains. Vet. Microbiol. 2000, 72, 277–284. [Google Scholar] [CrossRef]
  6. Selva, L.; Viana, D.; Corpa, J.M. Staphylococcus aureus nasal carriage could be a risk for development of clinical infections in rabbits. World Rabbit. Sci. 2015, 23, 181–184. [Google Scholar] [CrossRef]
  7. Jones, R.N. Global epidemiology of antimicrobial resistance among community-acquired and nosocomial pathogens: A five-year summary from the SENTRY Antimicrobial Surveillance Program (1997–2001). Semin. Respir. Crit. Care Med. 2003, 24, 121–134. [Google Scholar] [CrossRef] [PubMed]
  8. Francois, P.; Huyghe, A.; Charbonnier, Y.; Bento, M.; Herzig, S.; Topolski, I.; Fleury, B.; Lew, D.; Vaudaux, P.; Harbarth, S.; et al. Use of an automated multiple-locus, variable-number tandem repeat-based method for rapid and high-throughput genotyping of Staphylococcus aureus isolates. J. Clin. Microbiol. 2005, 43, 3346–3355. [Google Scholar] [CrossRef] [PubMed]
  9. Segura, P.; Martinez, J.; Peris, B.; Selva, L.; Viana, D.; Penadés, J.R.; Corpa, J.M. Staphylococcal infections in rabbit does on two industrial farms. Vet. Rec. 2007, 160, 869–872. [Google Scholar] [CrossRef]
  10. Rosell, J.M.; de la Fuente, L.F. Culling and mortality in breeding rabbits. Prev. Vet. Med. 2009, 88, 120–127. [Google Scholar] [CrossRef] [PubMed]
  11. Vancraeynest, D.; Haesebrouck, F.; Deplano, A.; Denis, O.; Godard, C.; Wildemauwe, C.; Hermans, K. International dissemination of a high virulence rabbit Staphylococcus aureus clone. J. Vet. Med. B Infect. Dis. Vet. Public Health 2006, 53, 418–422. [Google Scholar] [CrossRef] [PubMed]
  12. Viana, D.; Selva, L.; Callanan, J.J.; Guerrero, I.; Ferrian, S.; Corpa, J.M. Strains of Staphylococcus aureus and pathology associated with chronic suppurative mastitis in rabbits. Vet. J. 2011, 190, 403–407. [Google Scholar] [CrossRef] [PubMed]
  13. Pantosti, A.; Sanchini, A.; Monaco, M. Mechanisms of antibiotic resistance in Staphylococcus aureus. Fut. Microbiol. 2007, 2, 323–334. [Google Scholar] [CrossRef] [PubMed]
  14. Foster, T.J. Antibiotic resistance in Staphylococcus aureus. Current status and future prospects. FEMS Microbiol. Rev. 2017, 41, 430–449. [Google Scholar] [CrossRef]
  15. Cuny, C.; Wieler, L.; Witte, W. Livestock-associated MRSA: The impact on humans. Antibiotics 2015, 4, 521–543. [Google Scholar] [CrossRef]
  16. Armand-Lefevre, L.; Ruimy, R.; Andremont, A. Clonal comparison of Staphylococcus aureus isolates from healthy pig farmers, human controls, and pigs. Emerg. Infect. Dis. 2005, 11, 711–714. [Google Scholar] [CrossRef]
  17. Graveland, H.; Duim, B.; van Duijkeren, E.; Heederik, D.; Wagenaar, J.A. Livestock-associated methicillin-resistant Staphylococcus aureus in animals and humans. Int. J. Med. Microbiol. 2011, 301, 630–634. [Google Scholar] [CrossRef]
  18. Frana, T.S.; Beahm, A.R.; Hanson, B.M.; Kinyon, J.M.; Layman, L.L.; Karriker, L.A.; Ramirez, A.; Smith, T.C. Isolation and characterization of methicillin-resistant Staphylococcus aureus from pork farms and visiting veterinary students. PLoS ONE 2013, 8, e53738. [Google Scholar] [CrossRef]
  19. Aires-de-Sousa, M. Methicillin-resistant Staphylococcus aureus among animals: Current overview. Clin. Microbiol. Infect. 2017, 23, 373–380. [Google Scholar] [CrossRef]
  20. Angen, Ø.; Feld, L.; Larsen, J.; Rostgaard, K.; Skov, R.; Madsen, A.M.; Larsen, A.R. Transmission of methicillin-resistant Staphylococcus aureus to human volunteers visiting a swine farm. Appl. Environ. Microbiol. 2017, 83, e01489-17. [Google Scholar] [CrossRef]
  21. Agnoletti, F.; Mazzolini, E.; Bacchin, C.; Bano, L.; Berto, G.; Rigoli, R.; Muffato, G.; Coato, P.; Tonon, E.; Drigo, I. First reporting of methicillin-resistant Staphylococcus aureus (MRSA) ST398 in an industrial rabbit holding and in farm-related people. Vet. Microbiol. 2014, 170, 172–177. [Google Scholar] [CrossRef]
  22. Moreno-Grúa, E.; Pérez-Fuentes, S.; Muñoz-Silvestre, A.; Viana, D.; Fernández-Ros, A.B.; Sanz-Tejero, C.; Corpa, J.M.; Selva, L. Characterization of livestock-associated methicillin-resistant Staphylococcus aureus isolates obtained from commercial rabbitries located in the Iberian Peninsula. Front. Microbiol. 2018, 9, 1812. [Google Scholar] [CrossRef] [PubMed]
  23. Pantosti, A. Methicillin-resistant Staphylococcus aureus associated with animals and its relevance to human health. Front. Microbiol. 2012, 3, 127. [Google Scholar] [CrossRef] [PubMed]
  24. Monecke, S.; Slickers, P.; Ellington, M.J.; Kearns, A.M.; Ehricht, R. High diversity of Panton-Valentine leukocidin-positive, methicillin-susceptible isolates of Staphylococcus aureus and implications for the evolution of community-associated methicillin-resistant S. aureus. Clin. Microbiol. Infect. 2014, 13, 1157–1164. [Google Scholar] [CrossRef] [PubMed]
  25. Mat Azis, N.; Pung, H.P.; Abdul Rachman, A.R.; Amin Nordin, S.; Sarchio, S.N.E.; Suhaili, Z.; Mohd Desa, M.N. A persistent antimicrobial resistance pattern and limited methicillin-resistance-associated genotype in a short-term Staphylococcus aureus carriage isolated from a student population. J. Infect. Public Health 2017, 10, 156–164. [Google Scholar] [CrossRef] [PubMed]
  26. Lowder, B.V.; Guinane, C.M.; Ben Zakour, N.L.; Weinert, L.A.; Conway-Morris, A.; Cartwright, R.A.; Simpson, A.J.; Rambaut, A.; Nübel, U.; Fitzgerald, J.R. Recent human-to-poultry host jump, adaptation, and pandemic spread of Staphylococcus aureus. Proc. Natl. Acad. Sci. USA 2009, 106, 19545–19550. [Google Scholar] [CrossRef]
  27. Smith, T.C. Livestock-associated Staphylococcus aureus: The United States experience. PLoS Pathog. 2015, 11, e1004564. [Google Scholar] [CrossRef]
  28. Dolejska, M.; Cizek, A.; Literak, I. High prevalence of antimicrobial-resistant genes and integrons in Escherichia coli isolates from Black-headed Gulls in the Czech Republic. J. Appl. Microbiol. 2007, 103, 11–19. [Google Scholar] [CrossRef]
  29. Ruiz Ripa, L.; Alcalá, L.; Simón, C.; Gómez, P.; Mama, O.M.; Rezusta, A.; Zarazaga, M.; Torres, C. Diversity of Staphylococcus aureus clones in wild mammals in Aragon, Spain, with detection of MRSA ST130-mecCin wild rabbits. J. Appl. Microbiol. 2019, 127, 284–291. [Google Scholar] [CrossRef]
  30. Loncaric, I.; Kubber-Heiss, A.; Posautz, A.; Stalder, G.L.; Hoffmann, D.; Rosengarten, R.; Walzer, C. Characterization of methicillin-resistant Staphylococcus spp. carrying the mecC gene, isolated from wildlife. J. Antimicrob. Chemother. 2013, 2. [Google Scholar] [CrossRef]
  31. Monecke, S.; Gavier-Widén, D.; Hotzel, H.; Peters, M.; Guenther, S.; Lazaris, A.; Loncaric, I.; Müller, E.; Reissig, A.; Ruppelt-Lorz, A.; et al. Diversity of Staphylococcus aureus isolates in European wildlife. PLoS ONE 2016, 11, e0168433. [Google Scholar] [CrossRef]
  32. DOGV (Diario Oficial Comunidad Valenciana [Valencian Region Official Gazette]). Resolution of November 20, 2018, of the Director General of Natural Environment and Environmental Assessment, which Updates the Annex of the Order of June 11, 2009, of the Ministry of Environment, Water, Urban Planning and Housing, which Approves Extraordinary Guidelines for the Use, Management and Control of the Mountain Rabbit in the Valencian Region, Relative to the List of Municipal Terms Affected by Overpopulation of Mountain Rabbit. DOGV No. 8437 from 12.04.2018. 2018. Available online: http://www.dogv.gva.es/portal/ficha_disposicion.jsp?L=1&sig=010983%2F2018 (accessed on 25 February 2020).
  33. Torres, C.; Esteve, C.; Nieto, M.P.; Burgui, J.M. Estadísticas cinegéticas de la Comunitat Valenciana. Memoria 2018. Temporada 2017/2018 [Hunting statistics of the Valencian Community. Annual Report 2018. 2017/2018 Season]. Hunting and Fishing Service; Valencia Region Government: Valencia, Spain, 2019. [Google Scholar]
  34. Devriese, L.A.; Hendrickx, W.; Godard, C.; Okerman, L.; Haesebrouck, F. A new pathogenic Staphylococcus aureus type in commercial rabbits. Zentralbl Veterinarmed B 1996, 43, 313–315. [Google Scholar] [CrossRef] [PubMed]
  35. Viana, D.; Selva, L.; Segura, P.; Penadés, J.R.; Corpa, J.M. Genotypic characterization of Staphylococcus aureus strains isolated from rabbit lesions. Vet. Microbiol. 2007, 121, 288–298. [Google Scholar] [CrossRef] [PubMed]
  36. Enright, M.C.; Day, N.P.; Davies, C.E.; Peacock, S.J.; Spratt, B.G. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 2000, 38, 1008–1015. [Google Scholar] [CrossRef] [PubMed]
  37. Geha, D.J.; Uhl, J.R.; Gustaferro, C.A.; Persing, D.H. Multiplex PCR for identification of methicillin-resistant staphylococci in the clinical laboratory. J. Clin. Microbiol. 1994, 32, 1768–1772. [Google Scholar] [CrossRef]
  38. Khairalla, A.S.; Wasfi, R.; Ashour, H.M. Carriage frequency, phenotypic, and genotypic characteristics of methicillin-resistant Staphylococcus aureus isolated from dental health-care personnel, patients, and environment. Sci. Rep. 2017, 7, 7390. [Google Scholar] [CrossRef] [PubMed]
  39. Viana, D.; Selva, L.; Penadés, M.; Corpa, J.M. Screening of virulence genes in Staphylococcus aureus isolates from rabbits. World Rabbit Sci. 2015, 23, 185. [Google Scholar] [CrossRef]
  40. van Wamel, W.J.B.; Rooijakkers, S.H.M.; Ruyken, M.; van Kessel, K.P.M.; van Strijp, J.A.G. The innate immune modulators staphylococcal complement inhibitor and chemotaxis inhibitory protein of Staphylococcus aureus are located on β-hemolysin-converting bacteriophages. J. Bacteriol. 2006, 188, 1310–1315. [Google Scholar] [CrossRef]
  41. Schnellmann, C.; Gerber, V.; Rossano, A.; Jaquier, V.; Panchaud, Y.; Doherr, M.G.; Thomann, A.; Straub, R.; Perreten, V. Presence of new mecA and mph(C) variants conferring antibiotic resistance in Staphylococcus spp. isolated from the skin of horses before and after clinic admission. J. Clin. Microbiol. 2006, 44, 4444–4454. [Google Scholar] [CrossRef]
  42. Hermans, K.; De Herdt, P.; Devriese, L.A.; Hendrickx, W.; Godard, C.; Haesebrouck, F. Colonization of rabbits with Staphylococcus aureus in flocks with and without chronic staphylococcosis. Vet. Microbiol. 1999, 67, 37–46. [Google Scholar] [CrossRef]
  43. Corpa, J.M.; Hermans, K.; Haesebrouck, F. Main pathologies associated with Staphylococcus aureus infections in rabbits: A review. World Rabbit Sci. 2010, 17, 115–125. [Google Scholar] [CrossRef]
  44. Guerrero, I.; Ferrian, S.; Penadés, M.; García-Quirós, A.; Pascual, J.J.; Selva, L.; Viana, D.; Corpa, J.M. Host responses associated with chronic staphylococcal mastitis in rabbits. Vet. J. 2015, 204, 338–344. [Google Scholar] [CrossRef]
  45. Ariza-Miguel, J.; Hernández, M.; Fernández-Natal, I.; Rodríguez-Lázaro, D. Methicillin-resistant Staphylococcus aureus harboring mecC in livestock in Spain. J. Clin. Microbiol. 2014, 52, 4067–4069. [Google Scholar] [CrossRef] [PubMed]
  46. Giacinti, G.; Carfora, V.; Caprioli, A.; Sagrafoli, D.; Marri, N.; Giangolini, G.; Amoruso, R.; Iurescia, M.; Stravino, F.; Dottarelli, S.; et al. Prevalence and characterization of methicillin-resistant Staphylococcus aureus carrying mecA or mecC and methicillin-susceptible Staphylococcus aureus in dairy sheep farms in central Italy. J. Dairy Sci. 2017, 100, 7857–7863. [Google Scholar] [CrossRef] [PubMed]
  47. Paterson, G.K.; Larsen, A.R.; Robb, A.; Edwards, G.E.; Pennycott, T.W.; Foster, G.; Mot, D.; Hermans, K.; Baert, K.; Peacock, S.J.; et al. The newly described mecA homologue, mecALGA251, is present in methicillin-resistant Staphylococcus aureus isolates from a diverse range of host species. J. Antimicrob. Chemother. 2012, 67, 2809–2813. [Google Scholar] [CrossRef]
  48. Meemken, D.; Blaha, T.; Hotzel, H.; Strommenger, B.; Klein, G.; Ehricht, R.; Monecke, S.; Kehrenberg, C. Genotypic and phenotypic characterization of Staphylococcus aureus isolates from wild boars. Appl. Environ. Microbiol. 2013, 79, 1739–1742. [Google Scholar] [CrossRef]
  49. Porrero, M.C.; Mentaberre, G.; Sánchez, S.; Fernández-Llario, P.; Casas-Díaz, E.; Mateos, A.; Vidal, D.; Lavín, S.; Fernández-Garayzábal, J.-F.; Domínguez, L. Carriage of Staphylococcus aureus by free-living wild animals in Spain. Appl. Environ. Microbiol. 2014, 80, 4865–4870. [Google Scholar] [CrossRef] [PubMed]
  50. García-Álvarez, L.; Holden, M.T.G.; Lindsay, H.; Webb, C.R.; Brown, D.F.J.; Curran, M.D.; Walpole, E.; Brooks, K.; Pickard, D.J.; Teale, C.; et al. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: A descriptive study. Lancet Infect. Dis. 2011, 11, 595–603. [Google Scholar] [CrossRef]
  51. Porrero, M.C.; Valverde, A.; Fernández-Llario, P.; Díez-Guerrier, A.; Mateos, A.; Lavín, S.; Cantón, R.; Fernández-Garayzábal, J.-F.; Domínguez, L. Staphylococcus aureus carrying mecC gene in animals and urban wastewater, Spain. Emerg. Infect. Dis. 2014, 20, 899–901. [Google Scholar] [CrossRef] [PubMed]
  52. Merz, A.; Stephan, R.; Johler, S. Genotyping and DNA microarray based characterization of Staphylococcus aureus isolates from rabbit carcasses. Meat Sci. 2016, 112, 86–89. [Google Scholar] [CrossRef]
  53. Cuny, C.; Layer, F.; Strommenger, B.; Witte, W. Rare occurrence of methicillin-resistant Staphylococcus aureus CC130 with a novel mecA homologue in humans in Germany. PLoS ONE 2011, 6, e24360. [Google Scholar] [CrossRef] [PubMed]
  54. Laurent, F.; Chardon, H.; Haenni, M.; Bes, M.; Reverdy, M.-E.; Madec, J.-Y.; Lagier, E.; Vandenesch, F.; Tristan, A. MRSA harboring mecA variant gene mecC, France. Emerg. Infect. Dis. 2012, 18, 1465–1467. [Google Scholar] [CrossRef] [PubMed]
  55. García-Garrote, F.; Cercenado, E.; Marín, M.; Bal, M.; Trincado, P.; Corredoira, J.; Ballesteros, C.; Pita, J.; Alonso, P.; Vindel, A. Methicillin-resistant Staphylococcus aureus carrying the mecC gene: Emergence in Spain and report of a fatal case of bacteraemia. J. Antimicrob. Chemother. 2014, 69, 45–50. [Google Scholar] [CrossRef] [PubMed]
  56. Gómez, P.; González-Barrio, D.; Benito, D.; García, J.T.; Viñuela, J.; Zarazaga, M.; Ruiz-Fons, F.; Torres, C. Detection of methicillin-resistant Staphylococcus aureus (MRSA) carrying the mecC gene in wild small mammals in Spain. J. Antimicrob. Chemother. 2014, 69, 2061–2064. [Google Scholar] [CrossRef] [PubMed]
  57. Witte, W.; Strommenger, B.; Stanek, C.; Cuny, C. Methicillin-resistant Staphylococcus aureus ST398 in humans and animals, Central Europe. Emerg. Infect. Dis. 2007, 13, 255–258. [Google Scholar] [CrossRef]
  58. Bardiau, M.; Yamazaki, K.; Duprez, J.-N.; Taminiau, B.; Mainil, J.G.; Ote, I. Genotypic and phenotypic characterization of methicillin-resistant Staphylococcus aureus (MRSA) isolated from milk of bovine mastitis. Lett. Appl. Microbiol. 2013, 57, 181–186. [Google Scholar] [CrossRef]
  59. Paterson, G.K.; Morgan, F.J.E.; Harrison, E.M.; Cartwright, E.J.P.; Török, M.E.; Zadoks, R.N.; Parkhill, J.; Peacock, S.J.; Holmes, M.A. Prevalence and characterization of human mecC methicillin-resistant Staphylococcus aureus isolates in England. J. Antimicrob. Chemother. 2014, 69, 907–910. [Google Scholar] [CrossRef]
  60. Drougka, E.; Foka, A.; Posantzis, D.; Giormezis, N.; Anastassiou, E.D.; Petinaki, E.; Spiliopoulou, I. Human Staphylococcus aureus lineages among Zoological Park residents in Greece. Open Vet. J. 2015, 5, 148–153. [Google Scholar]
  61. Viana, D.; Comos, M.A.; McAdam, P.R.; Ward, M.J.; Selva, L.; Guinane, C.M.; Gonzalez-Munoz, B.M.; Tristan, A.; Foster, S.J.; Fitzgerald, J.R.; et al. A single natural nucleotide mutation alters bacterial pathogen host tropism. Nat. Genet. 2015, 47, 361–366. [Google Scholar] [CrossRef]
  62. Harrison, E.M.; Coll, F.; Toleman, M.S.; Blane, B.; Brown, N.M.; Török, M.E.; Parkhill, J.; Peacock, S.J. Genomic surveillance reveals low prevalence of livestock-associated methicillin-resistant Staphylococcus aureus in the East of England. Sci. Rep. 2017, 7, 7406–7407. [Google Scholar] [CrossRef]
  63. Traversa, A.; Gariano, G.R.; Gallina, S.; Bianchi, D.M.; Orusa, R.; Domenis, L.; Cavallerio, P.; Fossati, L.; Serra, R.; Decastelli, L. Methicillin resistance in Staphylococcus aureus strains isolated from food and wild animal carcasses in Italy. Food Microbiol. 2015, 52, 154–158. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Districts of the Valencian Region (El Baix Maestrat (1) La Plana Alta (2), Camp de Morvedre (3), El Camp de Túria (4), Serranos (5), La Plana Utiel-Requena (6), Hoya de Buñol (7), La Costera (8), La Vall d’Albaida (9), El Comtat (10)), colored according to rabbit density.
Figure 1. Districts of the Valencian Region (El Baix Maestrat (1) La Plana Alta (2), Camp de Morvedre (3), El Camp de Túria (4), Serranos (5), La Plana Utiel-Requena (6), Hoya de Buñol (7), La Costera (8), La Vall d’Albaida (9), El Comtat (10)), colored according to rabbit density.
Animals 10 01109 g001
Figure 2. PCR detection of the IEC Cluster (scn, chp, sak and sea), blaZ, tst and the PVL genes among MRSA isolates. The figure shows the positive and negative control of each gene.
Figure 2. PCR detection of the IEC Cluster (scn, chp, sak and sea), blaZ, tst and the PVL genes among MRSA isolates. The figure shows the positive and negative control of each gene.
Animals 10 01109 g002
Table 1. The primer sequences used in this study.
Table 1. The primer sequences used in this study.
PrimerSequence (5′–3′)References
mecAmecA-1m GTAGAAATGACTGAACGTCCGATAA[37,38]
mecA-2cCCAATTCCACATTGTTTCGGTCTAA
mecCmecC-1m CTACACGTTCCATACCATTAG[37,38]
mecC-2cCGCCTCTATGATAAACAATTGC
lukF/S-PVlukF/S-PV-1m ATCATTAGGTAAAATGTCTGGACATGATCCA[39]
lukF/S-PV-2cGCATCAAGTGTATTGGATAGCAAAAGC
seasea-1mAAAGTCCCGATCAATTTATGGCTA[39]
sea-2cGTAATTAACCGAAGGTTCTGTAGA
tsttst-1mCTAATCAAATAATCAAAACTGC[39]
tst-2cTTTCCAATAACCACCCGTTT
agr type Iagr type I-1mGTCACAAGTACTATAAGCTGCGAT[39]
agr type I-2cATGCACATGGTGCACATGC
agr type IIagr type II-1mTATTACTAATTGAAAAGTGGCCATAGC[39]
agr type II-2cATGCACATGGTGCACATGC
agr type IIIagr type III-1mGTAATGTAATAGCTTGTATAATAATACCCAG[39]
agr type III-2cATGCACATGGTGCACATGC
agr type IVagr type IV-1mCGATAATGCCGTAATACCCG[39]
agr type IV-2cATGCACATGGTGCACATGC
saksak-1mAAGGCGATGACGCGAGTTAT[40]
sak-2cGCGCTTGGATCTAATTCAAC
chpchp-1mTTTACTTTTGAACCGTTTCCTAC[40]
chp-2cCGTCCTGAATTCTTAGTATGCATATTCATTAG
scnscn-1mACTTTAGCAATCGTTTTAGC[40]
scn-2cCTGAAATTTTTATAGTTCGC
blaZblaZ-1mCAGTTCACATGCCAAAGAG[41]
blaZ-2cTACACTCTTGGCGGTTTC
Table 2. Animals positive for S. aureus and MRSA in the different studied districts.
Table 2. Animals positive for S. aureus and MRSA in the different studied districts.
IdDistrictTownNo. of Animals TestedNo. of Animals S. aureus Positive 1p2Animals mecC+Animals mecA+mec (%)
1El Baix MaestratVinaroz110.413210100
2La Plana AltaCabanes120180.000110055.6
3Camp de MorvedreFaura3190.18261011.1
4El Camp de TúriaLlíria101000
4El Camp de TúriaVilamarxant21110100
5SerranosPedralba39370.000132086.5
6La Plana Utiel-RequenaRequena200.5137000
6La Plana Utiel-RequenaUtiel3260.0077000
7Hoya de BuñolCheste53130.00988169.2
7Hoya de BuñolGodelleta15110.01434036.4
8La CosteraMontesa101000
9La Vall d’AlbaidaCastelló de Rugat28260.000115057.7
9La Vall d’AlbaidaMontaverner1890.46953033.3
10El ComtatAlfafara 20190.0001190100
Total363150 94163.3
1 Number of animals positive for S. aureus at one or more of the sampling sites. 2 Values in bold denote the variables with p < 0.01, considered statistically significant.
Table 3. Positive samples to S. aureus and MRSA according to sampling localization (in the different studied locations).
Table 3. Positive samples to S. aureus and MRSA according to sampling localization (in the different studied locations).
Sampling Localization SamplesS. aureus(%)MRSA(%)
Nasal cavity3637019.33448.6
Ears36312133.38066.1
Perineum3634512.42044.4
Lesions11872.7675
Dermatitis6583.3360
Hepatic abscesses221002100
Conjunctivitis3133.31100
Total110024422.214057.4
Table 4. Correlation between MLST and the clonal complexes of the studied isolates.
Table 4. Correlation between MLST and the clonal complexes of the studied isolates.
MLSTCCMRSAMSSATotal
ST1945CC13013641177
ST425CC425-4242
ST121CC121-77
ST5821CC425-44
ST5826singleton-33
ST398CC398123
ST5CC5-22
ST5822CC1301-1
ST5823CC1301-1
ST5824singleton1-1
ST5825CC130-11
ST5844CC425-11
ST5845CC130-11
Total 140104244
Table 5. Relation among the clonal complex (CC) isolates from rabbits with lesion/s and S. aureus carriers.
Table 5. Relation among the clonal complex (CC) isolates from rabbits with lesion/s and S. aureus carriers.
LesionsRabbitsCC LesionCC NostrilCC EarCC Perineum
DermatitisOC19006CC130/CC425CC425-CC425
ConjunctivitisOC19190CC130CC130CC130CC130
HepatitisOC19275CC130CC130CC130CC130
HepatitisOC19276CC130CC130CC130CC130
Table 6. Characteristics of the MRSA isolates recovered in the different studied high-density towns.
Table 6. Characteristics of the MRSA isolates recovered in the different studied high-density towns.
StrainTownAnatomical LocationMolecular TypingSCCmecIECAntimicrobial Resistance PhenotypeAntimicrobial Resistance Genes
coa/spaMLSTCCagr
1439AlfafaraEarB4 I1ST1945CC130IIIXIscn-sak (group E)PEN-FOXmecC-SCCmecXI
1490CabanesDermatitisB4 I1ST5822CC130IIIXI-PENmecC-SCCmecXI
1564CabanesNostrilB4 I1ST1945CC130IIIXI-SusceptiblemecC-SCCmecXI
1768Castelló de RugatEarB4 I1ST1945CC130IIIXI-PEN-FOXmecC-SCCmecXI
1657ChesteEarD1 I6ST398CC398IV-PEN-FOX-ENO-TETmecA-blaZ-SCCmecV
1660ChesteEarB4 I1ST5823CC130IIIXI-PEN-FOXmecC-SCCmecXI
1651ChestePerineumB4 I1ST1945CC130IIIXI-PEN-FOXmecC-SCCmecXI
1867FauraEarB4 II4ST1945CC130IIIXI-FOXmecC-SCCmecXI
1707GodelletaNostrilB4 I1ST1945CC130IIIXI-PEN-FOXmecC-SCCmecXI
1712GodellertaEarA1 IV1ST5824singletonIIXI-PEN-FOXmecC-SCCmecXI
1620MontavernerEarB4 I1ST1945CC130IIIXI-PEN-FOXmecC-SCCmecXI
1468PedralbaPerineumB4 II4ST1945CC130IIIXI-PEN-FOXmecC-SCCmecXI
1802VilamarxantNostrilB4 I1ST1954CC130IIIXI-PEN-FOXmecC-SCCmecXI
1272VinaròsDermatitisB4 I1ST1945CC130IIIXIscn-sak (group E)PEN-FOXmecC-SCCmecXI
PEN, penicillin; FOX, cefoxitin; ENO, enrofloxacin; TET, tetracycline.

Share and Cite

MDPI and ACS Style

Moreno-Grúa, E.; Pérez-Fuentes, S.; Viana, D.; Cardells, J.; Lizana, V.; Aguiló, J.; Selva, L.; Corpa, J.M. Marked Presence of Methicillin-Resistant Staphylococcus aureus in Wild Lagomorphs in Valencia, Spain. Animals 2020, 10, 1109. https://doi.org/10.3390/ani10071109

AMA Style

Moreno-Grúa E, Pérez-Fuentes S, Viana D, Cardells J, Lizana V, Aguiló J, Selva L, Corpa JM. Marked Presence of Methicillin-Resistant Staphylococcus aureus in Wild Lagomorphs in Valencia, Spain. Animals. 2020; 10(7):1109. https://doi.org/10.3390/ani10071109

Chicago/Turabian Style

Moreno-Grúa, Elena, Sara Pérez-Fuentes, David Viana, Jesús Cardells, Víctor Lizana, Jordi Aguiló, Laura Selva, and Juan M. Corpa. 2020. "Marked Presence of Methicillin-Resistant Staphylococcus aureus in Wild Lagomorphs in Valencia, Spain" Animals 10, no. 7: 1109. https://doi.org/10.3390/ani10071109

APA Style

Moreno-Grúa, E., Pérez-Fuentes, S., Viana, D., Cardells, J., Lizana, V., Aguiló, J., Selva, L., & Corpa, J. M. (2020). Marked Presence of Methicillin-Resistant Staphylococcus aureus in Wild Lagomorphs in Valencia, Spain. Animals, 10(7), 1109. https://doi.org/10.3390/ani10071109

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop