Next Article in Journal
Cell Wall Proteome Profiling of a Candida albicans Fluconazole-Resistant Strain from a Lebanese Hospital Patient Using Tandem Mass Spectrometry—A Pilot Study
Next Article in Special Issue
A Strong Evidence Outbreak of Salmonella Enteritidis in Central Italy Linked to the Consumption of Contaminated Raw Sheep Milk Cheese
Previous Article in Journal
Bioreactor Co-Cultivation of High Lipid and Carotenoid Producing Yeast Rhodotorula kratochvilovae and Several Microalgae under Stress
Previous Article in Special Issue
Survey of Pathogen-Lowering and Immuno-Modulatory Effects Upon Treatment of Campylobacter coli-Infected Secondary Abiotic IL-10−/− Mice with the Probiotic Formulation Aviguard®
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Quantitative Detection of Bifidobacterium longum Strains in Feces Using Strain-Specific Primers

1
State Key Laboratory of Food Science and Technology, Jiangnan University, Lihu Road No.1800, Binhu District, Wuxi 214122, China
2
School of Food Science and Technology, Jiangnan University, Wuxi 214122, China
3
National Engineering Research Center for Functional Food, Jiangnan University, Wuxi 214122, China
4
Institute of Food Biotechnology, Jiangnan University, Yangzhou 225004, China
5
Wuxi Translational Medicine Research Center and Jiangsu Translational Medicine Research, Institute Wuxi Branch, Wuxi 214122, China
6
Beijing Innovation Centre of Food Nutrition and Human Health, Beijing Technology and Business University (BTBU), Beijing 100048, China
7
International Joint Research Laboratory for Probiotics at Jiangnan University, Wuxi 214122, China
*
Author to whom correspondence should be addressed.
Microorganisms 2021, 9(6), 1159; https://doi.org/10.3390/microorganisms9061159
Submission received: 24 April 2021 / Accepted: 20 May 2021 / Published: 28 May 2021
(This article belongs to the Special Issue Foodborne Bacteria–Host Interactions)

Abstract

We adopted a bioinformatics-based technique to identify strain-specific markers, which were then used to quantify the abundances of three distinct B. longum sup. longum strains in fecal samples of humans and mice. A pangenome analysis of 205 B. longum sup. longum genomes revealed the accumulation of considerable strain-specific genes within this species; specifically, 28.7% of the total identified genes were strain-specific. We identified 32, 14, and 49 genes specific to B. longum sup. longum RG4-1, B. longum sup. longum M1-20-R01-3, and B. longum sup. longum FGSZY6M4, respectively. After performing an in silico validation of these strain-specific markers using a nucleotide BLAST against both the B. longum sup. longum genome database and an NR/NT database, RG4-1_01874 (1331 bp), M1-20-R01-3_00324 (1745 bp), and FGSZY6M4_01477 (1691 bp) were chosen as target genes for strain-specific quantification. The specificities of the qPCR primers were validated against 47 non-target microorganisms and fecal baseline microbiota to ensure that they produced no PCR amplification products. The performance of the qPCR primer-based analysis was further assessed using fecal samples. After oral administration, the target B. longum strains appeared to efficiently colonize both the human and mouse guts, with average population levels of >108 CFU/g feces. The bioinformatics pipeline proposed here can be applied to the quantification of various bacterial species.

1. Introduction

Intestinal commensals play an important role in host health via being involved in various aspects of host physiology, such as tissue development, metabolism, and immunomodulation [1,2]. Many of these organisms are believed to be beneficial to the host. Bifidobacterium is a genus of bacterial species that colonizes the gut early in life [3] and is considered beneficial to host health [4]. The abundances of various Bifidobacterium species in the gut vary widely among individuals according to differences in dietary patterns [5,6], age groups [7], and physiological statuses [8]. Among these species, B. longum stands out as a member of the core human microbiome [9] and the most dominant species within the Bifidobacterium genus in the gut, regardless of the host age [7]. B. longum is distributed broadly across subjects of various ages [10], and is among the limited number of bacterial species that can colonize the gut over years [11]. Therefore, B. longum is an excellent example of host–microbe co-evolution, and is considered to be among the most potent probiotic species that are likely to engraft and persist in the gut after oral ingestion [12].
Compared with probiotic strains that merely transit through the gut, those probiotic strains that are able to successfully reside in the gut, would interact closely with the gut immune system, mucosa, epithelial cells, and native microbial communities, thereby possibly harboring better probiotic effects. However, as a consequence of the difficulty of strain-level detection, there is clearly a knowledge gap regarding gut colonization mechanisms of probiotics [13]. Current generally used approaches to detect strain colonization include plate counting and species-level PCR [14,15,16]. However, these methods are not accurate, considering the natural occurrence of phylogenetically related species with the ingested probiotic strains in the indigenous microbiota. Therefore, detection and quantitation of probiotics at the strain level are critically important for accessing gut colonization by various strains, and further understanding their functionality and related mechanistic insight.
Multiple approaches have been developed to measure the presence and abundance of specific probiotic strains in the gastrointestinal tract. Initially, methods based on selective culture medium and colony identification (e.g., bacterial morphology, biochemical analysis, pulsed field gel electrophoresis (PFGE), 16S ribosomal DNA (rDNA) PCR, internally transcribed spacer (ITS)-PCR, random amplified polymorphic DNA (RAPD)-PCR, and monoclonal antibodies) were commonly used [14,17,18,19,20,21]. However, these methods are time consuming, laborious, and often inaccurate. Fluorescence [22] or antibiotic labeling [23], and group-specific fluorescence in situ hybridization (FISH) [24] are also ineffective, because of the recurrent loss of plasmids with these tags by strains during gut transition, the low detection sensitivity of fluorescence signals, and safety considerations regarding the application of these approaches in human subjects. Species-specific PCR assays that target 16S rDNA variable regions or 16S-23S ITS rDNA sequences have also been used to directly determine ingested probiotic strains in fecal samples [25,26]. However, this approach cannot distinguish the target strain from phylogenetically related species present in the baseline microbiota. Recently, with the accumulation of sequenced bacterial genomes, strain-specific gene markers have been identified at unprecedented speeds, impelling us to use these unique markers to detect and quantify strains using molecular methods.
Strain-specific detection depends on the identification of DNA regions unique to specific strains. Before the era of large-scale genomic sequencing, selected RAPD electrophoresis bands, specific DNA fragments from suppression subtractive hybridization (SSH), or known sequences related to specific traits (e.g., Lactobacillus rhamnosus GG (LGG) harbors a pili structure, but LC705 does not) were used to design strain-specific primers for qualification of some probiotic strains in the gut/fecal samples, including LGG [27], B. bifidum OLB6378 [28], L. gasseri K7 [29], B. breve Yakult [30], and L. reuteri DSM 16350 [31]. However, this strain specificity remained within narrow confidence intervals because the identification of the strain-specific DNA regions was based on a limited number of bacterial strains. Additionally, these methods usually required pure cultures of various bacterial strains for laborious electrophoretic analyses. Fortunately, recent emerged bioinformatics strategies based on the sequenced bacterial genomes provide an alternative to find nearly “true” strain-specific DNA sequences. Theoretically, some bioinformatics pipelines (Pan-Seq [32], PGAT [33], PGAP [34], and Roary [35]) can be used to search bacterial strain-specific DNA segments, which can subsequently be used as templates for strain-specific primers. However, no previous study has used these bioinformatics tools to identify strain-specific sequences and achieve strain-level bacterial detection.
In this study, we selected B. longum sup. longum as an example due to the fact that it has been reported to be the most potent probiotic species with long-term gut colonization potential, and used genomics analyses to identify DNA sequences specific to three B. longum sup. longum strains isolated from the fecal samples of three Chinese subjects. First, we used a Roary-based pangenome analysis to identify unique gene markers that were present only in a single strains of B. longum sup. longum but absent from all the other strains of this species. Next, we validated this strain specificity in the context of other microbes and the baseline microbiota, and then targeted these unique sequences to design strain-specific primers. Finally, we applied these strain-specific primers and quantitative PCR (qPCR) to quantify the colonized biomasses of these three B. longum sup. longum strains in the feces of humans and mice after ingestion.

2. Materials and Methods

2.1. Bacterial Strains, Culture Conditions and Genomic DNA Extraction

As shown in Table 1, 48 bacterial strains were used in this study. The genomic DNA of each bacterial strain was extracted using rapid bacterial genomic DNA isolation kit (Sangon Biotech Co., Ltd., Shanghai, China).

2.2. Bacterial Genome Sequencing and Retrieval of Publicly Available Genomes

Three B. longum strains (RG4-1, FGSZY6M4, and M1-20-R01-3) were isolated from fecal samples of three Chinese individuals, and under genome sequencing by Illumina HiSeq 2000. Briefly, a paired-end sequencing library (average insert size of 350 bp and maximum read length of 150 bp) was built according to manufacturers’ instructions (Illumina Inc., San Diego, CA, USA). On average, 3 GB paired-end raw reads were generated for each sample. After removing adaptors and low-quality reads, the resulting clean reads were assembled using SOAPdenovo v2.04 Software for short-read de novo assembler, BGI HK Research Institute: Hong Kong, China, 2012 [36], as described previously [37]. A total of 202 publicly available B. longum genomes were downloaded from National Center for Biotechnology Information (NCBI) database (Table 2). In total, 205 B. longum assemblies were finally used in this study.

2.3. Single Nucleotide Polymorphism (SNP) Calling and Phylogeny Reconstruction

The SNPs were recalled for 205 B. longum genomes by mapping the assemblies against the reference genome (B. longum NCC 2705) using MUMmer [38], as previously described [37], and only bi-allelic SNPs in the core genome were included in following analysis. The sequences of concatenated SNPs were used to construct phylogenetic tree (neighbor-joining method) using TreeBest (http://treesoft.sourceforge.net/treebest.shtml, accessed on 23 September 2020). It should be mentioned that before conducting the above phylogenetic analysis, we confirmed that the used 205 B. longum assemblies belonged to B. longum sup. longum by building a phylogenetic tree based on core genome bi-SNPs with the genomes of B. longum subsp. suillum, B. longum subsp. infantis, and B. longum subsp. suis as the outgroup.

2.4. Identification of Strain-Specific Markers

B. longum genomes were re-annotated using Prokka [39], and the obtained protein sequences were used to perform pangenome analysis via Roary (with a minimum BLASTP percentage identity of 90%) [35]. The genes that were only present in a single newly sequenced strain (RG4-1, FGSZY6M4 or M1-20-R01-3) and absent from all the other 204 strains were preliminarily identified. Considering the above gene presence/absence analysis was conducted at the protein level, we further validated the specificity of these strain-specific genes in nucleotide level. A nucleotide database containing 205 B. longum genomes was constructed using the makeblastdb command, and the above strain-specific gene sequences were analyzed through BLASTN against this database [40]. The DNA sequences that were only present in the target strain were retained. After the validation for intra-species specificity, we then tested the specificity of the DNA sequences under the background of all the representative microbes via website-based nucleotide BLAST against NR/NT database of NCBI database. The DNA sequences showing no hit in the database were finally selected.

2.5. Design of Strain-Specific Primers and Validation of Their Specificity via Electrophoresis

Based on the selected strain-specific DNA sequence for each B. longum strain, we designed corresponding qPCR primer pairs using Primer Premier5.0. The specificity of each primer pair was checked by Primer-blast in NCBI database. We conducted three titers of electrophoresis analysis to evaluate the primer specificity. For the intra-species specificity, another ten B. longum strains, in addition to each target strain (RG4-1, FGSZY6M4 or M1-20-R01-3), were used. For the intra-genus specificity within Bifidobacterium, six other Bifidobacterium species were selected. For the specificity against other gut bacteria, 32 representative members of intestinal microbes were adopted. Genome DNA was extracted for each strain, and amplification was performed using the designed strain-specific primers. Bio-Rad T100 Thermal Cycler was used for PCR amplifications. Each reaction mixture (50 µL) consisted of 2 µL bacterial genomic DNA, 25 µL 2× Taq Plus MasterMix, 2 µL forward primer (0.4 µmol in the final mixture), 2 µL reverse primer (0.4 µmol in the final mixture), and 19 µL ddH2O. The PCR conditions were as follows: 94 °C for 2 min, followed by 94 °C for 30 s, 65 °C for 30 s, and 72 °C for 30 s conducting 35 cycles, and then 72 °C for 2 min. The electrophoresis analysis was conducted to separate PCR products at 120 V using a 1.5% agarose gel.

2.6. Strain-Specific qPCR Designs and Standard Curves for Absolute Quantification

To evaluate the specificity of these strain-specific primer pairs against the background of complex fecal bacterial communities, we collected fecal samples from 30 humans and 15 mice. These samples were all the bassline samples (i.e., before B. longum administration) in the following described animal experiment and human trial. The fecal DNA was extracted using FastDNA Spin Kit for Soil (Catalog number: 116570200, MP Biomedicals, Santa Ana, CA, USA) according to the manufacturers’ instructions. The PCR program was optimized to ensure no positive amplification for these baseline samples. Positive control with DNA of each target B. longum strain and negative control using water instead of genomic DNA were included in all PCR runs. The PCR system (20 μL) consisted of 2 μL genomic DNA (template), 10 μL 2× supermix (BIO-RAD), 2 µL forward primer (0.4 µmol in the final mixture), 2 µL reverse primer (0.4 µmol in the final mixture), and 4 µL ddH2O. The following qPCR program yielded the most selective amplification: an initial denaturation step at 95 °C for 2 min; 30 cycles of denaturation at 95 °C for 5 s and annealing/extension at 65 °C for 30 s; a melt curve analysis between 65 °C and 95 °C in 0.5 °C increments at 2–5 s/step; and polymerase activation and DNA denaturation at 95 °C for 5 min.
For absolute quantification of target B. longum strains, standard curves were prepared. A pure culture-based standard series of each target B. longum strain was obtained using DNA extracted from a tenfold dilution series of each B. longum strain in MRS (16 h). The exact bacterial cell numbers of the first serial decimal dilution were determined using plate counting. Cycle threshold values (CT) were plotted versus equivalent log cell numbers. The amplification efficiency of each design was determined by the slope of the standard curves: E (%) = (10−1/slope − 1) × 100.

2.7. Quantification of Ingested B. longum Strains in the Fecal Samples

Each B. longum-specific qPCR system was used to access the colonized biomass of corresponding target strain in the gut of mice after strain administration. For animal experiments, 5-week-old male Balb/c mice used in this study were purchased from the Shanghai Laboratory Animal Center (Shanghai, China). Animal care and study protocols were approved by the Ethics Committee of Jiangnan University, China (JN. No20181130b1200130[261]). All of the applicable institutional and national guidelines for the care and use of animals were followed. All mice were kept in the mouse facility of the Laboratory Animal Center of the Department of Food Science and Technology, Jiangnan University, Wuxi, China, on a 12-h light/dark cycle in a temperature-(22 °C ± 1 °C) and humidity-controlled (55% ± 10%) room. Mice were assigned to three experiment groups (n = 5): the RG4-1 group, the FGSZY6M4 group and the M1-20-R01-3 group. The experimental period was 14 days, including a 7-day accommodation period, and followed by a 7-day B. longum intervention period. MRS broth-cultured B. longum strains, after being resuspended in sterile saline, were prepared each day, and routinely subjected to plate counting to ensure a gavage dose of 108–109 CFU/d for each mouse. Fecal samples were collected at day 7 and day 14.
For the human trial, the 30 volunteers were students at Jiangnan University who ranged in age from 20 to 30 years. No use of antibiotics was reported by the subjects within the 1 month before or during the study, and probiotic foods were not allowed during the trial. The experimental period included a 2-week baseline period (without any treatment) and a 2-week probiotic intervention period. The subjects were randomly assigned to three groups (n = 10 for each group), in which each subject in each B. longum intervention group (RG4-1, FGSZY6M4 or M1-20-R01-3) was administrated 109–1010 viable cells/d of the corresponding B. longum strain. Fecal samples were collected at day 14 (±3 days) of the baseline period, and day 14 (±3 days) of the treatment period. The colonized biomass of the three B. longum strains in fecal samples was determined using the respective qPCR primers. All volunteers provided informed consent. The Ethics Committee of Jiangnan University (Wuxi, China) provided ethical clearance for this human trial in accordance with the Declaration of Helsinki.
The colonized biomass of each B. longum strains was confirmed by selective culture medium with colony typing with the designed strain-specific primers. In brief, fecal samples were used to isolate bifidobacteria by cultivation on deMan Rogosa Sharpe (MRS) agar supplemented with 50 mg/L mupirocin and 0.1% L-cysteine HCl. After incubation at 37 °C for 48 h in an anaerobic chamber (80% N2, 10% H2, 10% CO2), colonies were counted, picked, and then subjected to conventional PCR using the strain-specific primers.

3. Results

3.1. Genomic Diversity of B. longum

We reconstructed a phylogenetic tree based on three newly sequenced and 202 publicly available B. longum strain genomes (Table 2 and Table 3, and Figure 1A), and calculated the pair-wise genetic distances and accessory gene numbers to reveal the intra-species genomic diversity (Figure 1B–D). The parameters for the newly sequenced genomes are shown in Table 3. As shown in Figure 1A, the three B. longum strains (RG4-1, M1-20-R01-3, and FGSZY6M4) isolated from the fecal samples of three Chinese individuals are closely clustered in the phylogenetic tree. This is unsurprising, because the majority of publicly available strains were isolated from geographically distant areas (i.e., other countries or continents). Nevertheless, the three strains exhibited obvious genetic distances indicative of their distinct genotypes.
We also determined the number of variable SNPs in the core genomes of 205 B. longum strains (Figure 1B). The results indicated that the average SNP distance across the 205 strains was 6691. The most phylogenetically related strains exhibited an SNP distance of 0, while the most phylogenetically distant strains exhibited an SNP distance of 11,145. For each of the three novel B. longum strains, the minimum genetic distances between the respective strain and the other 204 strains in the dataset were 6000 (RG4-1), 5257 (M1-20-R01-3), and 8514 (FGSZY6M4). These data further confirm the genetic differences between each of these three B. longum strains and the other strains (Figure 1C). As shown in Figure 1D, the pangenome analysis indicated that accessory genes accounted for 85.1% of the total genes, and that new genes were accumulated frequently as new strains were added to the analysis.
Overall, B. longum showed a high level of intra-species genomic diversity in terms of the pair-wise SNP distances and the total numbers of accessory genes. The target strains selected for strain-specific detection were phylogenetically distinct and exhibited considerable genetic dissimilarity with the other strains in this dataset, thus implying the possibility of finding appropriate strain-specific markers.

3.2. In Silico Identification and Validation of Strain-Specific Gene Markers

Considering the relatively high intra-species genetic similarity relative to inter-species and inter-genus similarities, we initially searched for strain-specific genes within the B. longum genomes. The pipeline used to construct a strain-specific detection tool is shown in Figure 2A. The publicly available B. longum genomes used in this study were derived from different projects, and the formats of their annotation files were not uniform, which prevented a pangenome analysis. Accordingly, we re-annotated these publicly available genomes and the three target B. longum strain genomes using Prokka, and then conducted a gene presence/absence analysis based on the annotated protein sequences. We defined unique genes (present in only one strain within the dataset of 205 strains), core genes (present in ≥99% of strains), soft core genes (present in ≥95% to <99%), shell genes (present in ≥15% to <95%), and cloud genes (present in ≥0.5% to <15%). As shown in Figure 2B, this analysis preliminarily identified 2398 strain-specific genes across the 205 B. longum strains, which accounted for 28.7% of the total genes. Notably, 32, 14, and 49 strain-specific genes were identified, respectively, for B. longum RG4-1 (Table 4), B. longum M1-20-R01-3 (Table 5), and B. longum FGSZY6M4 (Table 6).
Next, we explored whether the specificities of the identified strain-specific genes would be maintained against other microbial taxa. Rather than using amino acid sequences in Roary analysis, we tested the specificities of the preliminary strain-specific genes at the nucleotide level using an in-house nucleotide BLAST against a B. longum genome database to further ensure the strain-specificity of the identified genes. We also used a website-based nucleotide BLAST tool against the NR/NT database (NCBI) to determine which sequences could not be identified in any other representative microbes. Finally, this screening process identified RG4-1_01874 (1331 bp), M1-20-R01-3_00324 (1745 bp), and FGSZY6M4_01477 (1691 bp), which were selected as the target DNA sequences for strain-specific quantification.

3.3. Strain-Specific qPCR Designs and Electrophoretic Validation

Next, qPCR primer pairs were designed for each of the three B. longum strains (RG4-1, M1-20-R01-3, and FGSZY6M4) based on their respective strain-specific DNA sequences (Table 7), with predicted product sizes of 115, 199, and 144 bp, respectively. Using electrophoresis, the specificities of the three qPCR probe sets were validated against genomic DNA derived from various microbial strains (Table 1), including 10 other B. longum strains, 6 other Bifidobacterium species, and 32 representative members of the intestinal microbiome. The results indicated that PCR amplification based on the strain-specific primers was only successful for each of the respective target strains, and no amplification of genomic material from non-target microorganisms was observed (Figure 3). Multiple qPCR primer pairs were designed for each target strain, and the primers with the best performance at this stage were selected and are reported here.

3.4. Specificities, Standard Curves, and Amplification Efficiencies of qPCR Assays

Primer specificity was evaluated by qPCR against a complex microbial community present in baseline fecal samples that had not been enriched for the target strain (i.e., pre-treatment). The DNA of each target B. longum strain was used as a positive control in the qPCR runs. Under optimized conditions, no amplification was observed for the baseline samples, whereas the positive controls exhibited good amplification. As shown in Figure 4, standard curves corresponding to RG4-1, M1-20-R01-3, and FGSZY6M4 exhibited good linearity over a 4-log range (103–107 CFU/qPCR system, R2 > 0.99), a 5-log range (101–106 CFU/qPCR system, R2 > 0.99) and a 4-log range (103–107 CFU/qPCR system, R2 > 0.99), respectively. The equations of the regression curves for RG4-1, M1-20-R01-3, and FGSZY6M4 were as follows: Ct = −3.4789lgCFU + 38.217, Ct = −3.5901lgCFU + 35.128, and Ct = −3.2936lgCFU + 38.371; and the corresponding amplification efficiencies were 93.8%, 90.0% and 101.2%, respectively. Collectively, the three qPCR primer pairs exhibited specificity in the context of the complex bacterial communities in fecal samples from both humans and mice, the standard curves used for absolute quantification were of good linearity, and the amplification efficiencies were qualified, suggesting that these primers can be used to detect the abundances of the target B. longum strains in fecal samples.

3.5. Quantification of Ingested B. longum Strains in Mouse and Human Fecal Samples

We used the strain-specific primers to detect the abundances of three target B. longum strains in the feces of mice and human volunteers who had consumed these B. longum strains (Figure 5). For the animal experiments, the colonized biomasses of the three B. longum strains in samples collected 1 week after oral administration exceeded 108 CFU/g feces, with average abundances of 1.54 × 109 CFU/g feces for RG4-1, 4.60 × 108 CFU/g feces for M1-20-R01-3, and 1.06 × 109 CFU/g feces for FGSZY6M4. For the human trial, the average population levels of each strain reached >108 CFU/g feces, with average abundances of 4.00 × 108 CFU/g feces for RG4-1, 3.78 × 108 CFU/g feces for M1-20-R01-3, and 7.18 × 108 CFU/g feces for FGSZY6M4. These results indicate that orally ingested B. longum strains can be detected at considerable levels in the feces of both mice and humans during a period of intervention, suggesting short-term engraftment of the ingested bacteria in the gut. The colonized abundances of the three B. longum strains obtained from selective culture medium combined with colony typing using our specific qPCR primers further confirmed the conclusion of short-term engraftment by those strains, despite the bacterial numbers detected by this culture-dependent method were generally 10-fold lower (Figure 5).

4. Discussion

It has become increasingly clear that the beneficial effects of probiotic bacteria on the host are strain-specific, and the viability of probiotic strains in the gut after ingestion is believed to be an essential factor for them to demonstrate health-promoting functions. Therefore, determining the presence and colonized biomasses of specific probiotic strains in the gut is a key step toward the informed use of probiotics for therapeutic ends. Compared with traditional microbiological methods (e.g., selective media with colony identification), PCR-based molecular methods, which can distinguish the target strain from the baseline microbiota, are the most popular because of their superior sensitivity and specificity [13]. Here, we adopted a pangenome analysis-based approach to identify strain-specific DNA sequences and designed qPCR primers based on these unique markers, which enabled us to detect B. longum strains in fecal samples at a strain-level resolution. In addition to determining the abundances of probiotic bacteria at the strain level, this strategy advantageously involves the identification of strain-specific sequences based on a large set of bacterial genomes. The resulting strain-specificity was more “true” than those identified in an RAPD analysis based on a restricted number of pure cultured bacteria.
This is the first known example of using a bioinformatics method to search for unique gene markers and design strain-specific molecular tools to detect and quantify individual bacterial strains. Previous studies have used the abovementioned RAPD methods to identify strain-specific sequences against a background of a limited number of strains of the same species. Daranas et al. screened a unique marker of L. plantarum PM411 against seven other L. plantarum strains in an assay based on seven random RAPD primers [41]. In another study, B. bifidum BF-1 was detected by targeting a strain-specific sequence in an analysis involving 27 RAPD primers and 30 B. bifidum strains [42]. In this study, we identified 32, 14, and 49 strain-specific genes corresponding to B. longum RG4-1 (Table 5), B. longum M1-20-R01-3 (Table 6), and B. longum FGSZY6M4, respectively (Table 7), in the context of 205 B. longum genomes. Obviously, our pangenome-based approach could identify a larger number of strain-specific fragments within a wider confidence interval, because it uses whole genome sequences rather than random PCR products, and a large set of bacterial genomes rather than a limited number of available pure cultures. In addition, we also observed a high frequency of strain-specific sequences among B. longum isolates. Specifically, we detected 2398 strain-specific genes among 205 B. longum strains, which accounted for 28.7% of the total genes, and 178 of these strains harbored unique gene markers. Our data suggest the existence of considerable intra-species genomic diversity within B. longum in terms of the accessory gene number. This finding allowed us to construct strain-specific primers to identify and quantify most of these strains based on single gene markers. For those strains without unique genes, future approaches may use two or more gene sequences as unique combination amplification targets.
The strain-specific sequences identified in this study were first confirmed in silico, by electrophoresis and by the absence of qPCR amplification signals in baseline microbiota of the tested fecal samples derived from humans and mice. In previous studies, strain-specific sequences identified using RAPD methods often showed homology with sequences from other microbes and thus were not truly strain-specific. A previous BLAST analysis of a B. bifidum OLB6378-specific RAPD fragment showed a high similarity (98%) to the parB gene sequences in publicly available B. bifidum genomes [28]. The strain-specific RAPD band identified by Karjalainen et al., and used for the strain-level detection of Propionibacterium freudenreichii (P. freudenreichii). JS was found to encode a 103-bp region with 91% identity to P. freudenreichii ssp. shermanii CIRM-BIA1 [43]. Similarly, the unique RAPD band for B. breve 99 was shown to contain regions homologous to those detected in strains of B. longum, B. adolescentis, B. dentium Bd1, and B. animalis ssp. lactis [43]. In this study, we validated the strain-specific sequences identified preliminarily via nucleotide BLAST against a self-constructed database of the 205 B. longum genomes and further checked the specificities of the sequences against all available gene information from representative microbes via searching the NR/NT NCBI database. Our selected strain-specific fragments (RG4-1_01874, M1-20-R01-3_00324, and FGSZY6M4_01477) passed the nucleotide BLAST against the B. longum genome database and generated no hits in the NR/NT database. Therefore, the strain-specific sequences identified in this study were highly specific against a background of various microbes and can probably be applied in a broader taxonomic context. We further validated the specificities of the newly designed qPCR primers via conventional PCR against 10 other B. longum strains, 6 other Bifidobacterium species, and 32 representative members of the intestinal microbiome. We additionally confirmed the specificities of the primers by the absence of qPCR amplification products from fecal samples derived from both humans and mice that were free from the target B. longum strains.
The bioinformatics pipeline proposed in this study can be expanded to search for strain-specific markers and achieve strain-level qualifications of various bacteria, including probiotic species. A large number of genomes corresponding to probiotic Lactobacillus and Bifidobacterium species have been sequenced and made publicly available, including 544 L. plantarum, 198 L. paracasei, 112 B. breve, and 176 L. salivarius genomes in the NCBI database. Previous genomic analyses of these species have demonstrated open pangenomes, high intra-species genomic diversity, and high new gene discovery rates for L. salivarius [44,45] and L. casei [46] as the number of included genomes increases. Therefore, the pipeline constructed here can be directly translated for use in other probiotic species, provided that sufficient genomic data and abundant strain-specific genes are available. For this study, we selected Roary because of the simple command line and relatively higher running speed compared with other available tools. Other pangenome analysis tools, such as Pan-Seq [32], PGAT [33], and PGAP [34], are also suitable choices for constructing strain-specific primers.
Our qPCR assays further indicated that the three target B. longum strains could colonize the guts of both humans and mice at high levels of abundance (>108 CFU/g feces for both humans and mice) during an intervention period (1 week for mice and 2 weeks for humans), and the colonized biomasses were validated using selective culture and colony-typing methods with the strain-specific primers. Absolute qualification was achieved using highly linear standard curves (R2 > 0.99) and amplification efficiency was qualified (>90.0%), both of which are comparable to previous studies [41]. In line with our results, a previous study demonstrated that at 2 weeks post-ingestion, the abundances of B. longum AH1206 ranged from 107 to 1010 cells/g feces in human subjects [47]. Selective culture methods combined with strain typing using our strain-specific primers confirmed the colonization of these target B. longum strains. However, the bacterial numbers generated using this culture-based method were nearly 10-fold lower than those determined using qPCR. We attribute this underestimation to an inherent defect of culture-based methods, as previous studies have reported that both the frequencies and numbers of bacterial cells detected in feces by culture methods were substantially lower than the corresponding values obtained using qPCR [42,48]. In addition, PCR with our strain-specific primers enabled us to identify colonies of the three B. longum strains on selective agar efficiently and accurately.

5. Conclusions

In conclusion, benefiting from the large number of sequenced genomes of probiotic species, we took the most potent probiotic gut colonizer, B. longum, as an example, and proposed a precedent in which a pangenome analysis-based approach can be used to identify unique gene markers for a given bacterial strain, and targeted these markers to achieve strain-level qualification. The qPCR primers designed in this study were able to successfully detect and quantify the colonized biomasses of the given B. longum strains in fecal samples from humans and mice. Therefore, we demonstrated the ability of these efficient in silico analyses to replace existing time- and labor-intensive RAPD methods. Furthermore, by including as many bacterial genomes as possible, the annotated unique sequences are highly specific and can be applied in a broader taxonomic context involving a more complex microbial ecology. The pipeline constructed herein can also be adapted to identify strain-specific markers and design strain-level qPCR primers for other probiotic species.

Author Contributions

Conceptualization, Y.X., C.W., J.Z., H.Z., W.C. and Q.Z.; Data curation, Y.X.; Formal analysis, Y.X.; Funding acquisition, W.C. and Q.Z.; Investigation, Y.X. and Q.Z.; Methodology, Y.X.; Project administration, J.Z., H.Z., W.C. and Q.Z.; Resources, J.Z., H.Z., W.C. and Q.Z.; Software, Y.X.; Supervision, J.Z., H.Z., W.C. and Q.Z.; Validation, Y.X. and Q.Z.; Visualization, Y.X. and C.W.; Writing—original draft, Y.X. and J.Z.; Writing—review & editing, Y.X., C.W., J.Z., H.Z., W.C. and Q.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China Program [No. 31820103010 and No. 31871773]; Projects of Innovation and Development Pillar Program for Key Industries in Southern Xinjiang of Xinjiang Production and Construction Corps [2018DB002]; National Key Research and Development Project [No. 2018YFC1604206]; National First-Class Discipline Program of Food Science and Technology [JUFSTR20180102]; the BBSRC Newton Fund Joint Centre Award; and Collaborative Innovation Center of Food Safety and Quality Control in Jiangsu Province.

Institutional Review Board Statement

Animal care and study protocols were approved by the Ethics Committee of Jiangnan University, China (JN. No20181130b1200130[261]). All of the applicable institutional and national guidelines for the care and use of animals were followed. For the human trial, the Ethics Committee of Jiangnan University (Wuxi, China) provided ethical clearance for this human trial according to the Helsinki Declaration.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Data in this study are available from the authors upon request.

Conflicts of Interest

There are no conflict of interest to declare.

References

  1. Kamada, N.; Chen, G.Y.; Inohara, N.; Núñez, G. Control of pathogens and pathobionts by the gut microbiota. Nat. Immunol. 2013, 14, 685–690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Kau, A.L.; Ahern, P.P.; Griffin, N.W.; Goodman, A.L.; Gordon, J.I. Human nutrition, the gut microbiome and the immune system. Nat. Cell Biol. 2011, 474, 327–336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Korpela, K.; de Vos, W.M. Early life colonization of the human gut: Microbes matter everywhere. Curr. Opin. Microbiol. 2018, 44, 70–78. [Google Scholar] [CrossRef] [Scilit]
  4. Hidalgo-Cantabrana, C.; Delgado, S.; Ruiz, L.; Ruas-Madiedo, P.; Sánchez, B.; Margolles, A. Bifidobacteria and Their Health-Promoting Effects. Tuberc. Nontuberculous Mycobact. Infect. 2018, 73–98. [Google Scholar] [CrossRef] [Scilit]
  5. Krumbeck, J.A.; Maldonado-Gomez, M.X.; Martínez, I.; Frese, S.A.; Burkey, T.E.; Rasineni, K.; Ramer-Tait, A.E.; Harris, E.N.; Hutkins, R.W.; Walter, J. In Vivo Selection To Identify Bacterial Strains with Enhanced Ecological Performance in Synbiotic Applications. Appl. Environ. Microbiol. 2015, 81, 2455–2465. [Google Scholar] [CrossRef] [Scilit]
  6. Wu, G.; Zhang, C.; Wu, H.; Wang, R.; Shen, J.; Wang, L.; Zhao, Y.; Pang, X.; Zhang, X.; Zhao, L.; et al. Genomic Microdiversity of Bifidobacterium pseudocatenulatum Underlying Differential Strain-Level Responses to Dietary Carbohydrate Intervention. mBio 2017, 8, e02348-16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Arboleya, S.; Watkins, C.; Stanton, C.; Ross, R.P. Gut Bifidobacteria Populations in Human Health and Aging. Front. Microbiol. 2016, 7, 1204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Gevers, D.; Kugathasan, S.; Denson, L.A.; Vázquez-Baeza, Y.; Van Treuren, W.; Ren, B.; Schwager, E.; Knights, D.; Song, S.J.; Yassour, M.; et al. The Treatment-Naive Microbiome in New-Onset Crohn’s Disease. Cell Host Microbe 2014, 15, 382–392. [Google Scholar] [CrossRef] [Scilit]
  9. Schloissnig, S.; Arumugam, M.; Sunagawa, S.; Mitreva, M.; Tap, J.; Zhu, A.; Waller, A.; Mende, D.R.; Kultima, J.R.; Martin, J.; et al. Genomic variation landscape of the human gut microbiome. Nat. Cell Biol. 2013, 493, 45–50. [Google Scholar] [CrossRef] [Scilit]
  10. Odamaki, T.; Bottacini, F.; Kato, K.; Mitsuyama, E.; Yoshida, K.; Horigome, A.; Xiao, J.-Z.; Van Sinderen, D. Genomic diversity and distribution of Bifidobacterium longum subsp. longum across the human lifespan. Sci. Rep. 2018, 8, 1–12. [Google Scholar] [CrossRef] [Scilit]
  11. Faith, J.J.; Guruge, J.L.; Charbonneau, M.; Subramanian, S.; Seedorf, H.; Goodman, A.L.; Clemente, J.C.; Knight, R.; Heath, A.C.; Leibel, R.L.; et al. The Long-Term Stability of the Human Gut Microbiota. Science 2013, 341, 1237439. [Google Scholar] [CrossRef] [Scilit]
  12. Walter, J.; Maldonado-Gómez, M.X.; Martínez, I. To engraft or not to engraft: An ecological framework for gut microbiome modulation with live microbes. Curr. Opin. Biotechnol. 2018, 49, 129–139. [Google Scholar] [CrossRef] [Scilit]
  13. Xiao, Y.; Zhao, J.; Zhang, H.; Zhai, Q.; Chen, W. Mining Lactobacillus and Bifidobacterium for organisms with long-term gut colonization potential. Clin. Nutr. 2020, 39, 1315–1323. [Google Scholar] [CrossRef] [Scilit]
  14. Panigrahi, P.; Parida, S.; Pradhan, L.; Mohapatra, S.S.; Misra, P.R.; Johnson, J.A.; Chaudhry, R.; Taylor, S.; Hansen, N.I.; Gewolb, I.H. Long-term Colonization of a Lactobacillus plantarum Synbiotic Preparation in the Neonatal Gut. J. Pediatr. Gastroenterol. Nutr. 2008, 47, 45–53. [Google Scholar] [CrossRef] [Scilit]
  15. Spanhaak, S.; Havenaar, R.; Schaafsma, G. The effect of consumption of milk fermented by Lactobacillus casei strain Shirota on the intestinal microflora and immune parameters in humans. Eur. J. Clin. Nutr. 1998, 52, 899–907. [Google Scholar] [CrossRef] [Scilit]
  16. Toscano, M.; De Grandi, R.; Miniello, V.L.; Mattina, R.; Drago, L. Ability of Lactobacillus kefiri LKF01 (DSM32079) to colonize the intestinal environment and modify the gut microbiota composition of healthy individuals. Dig. Liver Dis. 2017, 49, 261–267. [Google Scholar] [CrossRef] [Scilit]
  17. Jacobsen, C.N.; Nielsen, V.R.; Hayford, A.E.; Møller, P.L.; Michaelsen, K.F.; Pærregaard, A.; Sandström, B.; Tvede, M.; Jakobsen, M. Screening of Probiotic Activities of Forty-Seven Strains of Lactobacillus spp. by In Vitro Techniques and Evaluation of the Colonization Ability of Five Selected Strains in Humans. Appl. Environ. Microbiol. 1999, 65, 4949–4956. [Google Scholar] [CrossRef] [Scilit]
  18. Fujiwara, S.; Seto, Y.; Kimura, A.; Hashiba, H. Intestinal transit of an orally administered streptomycin-rifampicin-resistant variant ofBifidobacterium longumSBT2928: Its long-term survival and effect on the intestinal microflora and metabolism. J. Appl. Microbiol. 2001, 90, 43–52. [Google Scholar] [CrossRef] [Scilit]
  19. Frese, S.A.; Hutton, A.A.; Contreras, L.N.; Shaw, C.A.; Palumbo, M.; Casaburi, G.; Xu, G.; Davis, J.C.C.; Lebrilla, C.B.; Henrick, B.M.; et al. Persistence of Supplemented Bifidobacterium longum subsp. infantis EVC001 in Breastfed Infants. mSphere 2017, 2, e00501-17. [Google Scholar] [CrossRef] [Scilit]
  20. Saxelin, M.; Pessi, T.; Salminen, S. Fecal recovery following oral administration of Lactobacillus Strain GG (ATCC 53103) in gelatine capsules to healthy volunteers. Int. J. Food Microbiol. 1995, 25, 199–203. [Google Scholar] [CrossRef] [Scilit]
  21. Yuki, N.; Watanabe, K.; Mike, A.; Tagami, Y.; Tanaka, R.; Ohwaki, M.; Morotomi, M. Survival of a probiotic, Lactobacillus casei strain Shirota, in the gastrointestinal tract: Selective isolation from faeces and identification using monoclonal antibodies. Int. J. Food Microbiol. 1999, 48, 51–57. [Google Scholar] [CrossRef] [Scilit]
  22. Lee, Y.K.; Ho, P.S.; Low, C.S.; Arvilommi, H.; Salminen, S. Permanent Colonization by Lactobacillus casei Is Hindered by the Low Rate of Cell Division in Mouse Gut. Appl. Environ. Microbiol. 2004, 70, 670–674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Denou, E.; Pridmore, R.D.; Berger, B.; Panoff, J.-M.; Arigoni, F.; Brüssow, H. Identification of Genes Associated with the Long-Gut-Persistence Phenotype of the Probiotic Lactobacillus johnsonii Strain NCC533 Using a Combination of Genomics and Transcriptome Analysis. J. Bacteriol. 2008, 190, 3161–3168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Valeur, N.; Engel, P.; Carbajal, N.; Connolly, E.; Ladefoged, K. Colonization and Immunomodulation by Lactobacillus reuteri ATCC 55730 in the Human Gastrointestinal Tract. Appl. Environ. Microbiol. 2004, 70, 1176–1181. [Google Scholar] [CrossRef] [Scilit]
  25. Tobin, J.M.; Garland, S.M.; Jacobs, S.E.; Pirotta, M.; Tabrizi, S.N. Rapid assay to assess colonization patterns following in-vivo probiotic ingestion. BMC Res. Notes 2013, 6, 252. [Google Scholar] [CrossRef] [Scilit]
  26. Massi, M.; Vitali, B.; Federici, F.; Matteuzzi, D.; Brigidi, P. Identification method based on PCR combined with automated ribotyping for tracking probiotic Lactobacillus strains colonizing the human gut and vagina. J. Appl. Microbiol. 2004, 96, 777–786. [Google Scholar] [CrossRef] [Scilit]
  27. Kankainen, M.; Paulin, L.; Tynkkynen, S.; von Ossowski, I.; Reunanen, J.; Partanen, P.; Satokari, R.; Vesterlund, S.; Hendrickx, A.P.A.; Lebeer, S.; et al. Comparative genomic analysis of Lactobacillus rhamnosus GG reveals pili containing a human- mucus binding protein. Proc. Natl. Acad. Sci. USA 2009, 106, 17193–17198. [Google Scholar] [CrossRef] [Scilit]
  28. Toshimitsu, T.; Nakamura, M.; Ikegami, S.; Terahara, M.; Itou, H. Strain-Specific Identification ofBifidobacterium bifidumOLB6378 by PCR. Biosci. Biotechnol. Biochem. 2013, 77, 572–576. [Google Scholar] [CrossRef] [Scilit]
  29. Treven, P.; Turkova, K.; Trmčić, A.; Obermajer, T.; Rogelj, I.; Matijašić, B.B. Detection and quantification of probiotic strain Lactobacillus gasseri K7 in faecal samples by targeting bacteriocin genes. Folia Microbiol. 2013, 58, 623–630. [Google Scholar] [CrossRef] [Scilit]
  30. Fujimoto, J.; Tanigawa, K.; Kudo, Y.; Makino, H.; Watanabe, K. Identification and quantification of viable Bifidobacterium breve strain Yakult in human faeces by using strain-specific primers and propidium monoazide. J. Appl. Microbiol. 2010, 110, 209–217. [Google Scholar] [CrossRef] [Scilit]
  31. Sattler, V.A.; Mohnl, M.; Klose, V. Development of a Strain-Specific Real-Time PCR Assay for Enumeration of a Probiotic Lactobacillus reuteri in Chicken Feed and Intestine. PLoS ONE 2014, 9, e90208. [Google Scholar] [CrossRef] [Scilit]
  32. Laing, C.; Buchanan, C.; Taboada, E.N.; Zhang, Y.; Kropinski, A.; Villegas, A.; Thomas, J.E.; Gannon, V.P.J. Pan-genome sequence analysis using Panseq: An online tool for the rapid analysis of core and accessory genomic regions. BMC Bioinform. 2010, 11, 461. [Google Scholar] [CrossRef] [Scilit]
  33. Brittnacher, M.J.; Fong, C.; Hayden, H.S.; Jacobs, M.A.; Radey, M.; Rohmer, L. PGAT: A multistrain analysis resource for microbial genomes. Bioinformatics 2011, 27, 2429–2430. [Google Scholar] [CrossRef] [Scilit]
  34. Zhao, Y.; Wu, J.; Yang, J.; Sun, S.; Xiao, J.; Yu, J. PGAP: Pan-genomes analysis pipeline. Bioinformatics 2011, 28, 416–418. [Google Scholar] [CrossRef] [Scilit]
  35. Page, A.J.; Cummins, C.A.; Hunt, M.; Wong, V.K.; Reuter, S.; Holden, M.T.G.; Fookes, M.; Falush, D.; Keane, J.A.; Parkhill, J. Roary: Rapid large-scale prokaryote pan genome analysis. Bioinformatics 2015, 31, 3691–3693. [Google Scholar] [CrossRef] [Scilit]
  36. Luo, R.; Liu, B.; Xie, Y.; Li, Z.; Huang, W.; Yuan, J.; He, G.; Chen, Y.; Pan, Q.; Liu, Y.; et al. Erratum: SOAPdenovo2: An empirically improved memory-efficient short-read de novo assembler. GigaScience 2015, 4, 30. [Google Scholar] [CrossRef] [Scilit]
  37. Cui, Y.; Yang, X.; Didelot, X.; Guo, C.; Li, D.; Yan, Y.; Zhang, Y.; Yuan, Y.; Yang, H.; Wang, J.; et al. Epidemic Clones, Oceanic Gene Pools, and Eco-LD in the Free Living Marine Pathogen Vibrio parahaemolyticus. Mol. Biol. Evol. 2015, 32, 1396–1410. [Google Scholar] [CrossRef] [Scilit]
  38. Delcher, A.L.; Salzberg, S.L.; Phillippy, A.M. Using MUMmer to Identify Similar Regions in Large Sequence Sets. Curr. Protoc. Bioinform. 2003, 10, 10.3.1–10.3.18. [Google Scholar] [CrossRef] [Scilit]
  39. Seemann, T. Prokka: Rapid Prokaryotic Genome Annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef] [Scilit]
  40. Madden, T. The NCBI Handbook, 2nd ed.; National Center for Biotechnology Information (US): Bethesda, MD, USA, 2013.
  41. Daranas, N.; Bonaterra, A.; Francés, J.; Cabrefiga, J.; Montesinos, E.; Badosa, E. Monitoring Viable Cells of the Biological Control AgentLactobacillus plantarumPM411 in Aerial Plant Surfaces by Means of a Strain-Specific Viability Quantitative PCR Method. Appl. Environ. Microbiol. 2018, 84, 84. [Google Scholar] [CrossRef] [Scilit]
  42. Fujimoto, J.; Watanabe, K. Quantitative Detection of Viable Bifidobacterium bifidum BF-1 Cells in Human Feces by Using Propidium Monoazide and Strain-Specific Primers. Appl. Environ. Microbiol. 2013, 79, 2182–2188. [Google Scholar] [CrossRef] [Scilit]
  43. Karjalainen, H.; Ahlroos, T.; Myllyluoma, E.; Tynkkynen, S. Real-time PCR assays for strain-specific quantification of probiotic strains in human faecal samples. Int. Dairy J. 2012, 27, 58–64. [Google Scholar] [CrossRef] [Scilit]
  44. Zhai, Q.; Shen, X.; Cen, S.; Zhang, C.; Tian, F.; Zhao, J.; Zhang, H.; Xue, Y.; Chen, W. Screening of Lactobacillus salivarius strains from the feces of Chinese populations and the evaluation of their effects against intestinal inflammation in mice. Food Funct. 2020, 11, 221–235. [Google Scholar] [CrossRef] [Scilit]
  45. Harris, H.M.B.; Bourin, M.J.B.; Claesson, M.J.; O’Toole, P.W. Phylogenomics and comparative genomics of Lactobacillus salivarius, a mammalian gut commensal. Microb. Genom. 2017, 3, e000115. [Google Scholar] [CrossRef] [Scilit]
  46. Wuyts, S.; Wittouck, S.; De Boeck, I.; Allonsius, C.N.; Pasolli, E.; Segata, N.; Lebeer, S. Large-Scale Phylogenomics of the Lactobacillus casei Group Highlights Taxonomic Inconsistencies and Reveals Novel Clade-Associated Features. mSystems 2017, 2, e00061-17. [Google Scholar] [CrossRef] [Scilit]
  47. Maldonado-Gómez, M.X.; Martínez, I.; Bottacini, F.; O’Callaghan, A.; Ventura, M.; van Sinderen, D.; Hillmann, B.; Vangay, P.; Knights, D.; Hutkins, R.W.; et al. Stable Engraftment of Bifidobacterium longum AH1206 in the Human Gut Depends on Individualized Features of the Resident Microbiome. Cell Host Microbe 2016, 20, 515–526. [Google Scholar] [CrossRef] [Scilit]
  48. Sato, N.; Seo, G.; Benno, Y. Development of Strain-Specific PCR Primers for Quantitative Detection of Bacillus mesentericus Strain TO-A in Human Feces. Biol. Pharm. Bull. 2014, 37, 123–129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Phylogenetic relationship and genomic diversity of B. longum. (A) Phylogenetic tree (neighbor-joining method) of 205 B. longum strains. The three target strains used for strain-specific detection are colored. (B) Distribution of pair-wise SNP distances between 205 strains. (C) Pair-wise SNP distances between each of the target strains and all the other strains in the dataset. (D) Pangenome curve depicting the number of total genes detected versus the number of conserved genes as the number of included genomes increases.
Figure 1. Phylogenetic relationship and genomic diversity of B. longum. (A) Phylogenetic tree (neighbor-joining method) of 205 B. longum strains. The three target strains used for strain-specific detection are colored. (B) Distribution of pair-wise SNP distances between 205 strains. (C) Pair-wise SNP distances between each of the target strains and all the other strains in the dataset. (D) Pangenome curve depicting the number of total genes detected versus the number of conserved genes as the number of included genomes increases.
Microorganisms 09 01159 g001
Figure 2. The analysis pipeline for strain-specific primer design corresponding to the three B. longum strains (A) and the pangenome readout (B).
Figure 2. The analysis pipeline for strain-specific primer design corresponding to the three B. longum strains (A) and the pangenome readout (B).
Microorganisms 09 01159 g002
Figure 3. Electrophoresis results of PCR products generated using each strain-specific qPCR primer pair against DNA from the respective target B. longum strains and non-target microorganisms. Each gel includes 25 lanes (including a lane for the gene ruler). Order of microorganisms were as follows: for RG4-1-A (from right to left), gene ruler, B. longum RG4-1, B. longum FGSZY6M4, B. longum M1-20-R01-3, B. longum 274, B. longum FSHHK13M1, B. longum FSDLZ57M1, B. longum NaTon 49-4, B. longum FJSWXJ11M1, B. longum HUB 36-17, B. longum 28-10, B. longum ZCC7, Bifidobacterium breve DSM 20213, Bifidobacterium bifidum DSM 20456, Bifidobacterium pseudocatenulatum FQHXN5M4, Bifidobacterium pseudolongum 56M2, Bifidobacterium animalis BB12, Bifidobacterium adolescentis L2-32, Lactobacillus salivarius DSM 20555, Lactobacillus gasseri DSM 20243, Lactobacillus casei DSM 20011, Lactobacillus acidophilus DSM 20079, Lactobacillus plantarum DSM 20174, Lactobacillus reuteri DSM 20016, and Lactobacillus rhamnosus LMS2-1; for M1-A (from right to left), gene ruler, B. longum M1-20-R01-3, B. longum RG4-1, B. longum FGSZY6M4, and the order of following strains was the same as that of RG4-1-A; for GS-A (from right to left), gene ruler, B. longum FGSZY6M4, B. longum M1-20-R01-3, B. longum RG4-1, and the order of following strains was the same as that of RG4-1-A; for RG4-1-B, M1-B and GS-B (from right to left), Escherichia coli CMCC44102, Akkermansia muciniphila FJLHD50M21, Faecalibacterium prausnitzii ATCC 27768, Enterococcus faecalis CCFM596, Bacteroides fragilis NCTC9343, Bacteroides thetaiotaomicron FNMHLBE9-K-7, Bacteroides eggerthii FSDTA-HCK-B-9, Bacteroides cellulosilyticus FSDTA-ELI-BHI-5, Bacteroides nordii FNMHLBE13K2, Bacteroides stercoris FJSWX62K34, Bacteroides uniformis FJSWX62K43, Bacteroides caccae FFJLY22K5, Parabacteroides distasonis FSDTA-HCM-XY-12, Bacteroides dorei FJSWX61E4, Bacteroides faecis FTJS2E2, Bacteroides intestinalis FBJ60K5, Bacteroides vulgatus FSDLZ51K1, Bacteroides finegoldii FNMHLBE11E1, Bacteroides ovatus FBJ10-K-10, Bacteroides clarus F-FJ-LY 22-K-22, Bacteroides salyersiae FSDTA-ELI-BHI-9, Bacteroides xylanisolvens FSDTAHCMXY17, Parabacteroides merdae FSDTAELIBHI4 and Clostridium butyricum FJSCZD1G10.
Figure 3. Electrophoresis results of PCR products generated using each strain-specific qPCR primer pair against DNA from the respective target B. longum strains and non-target microorganisms. Each gel includes 25 lanes (including a lane for the gene ruler). Order of microorganisms were as follows: for RG4-1-A (from right to left), gene ruler, B. longum RG4-1, B. longum FGSZY6M4, B. longum M1-20-R01-3, B. longum 274, B. longum FSHHK13M1, B. longum FSDLZ57M1, B. longum NaTon 49-4, B. longum FJSWXJ11M1, B. longum HUB 36-17, B. longum 28-10, B. longum ZCC7, Bifidobacterium breve DSM 20213, Bifidobacterium bifidum DSM 20456, Bifidobacterium pseudocatenulatum FQHXN5M4, Bifidobacterium pseudolongum 56M2, Bifidobacterium animalis BB12, Bifidobacterium adolescentis L2-32, Lactobacillus salivarius DSM 20555, Lactobacillus gasseri DSM 20243, Lactobacillus casei DSM 20011, Lactobacillus acidophilus DSM 20079, Lactobacillus plantarum DSM 20174, Lactobacillus reuteri DSM 20016, and Lactobacillus rhamnosus LMS2-1; for M1-A (from right to left), gene ruler, B. longum M1-20-R01-3, B. longum RG4-1, B. longum FGSZY6M4, and the order of following strains was the same as that of RG4-1-A; for GS-A (from right to left), gene ruler, B. longum FGSZY6M4, B. longum M1-20-R01-3, B. longum RG4-1, and the order of following strains was the same as that of RG4-1-A; for RG4-1-B, M1-B and GS-B (from right to left), Escherichia coli CMCC44102, Akkermansia muciniphila FJLHD50M21, Faecalibacterium prausnitzii ATCC 27768, Enterococcus faecalis CCFM596, Bacteroides fragilis NCTC9343, Bacteroides thetaiotaomicron FNMHLBE9-K-7, Bacteroides eggerthii FSDTA-HCK-B-9, Bacteroides cellulosilyticus FSDTA-ELI-BHI-5, Bacteroides nordii FNMHLBE13K2, Bacteroides stercoris FJSWX62K34, Bacteroides uniformis FJSWX62K43, Bacteroides caccae FFJLY22K5, Parabacteroides distasonis FSDTA-HCM-XY-12, Bacteroides dorei FJSWX61E4, Bacteroides faecis FTJS2E2, Bacteroides intestinalis FBJ60K5, Bacteroides vulgatus FSDLZ51K1, Bacteroides finegoldii FNMHLBE11E1, Bacteroides ovatus FBJ10-K-10, Bacteroides clarus F-FJ-LY 22-K-22, Bacteroides salyersiae FSDTA-ELI-BHI-9, Bacteroides xylanisolvens FSDTAHCMXY17, Parabacteroides merdae FSDTAELIBHI4 and Clostridium butyricum FJSCZD1G10.
Microorganisms 09 01159 g003
Figure 4. qPCR standard curves for the three B. longum strains.
Figure 4. qPCR standard curves for the three B. longum strains.
Microorganisms 09 01159 g004
Figure 5. Colonized biomasses of the target B. longum strains in fecal samples from humans and mice. Panel (A), the results collected from the human trail; Panel (B), the results collected from the animal experiments.
Figure 5. Colonized biomasses of the target B. longum strains in fecal samples from humans and mice. Panel (A), the results collected from the human trail; Panel (B), the results collected from the animal experiments.
Microorganisms 09 01159 g005
Table 1. Bacterial strains used for primer validation via electrophoresis a.
Table 1. Bacterial strains used for primer validation via electrophoresis a.
SpeciesAccession NumberCulture Conditions
Bifidobacterium deMan Rogosa Sharpe (MRS) broth supplemented with 0.1% L-cysteine HCl at 37 °C
B. longumRG4-1 b, FGSZY6M4 b, M1-20-R01-3 b, 274 b, FSHHK13M1 b, FSDLZ57M1 b, NaTon 49-4 b, FJSWXJ11M1 b, HUB 36-17 b, 28-10 b, ZCC7 b
B.breveDSM 20213 c
B. bifidumDSM 20456 c
B. pseudocatenulatumFQHXN5M4 b
B. pseudolongum56M2 b
B. animalisBB12d
B. adolescentisL2-32 e
Lactobacillus MRS broth at 37 °C
L. salivariusDSM 20555 c
L. gasseriDSM 20243 c
L. caseiDSM 20011 c
L. acidophilusDSM 20079 c
L. plantarumDSM 20174 c
L. reuteriDSM 20016 c
L. rhamnosusLMS2-1 e
Non-lactic acid bacteria (LAB)
Escherichia coliCMCC 44102 fLuria-Bertani (LB) broth at 37 °C
Akkermansia muciniphilaFJLHD50M21 bBrain Heart Infusion (BHI) broth at 37 °C
Faecalibacterium prausnitziiDSM 17677 cBHI broth containing 3.7% BHI powder supplemented with 0.5% yeast extract, 0.0005% hemin, 0.0005% vitamin K and 0.2% L-cysteine HCl at 37 °C
Enterococcus faecalisCCFM596 bBHI broth at 37 °C
Bacteroides fragilisATCC 25285/NCTC 9343 gBHI broth supplemented with 0.1% L-cysteine HCl, 0.001% hemin and 0.0002% vitamin K at 37 °C
Bacteroides thetaiotaomicronFNMHLBE9-K-7 b
Bacteroides eggerthiiFSDTA-HCK-B-9 b
Bacteroides cellulosilyticusFSDTA-ELI-BHI-5 b
Bacteroides nordiiFNMHLBE13K2 b
Bacteroides stercorisFJSWX62K34 b
Bacteroides uniformisFJSWX62K43 b
Bacteroides caccaeFFJLY22K5 b
Parabacteroides distasonisFSDTA-HCM-XY-12 b
Bacteroides doreiFJSWX61E4 b
Bacteroides faecisFTJS2E2 b
Bacteroides intestinalisFBJ60K5 b
Bacteroides vulgatusFSDLZ51K1 b
Bacteroides finegoldiiFNMHLBE11E1 b
Bacteroides ovatusFBJ10-K-10 b
Bacteroides clarusF-FJ-LY 22-K-22 b
Bacteroides salyersiaeFSDTA-ELI-BHI-9 b
Bacteroides xylanisolvensFSDTAHCMXY17 b
Parabacteroides merdaeFSDTAELIBHI4 b
Clostridium butyricumFJSCZD1G10 bReinforced Clostridial Medium (RCM) at 37 °C
a Anaerobes (Bifidobacterium, Akkermansia muciniphila, Faecalibacterium prausnitzii, Bacteroides strains and Clostridium butyricum) were maintained in anaerobic chamber (80% N2, 10% H2, 10% CO2) during cultivation. b These strains were retrieved from Culture Collection of Food Microorganisms, Jiangnan university. c These strains were purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ). d The strain was isolated from the commercial probiotic product. e The strains were kindly provided by Biodefense and Emerging Infections Research Resources Repository (BEI Resources). f The strain was purchased from National Center for Medical Culture Collections (CMCC). g The strain was purchased from American Type Culture Collection (ATCC).
Table 2. Publicly available B. longum genomes used in this study.
Table 2. Publicly available B. longum genomes used in this study.
GenomeStrainBioSampleSize (Mb)GC%ScaffoldsCDS
GCA_001576955.1_ASM157695v1121.2SAMN044979131.8725660.32341453
GCA_002331305.1_ASM233130v1UBA2088SAMN064574771.8784959.22270
GCF_900157195.1_Bifido_02_v1Bifido_02SAMEA518164182.3342960.1971860
GCF_900157165.1_Bifido_12_v1Bifido_12SAMEA518239182.0728860.56811743
GCF_900157155.1_Bifido_06_v1Bifido_06SAMEA518194182.4218260481978
GCF_900157145.1_Bifido_03_v1Bifido_03SAMEA518171682.4136360.1821962
GCF_900157115.1_Bifido_05_v1Bifido_05SAMEA518186682.3347459.9881906
GCF_900157095.1_Bifido_01_v1Bifido_01SAMEA518156682.3346359.9391907
GCF_900157055.1_Bifido_09_v1Bifido_09SAMEA518216682.6612459.9682225
GCF_900104835.1_IMG-taxon_2634166334_annotated_assemblyDSM 20219SAMN044897482.4490260.361942
GCF_004334865.1_ASM433486v1MCC10119SAMN063686692.4868960.1452023
GCF_004334855.1_ASM433485v1MCC10122SAMN063686722.4604360.1491978
GCF_004334815.1_ASM433481v1MCC10123SAMN063686732.506559.7492060
GCF_004334795.1_ASM433479v1MCC10125SAMN063686752.4477460.2431979
GCF_004334785.1_ASM433478v1MCC10128SAMN063686782.5096159.9572089
GCF_004334775.1_ASM433477v1MCC10129SAMN063686792.2735360.1181812
GCF_004334745.1_ASM433474v1MCC10117SAMN063686672.3016759.9351807
GCF_004334715.1_ASM433471v1MCC10120SAMN063686702.4837760.2622014
GCF_004334705.1_ASM433470v1MCC10118SAMN063686682.3497559.9361897
GCF_004334695.1_ASM433469v1MCC10121SAMN063686712.3844760261916
GCF_004334645.1_ASM433464v1MCC10124SAMN063686742.4570260.1471985
GCF_004334635.1_ASM433463v1MCC10126SAMN063686762.5530759.8682055
GCF_004334625.1_ASM433462v1MCC10130SAMN063686802.3685760591908
GCF_004334615.1_ASM433461v1MCC10127SAMN063686772.3567360.1411874
GCF_004334555.1_ASM433455v1MCC10212SAMN063686812.3654759.9281904
GCF_004334545.1_ASM433454v1MCC10002SAMN063685692.6345160592202
GCF_004334535.1_ASM433453v1MCC10006SAMN063685722.4501460.4831991
GCF_004334515.1_ASM433451v1MCC10009SAMN063685752.523760.1602035
GCF_004334485.1_ASM433448v1MCC10011SAMN063685772.3974659.9341931
GCF_004334465.1_ASM433446v1MCC10016SAMN063685812.3711860661893
GCF_004334445.1_ASM433444v1MCC10027SAMN063685892.5058359.9592042
GCF_004334435.1_ASM433443v1MCC10019SAMN063685842.3045360.1411837
GCF_004334425.1_ASM433442v1MCC10028SAMN063685902.4254160.2441983
GCF_004334365.1_ASM433436v1MCC10038SAMN063685982.3670159.9381968
GCF_004334355.1_ASM433435v1MCC10030SAMN063685922.5184460.1642023
GCF_004334345.1_ASM433434v1MCC10040SAMN063686002.4499660.2451996
GCF_004334335.1_ASM433433v1MCC10039SAMN063685992.3890560341924
GCF_004334325.1_ASM433432v1MCC10047SAMN063686072.3645159.9641861
GCF_004334285.1_ASM433428v1MCC10051SAMN063686102.3036360.1421830
GCF_004334255.1_ASM433425v1MCC10057SAMN063686162.1886259.9731725
GCF_004334245.1_ASM433424v1MCC10054SAMN063686132.2956460611842
GCF_004334235.1_ASM433423v1MCC10059SAMN063686182.4371860472005
GCF_004334215.1_ASM433421v1MCC10058SAMN063686172.3295660.2651886
GCF_004334205.1_ASM433420v1MCC10072SAMN063686282.2338860231742
GCF_004334165.1_ASM433416v1MCC10074SAMN063686302.4100159.8341965
GCF_004334155.1_ASM433415v1MCC10077SAMN063686332.4116260401957
GCF_004334145.1_ASM433414v1MCC10083SAMN063686382.4755760.2641953
GCF_004334105.1_ASM433410v1MCC10085SAMN063686402.366360641908
GCF_004334075.1_ASM433407v1MCC10003SAMN063685702.5267760.1692047
GCF_004334065.1_ASM433406v1MCC10004SAMN063685712.5517360522028
GCF_004334045.1_ASM433404v1MCC10007SAMN063685732.4846360.2592024
GCF_004334035.1_ASM433403v1MCC10008SAMN063685742.5436760802119
GCF_004334005.1_ASM433400v1MCC10010SAMN063685762.4524560.4931984
GCF_004333995.1_ASM433399v1MCC10012SAMN063685782.4798759.6671977
GCF_004333975.1_ASM433397v1MCC10014SAMN063685792.4662160.2592007
GCF_004333935.1_ASM433393v1MCC10017SAMN063685822.4488359.7601972
GCF_004333925.1_ASM433392v1MCC10015SAMN063685802.6302959.9832177
GCF_004333905.1_ASM433390v1MCC10018SAMN063685832.3304160321891
GCF_004333895.1_ASM433389v1MCC10022SAMN063685862.4190459.7551950
GCF_004333875.1_ASM433387v1MCC10021SAMN063685852.2357560581774
GCF_004333855.1_ASM433385v1MCC10023SAMN063685872.3081660.3411853
GCF_004333845.1_ASM433384v1MCC10025SAMN063685882.4088460.1561912
GCF_004333795.1_ASM433379v1MCC10029SAMN063685912.346159.9551877
GCF_004333785.1_ASM433378v1MCC10031SAMN063685932.4011560.1411916
GCF_004333775.1_ASM433377v1MCC10033SAMN063685942.3920460631929
GCF_004333765.1_ASM433376v1MCC10034SAMN063685952.2536360701771
GCF_004333735.1_ASM433373v1MCC10036SAMN063685972.2499859.9221811
GCF_004333715.1_ASM433371v1MCC10035SAMN063685962.457559.8522012
GCF_004333695.1_ASM433369v1MCC10041SAMN063686012.3706460.1471906
GCF_004333675.1_ASM433367v1MCC10042SAMN063686022.3205660.1531867
GCF_004333645.1_ASM433364v1MCC10044SAMN063686042.5128160.3502055
GCF_004333635.1_ASM433363v1MCC10043SAMN063686032.6238659.5622115
GCF_004333625.1_ASM433362v1MCC10045SAMN063686052.4377860.3611973
GCF_004333575.1_ASM433357v1MCC10046SAMN063686062.2864159.9711761
GCF_004333565.1_ASM433356v1MCC10048SAMN063686082.4560259.8711949
GCF_004333555.1_ASM433355v1MCC10050SAMN063686092.2803759.8341782
GCF_004333535.1_ASM433353v1MCC10052SAMN063686112.4287460.1651956
GCF_004333515.1_ASM433351v1MCC10053SAMN063686122.4258260.3511942
GCF_004333475.1_ASM433347v1MCC10056SAMN063686152.2997560791837
GCF_004333465.1_ASM433346v1MCC10060SAMN063686192.3131160.2591831
GCF_004333455.1_ASM433345v1MCC10055SAMN063686142.4860360.1722019
GCF_004333445.1_ASM433344v1MCC10062SAMN063686202.3259259.8591837
GCF_004333425.1_ASM433342v1MCC10064SAMN063686212.2657860401790
GCF_004333385.1_ASM433338v1MCC10066SAMN063686222.2938359.8531852
GCF_004333375.1_ASM433337v1MCC10067SAMN063686232.3943759.6551910
GCF_004333365.1_ASM433336v1MCC10068SAMN063686242.4078759.7581894
GCF_004333335.1_ASM433333v1MCC10069SAMN063686252.3671859.9571893
GCF_004333325.1_ASM433332v1MCC10070SAMN063686262.5082259.6482038
GCF_004333305.1_ASM433330v1MCC10071SAMN063686272.2877260491793
GCF_004333275.1_ASM433327v1MCC10073SAMN063686292.284359.7421829
GCF_004333265.1_ASM433326v1MCC10075SAMN063686312.3849760.1531947
GCF_004333235.1_ASM433323v1MCC10076SAMN063686322.5635560.2502152
GCF_004333215.1_ASM433321v1MCC10079SAMN063686352.3827259.9771936
GCF_004333205.1_ASM433320v1MCC10078SAMN063686342.2719859.8581766
GCF_004333175.1_ASM433317v1MCC10080SAMN063686362.5289360.2592014
GCF_004333165.1_ASM433316v1MCC10081SAMN063686372.3234659.9561911
GCF_004333125.1_ASM433312v1MCC10084SAMN063686392.2643560.1461788
GCF_004333115.1_ASM433311v1MCC10086SAMN063686412.2838259.8481783
GCF_004333105.1_ASM433310v1MCC10087SAMN063686422.3031960491819
GCF_004333065.1_ASM433306v1MCC10089SAMN063686432.3248160.3411853
GCF_004333045.1_ASM433304v1MCC10096SAMN063686502.5712959.7392099
GCF_004333035.1_ASM433303v1MCC10090SAMN063686442.3473159.8491883
GCF_004333015.1_ASM433301v1MCC10091SAMN063686452.3942160641931
GCF_004333005.1_ASM433300v1MCC10103SAMN063686572.3946859.9161933
GCF_004332965.1_ASM433296v1MCC10100SAMN063686542.51860.1562037
GCF_004332945.1_ASM433294v1MCC10116SAMN063686662.6289860472167
GCF_004332935.1_ASM433293v1MCC10112SAMN063686622.2775760581804
GCF_004332925.1_ASM433292v1MCC10092SAMN063686462.2348359.9891742
GCF_004332895.1_ASM433289v1MCC10094SAMN063686482.5096259.9392078
GCF_004332865.1_ASM433286v1MCC10093SAMN063686472.4589460.2572000
GCF_004332855.1_ASM433285v1MCC10095SAMN063686492.3568260.3951915
GCF_004332835.1_ASM433283v1MCC10098SAMN063686522.3266759.9581815
GCF_004332825.1_ASM433282v1MCC10097SAMN063686512.2803560521805
GCF_004332765.1_ASM433276v1MCC10107SAMN063686592.3847559.8451931
GCF_004332755.1_ASM433275v1MCC10102SAMN063686562.5387560.1562077
GCF_004332745.1_ASM433274v1MCC10099SAMN063686532.3400760.1661870
GCF_004332735.1_ASM433273v1MCC10106SAMN063686582.4150360.1741947
GCF_004332725.1_ASM433272v1MCC10101SAMN063686552.4180660.1651953
GCF_004332665.1_ASM433266v1MCC10108SAMN063686602.4187560.3731972
GCF_004332655.1_ASM433265v1MCC10111SAMN063686612.4382660492007
GCF_004332645.1_ASM433264v1MCC10115SAMN063686652.4337260.3542017
GCF_004332635.1_ASM433263v1MCC10113SAMN063686632.4641160622021
GCF_004332625.1_ASM433262v1MCC10114SAMN063686642.4545959.8582005
GCF_002900845.1_ASM290084v1CECT 7210SAMEA31585082.467759.912009
GCF_002861445.1_ASM286144v1UMB0788SAMN081936492.4549360.2332051
GCF_002833285.1_ASM283328v1APC1466SAMN079583512.4199859.8511967
GCF_002833265.1_ASM283326v1APC1476SAMN079583552.5325460482094
GCF_002833255.1_ASM283325v1DPC6320SAMN079583642.3303759.9251807
GCF_002833215.1_ASM283321v1DPC6323SAMN079583662.3969660.2521911
GCF_002833205.1_ASM283320v1APC1462SAMN079583482.4177860.3271953
GCF_002833185.1_ASM283318v1APC1464SAMN079583492.3465260.1311873
GCF_002833175.1_ASM283317v1APC1465SAMN079583502.4522159.7571976
GCF_002833135.1_ASM283313v1APC1468SAMN079583522.3951660.2451966
GCF_002833125.1_ASM283312v1APC1473SAMN079583542.3170759.8391817
GCF_002833115.1_ASM283311v1APC1472SAMN079583532.3640460.2501863
GCF_002833075.1_ASM283307v1APC1477SAMN079583562.2288159.8241726
GCF_002833065.1_ASM283306v1APC1480SAMN079583582.4777559.9272022
GCF_002833055.1_ASM283305v1APC1478SAMN079583572.2233559.8211729
GCF_002833035.1_ASM283303v1APC1482SAMN079583592.3374460.2721858
GCF_002833015.1_ASM283301v1DPC6316SAMN079583622.3939760.4321912
GCF_002832995.1_ASM283299v1DPC6321SAMN079583652.3823659.9281894
GCF_002832985.1_ASM283298v1APC1503SAMN079583602.562759.7392103
GCF_002832955.1_ASM283295v1APC1504SAMN079583612.3102960.2511860
GCF_002832945.1_ASM283294v1DPC6317SAMN079583632.4486360.2201918
GCF_002276185.1_ASM227618v1IndicaSAMN075031772.3742360431948
GCF_002076095.1_Bbif1886B1886BSAMN066217062.4737560.2472083
GCF_002076015.1_Bbif1890B1890BSAMN066217102.3416759.91091846
GCF_002075875.1_Bbif1898B1898BSAMN066217162.4743959.9411998
GCF_001940535.1_BlonW11v1W11SAMN061092302.3299859.9221857
GCF_001892965.1_ASM189296v1296BSAMN059160522.2531859.9401685
GCF_001725985.1_ASM172598v1AH1206SAMN045762132.4212960.211967
GCF_001719085.1_ASM171908v135624SAMN042544662.264066011773
GCF_001686245.1_ASM168624v1LO-K29bSAMD000476232.3727160.1971866
GCF_001686225.1_ASM168622v1LO-K29aSAMD000476222.4491860851874
GCF_001686205.1_ASM168620v1LO-C29SAMD000476212.4838760491927
GCF_001686185.1_ASM168618v1LO-21SAMD000476202.6560360.1712034
GCF_001686165.1_ASM168616v1LO-10SAMD000476192.5402460.3801988
GCF_001686145.1_ASM168614v1LO-06SAMD000476182.4374760771926
GCF_001595465.1_ASM159546v1379SAMN041556022.3876260.2241921
GCF_001546275.1_ASM154627v1CMW7750SAMN038422222.3720860391894
GCF_001516925.1_ASM151692v1MC-42SAMN042639422.2882559.8291792
GCF_001447975.1_ASM144797v17SAMN041295332.2355860361766
GCF_001447955.1_ASM144795v19SAMN041295412.2337760311765
GCF_001446275.1_ASM144627v1CCUG30698SAMN037858192.45860.211956
GCF_001446255.1_ASM144625v1NCIMB8809SAMN037858182.3409960.111807
GCF_001293145.1_ASM129314v1BG7SAMN032716822.4557660.006821926
GCF_001275745.1_assBLOI2BLOI2SAMN037750402.4175960721937
GCF_001051015.2_ASM105101v2CECT 7210SAMEA31585082.467759.911992
GCF_001050555.1_ASM105055v1CECT 7347SAMEA31462492.32722601281868
GCF_000829295.1_ASM82929v1105-ASAMD000199432.2901460.111772
GCF_000786175.1_ASM78617v1VMKB44SAMN031052072.5019360.3342080
GCF_000772485.1_ASM77248v1GT15SAMN030932302.337526011815
GCF_000741245.1_Biflon_sub.lonLMG 13197SAMN026734372.384760.381803
GCF_000730135.1_ASM73013v1EK13SAMN028629972.4745360392043
GCF_000730105.1_ASM73010v11-5BSAMN028629912.3675160.1251902
GCF_000730055.1_ASM73005v17-1BSAMN028629922.4070959.8341904
GCF_000730045.1_ASM73004v172BSAMN028629942.3744560.3301950
GCF_000730035.1_ASM73003v117-1BSAMN028629932.467260.2201962
GCF_000730025.1_ASM73002v1EK5SAMN028629962.2312959.7281780
GCF_000497735.1_BLONGv1.0E18SAMN024719722.372976011912
GCF_000478525.1_blongD2957D2957SAMN024720642.3302360.4131812
GCF_000261265.1_Blongum44Bv1.044BSAMN008291482.5592259.7622109
GCF_000261245.1_Blongum16Bv1.01-6BSAMN008291542.6867759.61712215
GCF_000261225.1_Blongum35Bv1.035BSAMN008291582.5144360.11311967
GCF_000261205.1_Blongum22Bv1.02-2BSAMN008291552.625759.71412089
GCF_000219455.1_ASM21945v1KACC 91563SAMN026036562.3957659.811531856
GCF_000210755.1_ASM21075v1F8SAMEA31383792.3849959.911884
GCF_000196575.1_ASM19657v1157FSAMD000609532.4088360.11131923
GCF_000196555.1_ASM19655v1JCM 1217SAMD000609512.3851660.311870
GCF_000185665.1_ASM18566v112_1_47BFAASAMN024638222.4059960.1611981
GCF_000166895.2_ASM16689v2DJO10ASAMN024414142.3752859.91201792
GCF_000166315.1_ASM16631v1BBMN68SAMN026034692.2659459.911740
GCF_000155415.1_ASM15541v1CCUG 52486SAMN024636772.4808560222034
GCF_000008945.1_ASM894v1DJO10ASAMN026035122.3895360.118231932
GCF_000007525.1_ASM752v1NCC2705SAMN026036752.2602760.107521773
GCF_000003135.1_ASM313v1ATCC 55813SAMN000014752.3963660.11141901
GCF_003094635.1_ASM309463v1DS9_3SAMN064641002.3971759.9131955
GCF_003094855.1_ASM309485v1DS15_3SAMN064640972.3981859.9211956
GCF_003094935.1_ASM309493v1DS18_3SAMN064640982.4482659.71742002
GCF_003094955.1_ASM309495v1DS1_3SAMN064640962.41728601701958
GCF_003094975.1_ASM309497v1DS7_3SAMN064640992.2372960171765
GCF_003094995.1_ASM309499v1DS32_3SAMN089490072.2359360.1281761
Table 3. Parameters for self-sequenced genomes.
Table 3. Parameters for self-sequenced genomes.
Scaffold NumberLengthGapAverage LengthN50N90GC Content (%)
FGSZY6M4522,321,455357444,643.37202,55083,02359.72
RG4-1512,601,515342051,010.1224,48060,10360.21
M1-20-R01-3462,237,922325848,650.48232,21763,50060.02
Table 4. Strain-specific genes identified by Roary for B. longum RG4-1.
Table 4. Strain-specific genes identified by Roary for B. longum RG4-1.
GeneNon-Unique Gene NameAnnotationAvg Group Size NucGene Tag
group_8150 hypothetical protein227RG4-1_00079
group_8151 hypothetical protein296RG4-1_00112
group_8152 hypothetical protein257RG4-1_00222
group_8153xerC_1Tyrosine recombinase XerC1286RG4-1_00224
group_8154 Helix-turn-helix domain protein185RG4-1_00225
group_8155 Helix-turn-helix domain protein395RG4-1_00226
group_8156 Helix-turn-helix domain protein341RG4-1_00227
group_8157 site-specific tyrosine recombinase XerC1349RG4-1_00228
group_8158 hypothetical protein209RG4-1_00545
group_8160 hypothetical protein236RG4-1_00568
group_8161 hypothetical protein272RG4-1_01044
group_8162mdeA_1Methionine gamma-lyase1277RG4-1_01045
group_8163 Phage-related minor tail protein3317RG4-1_01165
group_8164 Phage tail protein788RG4-1_01166
group_8165 hypothetical protein1115RG4-1_01167
group_8166smc_4Chromosome partition protein Smc1124RG4-1_01168
group_8167 hypothetical protein359RG4-1_01169
group_8168 hypothetical protein1871RG4-1_01170
group_8169 hypothetical protein185RG4-1_01171
group_8170acmLysozyme M1 precursor1280RG4-1_01174
yoaD Putative 2-hydroxyacid dehydrogenase YoaD968RG4-1_01873
group_8172araN_4putative arabinose-binding protein precursor1331RG4-1_01874
ycjP_2 Inner membrane ABC transporter permease protein YcjP830RG4-1_01875
group_8174ycjO_1Inner membrane ABC transporter permease protein YcjO899RG4-1_01876
group_8175 hypothetical protein161RG4-1_01877
group_8176nanEPutative N-acetylmannosamine-6-phosphate 2-epimerase689RG4-1_01878
group_8177nanAN-acetylneuraminate lyase917RG4-1_01879
bglK Beta-glucoside kinase914RG4-1_01880
rpiR HTH-type transcriptional regulator RpiR905RG4-1_01881
group_8180 Chitinase class I551RG4-1_02208
group_8181 Thaumatin family protein284RG4-1_02209
group_8182 hypothetical protein197RG4-1_02210
Table 5. Strain-specific genes identified by Roary for B. longum M1-20-R01-3.
Table 5. Strain-specific genes identified by Roary for B. longum M1-20-R01-3.
GeneNon-Unique Gene NameAnnotationAvg Group Size NucGene Tag
group_6841 hypothetical protein194M1-20-R01-3_00305
group_6842 hypothetical protein998M1-20-R01-3_00310
group_6843 hypothetical protein221M1-20-R01-3_00311
group_6844 hypothetical protein233M1-20-R01-3_00316
group_6845 hypothetical protein257M1-20-R01-3_00318
group_6846 hypothetical protein623M1-20-R01-3_00319
group_6847 hypothetical protein587M1-20-R01-3_00320
group_6848 hypothetical protein1745M1-20-R01-3_00324
group_6849 hypothetical protein236M1-20-R01-3_00325
group_6850 hypothetical protein581M1-20-R01-3_00326
group_6851 hypothetical protein191M1-20-R01-3_00327
group_6852 YcfA-like protein224M1-20-R01-3_00328
group_6853 hypothetical protein413M1-20-R01-3_00329
group_6854 hypothetical protein617M1-20-R01-3_00562
Table 6. Strain-specific genes identified by Roary for B. longum FGSZY6M4.
Table 6. Strain-specific genes identified by Roary for B. longum FGSZY6M4.
GeneNon-Unique Gene NameAnnotationAvg Group Size NucGene Tag
group_3844 hypothetical protein203FGSZY6M4_00001
group_3845pepD_1Dipeptidase1637FGSZY6M4_00002
group_3846epsHPutative glycosyltransferase EpsH1034FGSZY6M4_00003
group_3847 transcriptional regulator BetI821FGSZY6M4_00004
group_3850 N-acetylmuramoyl-L-alanine amidase878FGSZY6M4_00052
group_3869 hypothetical protein419FGSZY6M4_00335
group_3870 putative ABC transporter ATP-binding protein/MT1014434FGSZY6M4_00336
zur_2 Zinc uptake regulation protein500FGSZY6M4_00339
group_3880 hypothetical protein578FGSZY6M4_00378
group_3899 hypothetical protein518FGSZY6M4_00692
yhcR_2 Endonuclease YhcR precursor3566FGSZY6M4_01406
group_3960 hypothetical protein332FGSZY6M4_01466
group_3961 hypothetical protein692FGSZY6M4_01467
group_3962 YcaO-like family protein1610FGSZY6M4_01468
group_3963 ABC-2 type transporter731FGSZY6M4_01469
group_3964yxlFputative ABC transporter ATP-binding protein YxlF908FGSZY6M4_01470
group_3965 hypothetical protein188FGSZY6M4_01471
group_3966 hypothetical protein1079FGSZY6M4_01472
group_3967 hypothetical protein1061FGSZY6M4_01473
group_3968 hypothetical protein2594FGSZY6M4_01474
group_3969 Nitroreductase family protein1532FGSZY6M4_01475
group_3970 YcaO-like family protein1607FGSZY6M4_01476
group_3971 hypothetical protein1691FGSZY6M4_01477
group_3972 hypothetical protein176FGSZY6M4_01478
group_4002 hypothetical protein254FGSZY6M4_01825
group_4004 hypothetical protein308FGSZY6M4_01832
group_4005 hypothetical protein227FGSZY6M4_01836
group_4008 hypothetical protein365FGSZY6M4_01863
group_4009 hypothetical protein359FGSZY6M4_01864
group_4010 hypothetical protein197FGSZY6M4_01866
group_4011 hypothetical protein455FGSZY6M4_01867
group_4012whiB1_2Transcriptional regulator WhiB1245FGSZY6M4_01868
group_4013 hypothetical protein329FGSZY6M4_01869
group_4014 hypothetical protein170FGSZY6M4_01871
group_4036 hypothetical protein4835FGSZY6M4_01918
group_4037 hypothetical protein566FGSZY6M4_01919
group_4038 hypothetical protein440FGSZY6M4_01920
group_4039 hypothetical protein176FGSZY6M4_01921
group_4040 hypothetical protein527FGSZY6M4_01922
group_4041 hypothetical protein368FGSZY6M4_01923
group_4042 hypothetical protein566FGSZY6M4_01939
group_4048 hypothetical protein338FGSZY6M4_01977
group_4049 hypothetical protein419FGSZY6M4_01981
group_4050 hypothetical protein1190FGSZY6M4_01982
bvgA Virulence factors putative positive transcription regulator BvgA668FGSZY6M4_01983
group_4052 enterobactin exporter EntS1262FGSZY6M4_01984
group_4053 hypothetical protein197FGSZY6M4_01985
aacA-aphD Bifunctional AAC/APH1340FGSZY6M4_01986
group_4055 Zein seed storage protein755FGSZY6M4_01993
Table 7. Strain-specific primers for three B. longum strains.
Table 7. Strain-specific primers for three B. longum strains.
StrainPrimer Sequence (5′-3′)Primer Length (bp)Primer ScoreProduct Length (bp)
RG4-1F: ACCATCTGGGTGGAGAAAGTG21100115
R: TGGCGGAAATGAACTCGTAAT21100
M1-20-R01-3F: GATGGCACCAGCACAGG17100199
R: GGAGCACGGCGACTATG17100
FGSZY6M4F: TCCCGAATCCGACTATGA18100144
R: TCGCTGCCAACTACTAAAA19100
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Xiao, Y.; Wang, C.; Zhao, J.; Zhang, H.; Chen, W.; Zhai, Q. Quantitative Detection of Bifidobacterium longum Strains in Feces Using Strain-Specific Primers. Microorganisms 2021, 9, 1159. https://doi.org/10.3390/microorganisms9061159

AMA Style

Xiao Y, Wang C, Zhao J, Zhang H, Chen W, Zhai Q. Quantitative Detection of Bifidobacterium longum Strains in Feces Using Strain-Specific Primers. Microorganisms. 2021; 9(6):1159. https://doi.org/10.3390/microorganisms9061159

Chicago/Turabian Style

Xiao, Yue, Chen Wang, Jianxin Zhao, Hao Zhang, Wei Chen, and Qixiao Zhai. 2021. "Quantitative Detection of Bifidobacterium longum Strains in Feces Using Strain-Specific Primers" Microorganisms 9, no. 6: 1159. https://doi.org/10.3390/microorganisms9061159

APA Style

Xiao, Y., Wang, C., Zhao, J., Zhang, H., Chen, W., & Zhai, Q. (2021). Quantitative Detection of Bifidobacterium longum Strains in Feces Using Strain-Specific Primers. Microorganisms, 9(6), 1159. https://doi.org/10.3390/microorganisms9061159

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop