Quantitative Detection of Bifidobacterium longum Strains in Feces Using Strain-Specific Primers
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Culture Conditions and Genomic DNA Extraction
2.2. Bacterial Genome Sequencing and Retrieval of Publicly Available Genomes
2.3. Single Nucleotide Polymorphism (SNP) Calling and Phylogeny Reconstruction
2.4. Identification of Strain-Specific Markers
2.5. Design of Strain-Specific Primers and Validation of Their Specificity via Electrophoresis
2.6. Strain-Specific qPCR Designs and Standard Curves for Absolute Quantification
2.7. Quantification of Ingested B. longum Strains in the Fecal Samples
3. Results
3.1. Genomic Diversity of B. longum
3.2. In Silico Identification and Validation of Strain-Specific Gene Markers
3.3. Strain-Specific qPCR Designs and Electrophoretic Validation
3.4. Specificities, Standard Curves, and Amplification Efficiencies of qPCR Assays
3.5. Quantification of Ingested B. longum Strains in Mouse and Human Fecal Samples
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kamada, N.; Chen, G.Y.; Inohara, N.; Núñez, G. Control of pathogens and pathobionts by the gut microbiota. Nat. Immunol. 2013, 14, 685–690. [Google Scholar] [CrossRef] [PubMed]
- Kau, A.L.; Ahern, P.P.; Griffin, N.W.; Goodman, A.L.; Gordon, J.I. Human nutrition, the gut microbiome and the immune system. Nat. Cell Biol. 2011, 474, 327–336. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Korpela, K.; de Vos, W.M. Early life colonization of the human gut: Microbes matter everywhere. Curr. Opin. Microbiol. 2018, 44, 70–78. [Google Scholar] [CrossRef] [Green Version]
- Hidalgo-Cantabrana, C.; Delgado, S.; Ruiz, L.; Ruas-Madiedo, P.; Sánchez, B.; Margolles, A. Bifidobacteria and Their Health-Promoting Effects. Tuberc. Nontuberculous Mycobact. Infect. 2018, 73–98. [Google Scholar] [CrossRef]
- Krumbeck, J.A.; Maldonado-Gomez, M.X.; Martínez, I.; Frese, S.A.; Burkey, T.E.; Rasineni, K.; Ramer-Tait, A.E.; Harris, E.N.; Hutkins, R.W.; Walter, J. In Vivo Selection To Identify Bacterial Strains with Enhanced Ecological Performance in Synbiotic Applications. Appl. Environ. Microbiol. 2015, 81, 2455–2465. [Google Scholar] [CrossRef] [Green Version]
- Wu, G.; Zhang, C.; Wu, H.; Wang, R.; Shen, J.; Wang, L.; Zhao, Y.; Pang, X.; Zhang, X.; Zhao, L.; et al. Genomic Microdiversity of Bifidobacterium pseudocatenulatum Underlying Differential Strain-Level Responses to Dietary Carbohydrate Intervention. mBio 2017, 8, e02348-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arboleya, S.; Watkins, C.; Stanton, C.; Ross, R.P. Gut Bifidobacteria Populations in Human Health and Aging. Front. Microbiol. 2016, 7, 1204. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gevers, D.; Kugathasan, S.; Denson, L.A.; Vázquez-Baeza, Y.; Van Treuren, W.; Ren, B.; Schwager, E.; Knights, D.; Song, S.J.; Yassour, M.; et al. The Treatment-Naive Microbiome in New-Onset Crohn’s Disease. Cell Host Microbe 2014, 15, 382–392. [Google Scholar] [CrossRef] [Green Version]
- Schloissnig, S.; Arumugam, M.; Sunagawa, S.; Mitreva, M.; Tap, J.; Zhu, A.; Waller, A.; Mende, D.R.; Kultima, J.R.; Martin, J.; et al. Genomic variation landscape of the human gut microbiome. Nat. Cell Biol. 2013, 493, 45–50. [Google Scholar] [CrossRef] [Green Version]
- Odamaki, T.; Bottacini, F.; Kato, K.; Mitsuyama, E.; Yoshida, K.; Horigome, A.; Xiao, J.-Z.; Van Sinderen, D. Genomic diversity and distribution of Bifidobacterium longum subsp. longum across the human lifespan. Sci. Rep. 2018, 8, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Faith, J.J.; Guruge, J.L.; Charbonneau, M.; Subramanian, S.; Seedorf, H.; Goodman, A.L.; Clemente, J.C.; Knight, R.; Heath, A.C.; Leibel, R.L.; et al. The Long-Term Stability of the Human Gut Microbiota. Science 2013, 341, 1237439. [Google Scholar] [CrossRef] [Green Version]
- Walter, J.; Maldonado-Gómez, M.X.; Martínez, I. To engraft or not to engraft: An ecological framework for gut microbiome modulation with live microbes. Curr. Opin. Biotechnol. 2018, 49, 129–139. [Google Scholar] [CrossRef]
- Xiao, Y.; Zhao, J.; Zhang, H.; Zhai, Q.; Chen, W. Mining Lactobacillus and Bifidobacterium for organisms with long-term gut colonization potential. Clin. Nutr. 2020, 39, 1315–1323. [Google Scholar] [CrossRef]
- Panigrahi, P.; Parida, S.; Pradhan, L.; Mohapatra, S.S.; Misra, P.R.; Johnson, J.A.; Chaudhry, R.; Taylor, S.; Hansen, N.I.; Gewolb, I.H. Long-term Colonization of a Lactobacillus plantarum Synbiotic Preparation in the Neonatal Gut. J. Pediatr. Gastroenterol. Nutr. 2008, 47, 45–53. [Google Scholar] [CrossRef]
- Spanhaak, S.; Havenaar, R.; Schaafsma, G. The effect of consumption of milk fermented by Lactobacillus casei strain Shirota on the intestinal microflora and immune parameters in humans. Eur. J. Clin. Nutr. 1998, 52, 899–907. [Google Scholar] [CrossRef] [Green Version]
- Toscano, M.; De Grandi, R.; Miniello, V.L.; Mattina, R.; Drago, L. Ability of Lactobacillus kefiri LKF01 (DSM32079) to colonize the intestinal environment and modify the gut microbiota composition of healthy individuals. Dig. Liver Dis. 2017, 49, 261–267. [Google Scholar] [CrossRef] [Green Version]
- Jacobsen, C.N.; Nielsen, V.R.; Hayford, A.E.; Møller, P.L.; Michaelsen, K.F.; Pærregaard, A.; Sandström, B.; Tvede, M.; Jakobsen, M. Screening of Probiotic Activities of Forty-Seven Strains of Lactobacillus spp. by In Vitro Techniques and Evaluation of the Colonization Ability of Five Selected Strains in Humans. Appl. Environ. Microbiol. 1999, 65, 4949–4956. [Google Scholar] [CrossRef] [Green Version]
- Fujiwara, S.; Seto, Y.; Kimura, A.; Hashiba, H. Intestinal transit of an orally administered streptomycin-rifampicin-resistant variant ofBifidobacterium longumSBT2928: Its long-term survival and effect on the intestinal microflora and metabolism. J. Appl. Microbiol. 2001, 90, 43–52. [Google Scholar] [CrossRef] [Green Version]
- Frese, S.A.; Hutton, A.A.; Contreras, L.N.; Shaw, C.A.; Palumbo, M.; Casaburi, G.; Xu, G.; Davis, J.C.C.; Lebrilla, C.B.; Henrick, B.M.; et al. Persistence of Supplemented Bifidobacterium longum subsp. infantis EVC001 in Breastfed Infants. mSphere 2017, 2, e00501-17. [Google Scholar] [CrossRef] [Green Version]
- Saxelin, M.; Pessi, T.; Salminen, S. Fecal recovery following oral administration of Lactobacillus Strain GG (ATCC 53103) in gelatine capsules to healthy volunteers. Int. J. Food Microbiol. 1995, 25, 199–203. [Google Scholar] [CrossRef]
- Yuki, N.; Watanabe, K.; Mike, A.; Tagami, Y.; Tanaka, R.; Ohwaki, M.; Morotomi, M. Survival of a probiotic, Lactobacillus casei strain Shirota, in the gastrointestinal tract: Selective isolation from faeces and identification using monoclonal antibodies. Int. J. Food Microbiol. 1999, 48, 51–57. [Google Scholar] [CrossRef]
- Lee, Y.K.; Ho, P.S.; Low, C.S.; Arvilommi, H.; Salminen, S. Permanent Colonization by Lactobacillus casei Is Hindered by the Low Rate of Cell Division in Mouse Gut. Appl. Environ. Microbiol. 2004, 70, 670–674. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Denou, E.; Pridmore, R.D.; Berger, B.; Panoff, J.-M.; Arigoni, F.; Brüssow, H. Identification of Genes Associated with the Long-Gut-Persistence Phenotype of the Probiotic Lactobacillus johnsonii Strain NCC533 Using a Combination of Genomics and Transcriptome Analysis. J. Bacteriol. 2008, 190, 3161–3168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Valeur, N.; Engel, P.; Carbajal, N.; Connolly, E.; Ladefoged, K. Colonization and Immunomodulation by Lactobacillus reuteri ATCC 55730 in the Human Gastrointestinal Tract. Appl. Environ. Microbiol. 2004, 70, 1176–1181. [Google Scholar] [CrossRef] [Green Version]
- Tobin, J.M.; Garland, S.M.; Jacobs, S.E.; Pirotta, M.; Tabrizi, S.N. Rapid assay to assess colonization patterns following in-vivo probiotic ingestion. BMC Res. Notes 2013, 6, 252. [Google Scholar] [CrossRef] [Green Version]
- Massi, M.; Vitali, B.; Federici, F.; Matteuzzi, D.; Brigidi, P. Identification method based on PCR combined with automated ribotyping for tracking probiotic Lactobacillus strains colonizing the human gut and vagina. J. Appl. Microbiol. 2004, 96, 777–786. [Google Scholar] [CrossRef]
- Kankainen, M.; Paulin, L.; Tynkkynen, S.; von Ossowski, I.; Reunanen, J.; Partanen, P.; Satokari, R.; Vesterlund, S.; Hendrickx, A.P.A.; Lebeer, S.; et al. Comparative genomic analysis of Lactobacillus rhamnosus GG reveals pili containing a human- mucus binding protein. Proc. Natl. Acad. Sci. USA 2009, 106, 17193–17198. [Google Scholar] [CrossRef] [Green Version]
- Toshimitsu, T.; Nakamura, M.; Ikegami, S.; Terahara, M.; Itou, H. Strain-Specific Identification ofBifidobacterium bifidumOLB6378 by PCR. Biosci. Biotechnol. Biochem. 2013, 77, 572–576. [Google Scholar] [CrossRef] [Green Version]
- Treven, P.; Turkova, K.; Trmčić, A.; Obermajer, T.; Rogelj, I.; Matijašić, B.B. Detection and quantification of probiotic strain Lactobacillus gasseri K7 in faecal samples by targeting bacteriocin genes. Folia Microbiol. 2013, 58, 623–630. [Google Scholar] [CrossRef]
- Fujimoto, J.; Tanigawa, K.; Kudo, Y.; Makino, H.; Watanabe, K. Identification and quantification of viable Bifidobacterium breve strain Yakult in human faeces by using strain-specific primers and propidium monoazide. J. Appl. Microbiol. 2010, 110, 209–217. [Google Scholar] [CrossRef]
- Sattler, V.A.; Mohnl, M.; Klose, V. Development of a Strain-Specific Real-Time PCR Assay for Enumeration of a Probiotic Lactobacillus reuteri in Chicken Feed and Intestine. PLoS ONE 2014, 9, e90208. [Google Scholar] [CrossRef] [Green Version]
- Laing, C.; Buchanan, C.; Taboada, E.N.; Zhang, Y.; Kropinski, A.; Villegas, A.; Thomas, J.E.; Gannon, V.P.J. Pan-genome sequence analysis using Panseq: An online tool for the rapid analysis of core and accessory genomic regions. BMC Bioinform. 2010, 11, 461. [Google Scholar] [CrossRef] [Green Version]
- Brittnacher, M.J.; Fong, C.; Hayden, H.S.; Jacobs, M.A.; Radey, M.; Rohmer, L. PGAT: A multistrain analysis resource for microbial genomes. Bioinformatics 2011, 27, 2429–2430. [Google Scholar] [CrossRef]
- Zhao, Y.; Wu, J.; Yang, J.; Sun, S.; Xiao, J.; Yu, J. PGAP: Pan-genomes analysis pipeline. Bioinformatics 2011, 28, 416–418. [Google Scholar] [CrossRef] [Green Version]
- Page, A.J.; Cummins, C.A.; Hunt, M.; Wong, V.K.; Reuter, S.; Holden, M.T.G.; Fookes, M.; Falush, D.; Keane, J.A.; Parkhill, J. Roary: Rapid large-scale prokaryote pan genome analysis. Bioinformatics 2015, 31, 3691–3693. [Google Scholar] [CrossRef]
- Luo, R.; Liu, B.; Xie, Y.; Li, Z.; Huang, W.; Yuan, J.; He, G.; Chen, Y.; Pan, Q.; Liu, Y.; et al. Erratum: SOAPdenovo2: An empirically improved memory-efficient short-read de novo assembler. GigaScience 2015, 4, 30. [Google Scholar] [CrossRef] [Green Version]
- Cui, Y.; Yang, X.; Didelot, X.; Guo, C.; Li, D.; Yan, Y.; Zhang, Y.; Yuan, Y.; Yang, H.; Wang, J.; et al. Epidemic Clones, Oceanic Gene Pools, and Eco-LD in the Free Living Marine Pathogen Vibrio parahaemolyticus. Mol. Biol. Evol. 2015, 32, 1396–1410. [Google Scholar] [CrossRef] [Green Version]
- Delcher, A.L.; Salzberg, S.L.; Phillippy, A.M. Using MUMmer to Identify Similar Regions in Large Sequence Sets. Curr. Protoc. Bioinform. 2003, 10, 10.3.1–10.3.18. [Google Scholar] [CrossRef]
- Seemann, T. Prokka: Rapid Prokaryotic Genome Annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef]
- Madden, T. The NCBI Handbook, 2nd ed.; National Center for Biotechnology Information (US): Bethesda, MD, USA, 2013.
- Daranas, N.; Bonaterra, A.; Francés, J.; Cabrefiga, J.; Montesinos, E.; Badosa, E. Monitoring Viable Cells of the Biological Control AgentLactobacillus plantarumPM411 in Aerial Plant Surfaces by Means of a Strain-Specific Viability Quantitative PCR Method. Appl. Environ. Microbiol. 2018, 84, 84. [Google Scholar] [CrossRef] [Green Version]
- Fujimoto, J.; Watanabe, K. Quantitative Detection of Viable Bifidobacterium bifidum BF-1 Cells in Human Feces by Using Propidium Monoazide and Strain-Specific Primers. Appl. Environ. Microbiol. 2013, 79, 2182–2188. [Google Scholar] [CrossRef] [Green Version]
- Karjalainen, H.; Ahlroos, T.; Myllyluoma, E.; Tynkkynen, S. Real-time PCR assays for strain-specific quantification of probiotic strains in human faecal samples. Int. Dairy J. 2012, 27, 58–64. [Google Scholar] [CrossRef]
- Zhai, Q.; Shen, X.; Cen, S.; Zhang, C.; Tian, F.; Zhao, J.; Zhang, H.; Xue, Y.; Chen, W. Screening of Lactobacillus salivarius strains from the feces of Chinese populations and the evaluation of their effects against intestinal inflammation in mice. Food Funct. 2020, 11, 221–235. [Google Scholar] [CrossRef]
- Harris, H.M.B.; Bourin, M.J.B.; Claesson, M.J.; O’Toole, P.W. Phylogenomics and comparative genomics of Lactobacillus salivarius, a mammalian gut commensal. Microb. Genom. 2017, 3, e000115. [Google Scholar] [CrossRef]
- Wuyts, S.; Wittouck, S.; De Boeck, I.; Allonsius, C.N.; Pasolli, E.; Segata, N.; Lebeer, S. Large-Scale Phylogenomics of the Lactobacillus casei Group Highlights Taxonomic Inconsistencies and Reveals Novel Clade-Associated Features. mSystems 2017, 2, e00061-17. [Google Scholar] [CrossRef] [Green Version]
- Maldonado-Gómez, M.X.; Martínez, I.; Bottacini, F.; O’Callaghan, A.; Ventura, M.; van Sinderen, D.; Hillmann, B.; Vangay, P.; Knights, D.; Hutkins, R.W.; et al. Stable Engraftment of Bifidobacterium longum AH1206 in the Human Gut Depends on Individualized Features of the Resident Microbiome. Cell Host Microbe 2016, 20, 515–526. [Google Scholar] [CrossRef] [Green Version]
- Sato, N.; Seo, G.; Benno, Y. Development of Strain-Specific PCR Primers for Quantitative Detection of Bacillus mesentericus Strain TO-A in Human Feces. Biol. Pharm. Bull. 2014, 37, 123–129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Species | Accession Number | Culture Conditions |
---|---|---|
Bifidobacterium | deMan Rogosa Sharpe (MRS) broth supplemented with 0.1% L-cysteine HCl at 37 °C | |
B. longum | RG4-1 b, FGSZY6M4 b, M1-20-R01-3 b, 274 b, FSHHK13M1 b, FSDLZ57M1 b, NaTon 49-4 b, FJSWXJ11M1 b, HUB 36-17 b, 28-10 b, ZCC7 b | |
B.breve | DSM 20213 c | |
B. bifidum | DSM 20456 c | |
B. pseudocatenulatum | FQHXN5M4 b | |
B. pseudolongum | 56M2 b | |
B. animalis | BB12d | |
B. adolescentis | L2-32 e | |
Lactobacillus | MRS broth at 37 °C | |
L. salivarius | DSM 20555 c | |
L. gasseri | DSM 20243 c | |
L. casei | DSM 20011 c | |
L. acidophilus | DSM 20079 c | |
L. plantarum | DSM 20174 c | |
L. reuteri | DSM 20016 c | |
L. rhamnosus | LMS2-1 e | |
Non-lactic acid bacteria (LAB) | ||
Escherichia coli | CMCC 44102 f | Luria-Bertani (LB) broth at 37 °C |
Akkermansia muciniphila | FJLHD50M21 b | Brain Heart Infusion (BHI) broth at 37 °C |
Faecalibacterium prausnitzii | DSM 17677 c | BHI broth containing 3.7% BHI powder supplemented with 0.5% yeast extract, 0.0005% hemin, 0.0005% vitamin K and 0.2% L-cysteine HCl at 37 °C |
Enterococcus faecalis | CCFM596 b | BHI broth at 37 °C |
Bacteroides fragilis | ATCC 25285/NCTC 9343 g | BHI broth supplemented with 0.1% L-cysteine HCl, 0.001% hemin and 0.0002% vitamin K at 37 °C |
Bacteroides thetaiotaomicron | FNMHLBE9-K-7 b | |
Bacteroides eggerthii | FSDTA-HCK-B-9 b | |
Bacteroides cellulosilyticus | FSDTA-ELI-BHI-5 b | |
Bacteroides nordii | FNMHLBE13K2 b | |
Bacteroides stercoris | FJSWX62K34 b | |
Bacteroides uniformis | FJSWX62K43 b | |
Bacteroides caccae | FFJLY22K5 b | |
Parabacteroides distasonis | FSDTA-HCM-XY-12 b | |
Bacteroides dorei | FJSWX61E4 b | |
Bacteroides faecis | FTJS2E2 b | |
Bacteroides intestinalis | FBJ60K5 b | |
Bacteroides vulgatus | FSDLZ51K1 b | |
Bacteroides finegoldii | FNMHLBE11E1 b | |
Bacteroides ovatus | FBJ10-K-10 b | |
Bacteroides clarus | F-FJ-LY 22-K-22 b | |
Bacteroides salyersiae | FSDTA-ELI-BHI-9 b | |
Bacteroides xylanisolvens | FSDTAHCMXY17 b | |
Parabacteroides merdae | FSDTAELIBHI4 b | |
Clostridium butyricum | FJSCZD1G10 b | Reinforced Clostridial Medium (RCM) at 37 °C |
Genome | Strain | BioSample | Size (Mb) | GC% | Scaffolds | CDS |
---|---|---|---|---|---|---|
GCA_001576955.1_ASM157695v1 | 121.2 | SAMN04497913 | 1.87256 | 60.3 | 234 | 1453 |
GCA_002331305.1_ASM233130v1 | UBA2088 | SAMN06457477 | 1.87849 | 59.2 | 227 | 0 |
GCF_900157195.1_Bifido_02_v1 | Bifido_02 | SAMEA51816418 | 2.33429 | 60.1 | 97 | 1860 |
GCF_900157165.1_Bifido_12_v1 | Bifido_12 | SAMEA51823918 | 2.07288 | 60.5 | 681 | 1743 |
GCF_900157155.1_Bifido_06_v1 | Bifido_06 | SAMEA51819418 | 2.42182 | 60 | 48 | 1978 |
GCF_900157145.1_Bifido_03_v1 | Bifido_03 | SAMEA51817168 | 2.41363 | 60.1 | 82 | 1962 |
GCF_900157115.1_Bifido_05_v1 | Bifido_05 | SAMEA51818668 | 2.33474 | 59.9 | 88 | 1906 |
GCF_900157095.1_Bifido_01_v1 | Bifido_01 | SAMEA51815668 | 2.33463 | 59.9 | 39 | 1907 |
GCF_900157055.1_Bifido_09_v1 | Bifido_09 | SAMEA51821668 | 2.66124 | 59.9 | 68 | 2225 |
GCF_900104835.1_IMG-taxon_2634166334_annotated_assembly | DSM 20219 | SAMN04489748 | 2.44902 | 60.3 | 6 | 1942 |
GCF_004334865.1_ASM433486v1 | MCC10119 | SAMN06368669 | 2.48689 | 60.1 | 45 | 2023 |
GCF_004334855.1_ASM433485v1 | MCC10122 | SAMN06368672 | 2.46043 | 60.1 | 49 | 1978 |
GCF_004334815.1_ASM433481v1 | MCC10123 | SAMN06368673 | 2.5065 | 59.7 | 49 | 2060 |
GCF_004334795.1_ASM433479v1 | MCC10125 | SAMN06368675 | 2.44774 | 60.2 | 43 | 1979 |
GCF_004334785.1_ASM433478v1 | MCC10128 | SAMN06368678 | 2.50961 | 59.9 | 57 | 2089 |
GCF_004334775.1_ASM433477v1 | MCC10129 | SAMN06368679 | 2.27353 | 60.1 | 18 | 1812 |
GCF_004334745.1_ASM433474v1 | MCC10117 | SAMN06368667 | 2.30167 | 59.9 | 35 | 1807 |
GCF_004334715.1_ASM433471v1 | MCC10120 | SAMN06368670 | 2.48377 | 60.2 | 62 | 2014 |
GCF_004334705.1_ASM433470v1 | MCC10118 | SAMN06368668 | 2.34975 | 59.9 | 36 | 1897 |
GCF_004334695.1_ASM433469v1 | MCC10121 | SAMN06368671 | 2.38447 | 60 | 26 | 1916 |
GCF_004334645.1_ASM433464v1 | MCC10124 | SAMN06368674 | 2.45702 | 60.1 | 47 | 1985 |
GCF_004334635.1_ASM433463v1 | MCC10126 | SAMN06368676 | 2.55307 | 59.8 | 68 | 2055 |
GCF_004334625.1_ASM433462v1 | MCC10130 | SAMN06368680 | 2.36857 | 60 | 59 | 1908 |
GCF_004334615.1_ASM433461v1 | MCC10127 | SAMN06368677 | 2.35673 | 60.1 | 41 | 1874 |
GCF_004334555.1_ASM433455v1 | MCC10212 | SAMN06368681 | 2.36547 | 59.9 | 28 | 1904 |
GCF_004334545.1_ASM433454v1 | MCC10002 | SAMN06368569 | 2.63451 | 60 | 59 | 2202 |
GCF_004334535.1_ASM433453v1 | MCC10006 | SAMN06368572 | 2.45014 | 60.4 | 83 | 1991 |
GCF_004334515.1_ASM433451v1 | MCC10009 | SAMN06368575 | 2.5237 | 60.1 | 60 | 2035 |
GCF_004334485.1_ASM433448v1 | MCC10011 | SAMN06368577 | 2.39746 | 59.9 | 34 | 1931 |
GCF_004334465.1_ASM433446v1 | MCC10016 | SAMN06368581 | 2.37118 | 60 | 66 | 1893 |
GCF_004334445.1_ASM433444v1 | MCC10027 | SAMN06368589 | 2.50583 | 59.9 | 59 | 2042 |
GCF_004334435.1_ASM433443v1 | MCC10019 | SAMN06368584 | 2.30453 | 60.1 | 41 | 1837 |
GCF_004334425.1_ASM433442v1 | MCC10028 | SAMN06368590 | 2.42541 | 60.2 | 44 | 1983 |
GCF_004334365.1_ASM433436v1 | MCC10038 | SAMN06368598 | 2.36701 | 59.9 | 38 | 1968 |
GCF_004334355.1_ASM433435v1 | MCC10030 | SAMN06368592 | 2.51844 | 60.1 | 64 | 2023 |
GCF_004334345.1_ASM433434v1 | MCC10040 | SAMN06368600 | 2.44996 | 60.2 | 45 | 1996 |
GCF_004334335.1_ASM433433v1 | MCC10039 | SAMN06368599 | 2.38905 | 60 | 34 | 1924 |
GCF_004334325.1_ASM433432v1 | MCC10047 | SAMN06368607 | 2.36451 | 59.9 | 64 | 1861 |
GCF_004334285.1_ASM433428v1 | MCC10051 | SAMN06368610 | 2.30363 | 60.1 | 42 | 1830 |
GCF_004334255.1_ASM433425v1 | MCC10057 | SAMN06368616 | 2.18862 | 59.9 | 73 | 1725 |
GCF_004334245.1_ASM433424v1 | MCC10054 | SAMN06368613 | 2.29564 | 60 | 61 | 1842 |
GCF_004334235.1_ASM433423v1 | MCC10059 | SAMN06368618 | 2.43718 | 60 | 47 | 2005 |
GCF_004334215.1_ASM433421v1 | MCC10058 | SAMN06368617 | 2.32956 | 60.2 | 65 | 1886 |
GCF_004334205.1_ASM433420v1 | MCC10072 | SAMN06368628 | 2.23388 | 60 | 23 | 1742 |
GCF_004334165.1_ASM433416v1 | MCC10074 | SAMN06368630 | 2.41001 | 59.8 | 34 | 1965 |
GCF_004334155.1_ASM433415v1 | MCC10077 | SAMN06368633 | 2.41162 | 60 | 40 | 1957 |
GCF_004334145.1_ASM433414v1 | MCC10083 | SAMN06368638 | 2.47557 | 60.2 | 64 | 1953 |
GCF_004334105.1_ASM433410v1 | MCC10085 | SAMN06368640 | 2.3663 | 60 | 64 | 1908 |
GCF_004334075.1_ASM433407v1 | MCC10003 | SAMN06368570 | 2.52677 | 60.1 | 69 | 2047 |
GCF_004334065.1_ASM433406v1 | MCC10004 | SAMN06368571 | 2.55173 | 60 | 52 | 2028 |
GCF_004334045.1_ASM433404v1 | MCC10007 | SAMN06368573 | 2.48463 | 60.2 | 59 | 2024 |
GCF_004334035.1_ASM433403v1 | MCC10008 | SAMN06368574 | 2.54367 | 60 | 80 | 2119 |
GCF_004334005.1_ASM433400v1 | MCC10010 | SAMN06368576 | 2.45245 | 60.4 | 93 | 1984 |
GCF_004333995.1_ASM433399v1 | MCC10012 | SAMN06368578 | 2.47987 | 59.6 | 67 | 1977 |
GCF_004333975.1_ASM433397v1 | MCC10014 | SAMN06368579 | 2.46621 | 60.2 | 59 | 2007 |
GCF_004333935.1_ASM433393v1 | MCC10017 | SAMN06368582 | 2.44883 | 59.7 | 60 | 1972 |
GCF_004333925.1_ASM433392v1 | MCC10015 | SAMN06368580 | 2.63029 | 59.9 | 83 | 2177 |
GCF_004333905.1_ASM433390v1 | MCC10018 | SAMN06368583 | 2.33041 | 60 | 32 | 1891 |
GCF_004333895.1_ASM433389v1 | MCC10022 | SAMN06368586 | 2.41904 | 59.7 | 55 | 1950 |
GCF_004333875.1_ASM433387v1 | MCC10021 | SAMN06368585 | 2.23575 | 60 | 58 | 1774 |
GCF_004333855.1_ASM433385v1 | MCC10023 | SAMN06368587 | 2.30816 | 60.3 | 41 | 1853 |
GCF_004333845.1_ASM433384v1 | MCC10025 | SAMN06368588 | 2.40884 | 60.1 | 56 | 1912 |
GCF_004333795.1_ASM433379v1 | MCC10029 | SAMN06368591 | 2.3461 | 59.9 | 55 | 1877 |
GCF_004333785.1_ASM433378v1 | MCC10031 | SAMN06368593 | 2.40115 | 60.1 | 41 | 1916 |
GCF_004333775.1_ASM433377v1 | MCC10033 | SAMN06368594 | 2.39204 | 60 | 63 | 1929 |
GCF_004333765.1_ASM433376v1 | MCC10034 | SAMN06368595 | 2.25363 | 60 | 70 | 1771 |
GCF_004333735.1_ASM433373v1 | MCC10036 | SAMN06368597 | 2.24998 | 59.9 | 22 | 1811 |
GCF_004333715.1_ASM433371v1 | MCC10035 | SAMN06368596 | 2.4575 | 59.8 | 52 | 2012 |
GCF_004333695.1_ASM433369v1 | MCC10041 | SAMN06368601 | 2.37064 | 60.1 | 47 | 1906 |
GCF_004333675.1_ASM433367v1 | MCC10042 | SAMN06368602 | 2.32056 | 60.1 | 53 | 1867 |
GCF_004333645.1_ASM433364v1 | MCC10044 | SAMN06368604 | 2.51281 | 60.3 | 50 | 2055 |
GCF_004333635.1_ASM433363v1 | MCC10043 | SAMN06368603 | 2.62386 | 59.5 | 62 | 2115 |
GCF_004333625.1_ASM433362v1 | MCC10045 | SAMN06368605 | 2.43778 | 60.3 | 61 | 1973 |
GCF_004333575.1_ASM433357v1 | MCC10046 | SAMN06368606 | 2.28641 | 59.9 | 71 | 1761 |
GCF_004333565.1_ASM433356v1 | MCC10048 | SAMN06368608 | 2.45602 | 59.8 | 71 | 1949 |
GCF_004333555.1_ASM433355v1 | MCC10050 | SAMN06368609 | 2.28037 | 59.8 | 34 | 1782 |
GCF_004333535.1_ASM433353v1 | MCC10052 | SAMN06368611 | 2.42874 | 60.1 | 65 | 1956 |
GCF_004333515.1_ASM433351v1 | MCC10053 | SAMN06368612 | 2.42582 | 60.3 | 51 | 1942 |
GCF_004333475.1_ASM433347v1 | MCC10056 | SAMN06368615 | 2.29975 | 60 | 79 | 1837 |
GCF_004333465.1_ASM433346v1 | MCC10060 | SAMN06368619 | 2.31311 | 60.2 | 59 | 1831 |
GCF_004333455.1_ASM433345v1 | MCC10055 | SAMN06368614 | 2.48603 | 60.1 | 72 | 2019 |
GCF_004333445.1_ASM433344v1 | MCC10062 | SAMN06368620 | 2.32592 | 59.8 | 59 | 1837 |
GCF_004333425.1_ASM433342v1 | MCC10064 | SAMN06368621 | 2.26578 | 60 | 40 | 1790 |
GCF_004333385.1_ASM433338v1 | MCC10066 | SAMN06368622 | 2.29383 | 59.8 | 53 | 1852 |
GCF_004333375.1_ASM433337v1 | MCC10067 | SAMN06368623 | 2.39437 | 59.6 | 55 | 1910 |
GCF_004333365.1_ASM433336v1 | MCC10068 | SAMN06368624 | 2.40787 | 59.7 | 58 | 1894 |
GCF_004333335.1_ASM433333v1 | MCC10069 | SAMN06368625 | 2.36718 | 59.9 | 57 | 1893 |
GCF_004333325.1_ASM433332v1 | MCC10070 | SAMN06368626 | 2.50822 | 59.6 | 48 | 2038 |
GCF_004333305.1_ASM433330v1 | MCC10071 | SAMN06368627 | 2.28772 | 60 | 49 | 1793 |
GCF_004333275.1_ASM433327v1 | MCC10073 | SAMN06368629 | 2.2843 | 59.7 | 42 | 1829 |
GCF_004333265.1_ASM433326v1 | MCC10075 | SAMN06368631 | 2.38497 | 60.1 | 53 | 1947 |
GCF_004333235.1_ASM433323v1 | MCC10076 | SAMN06368632 | 2.56355 | 60.2 | 50 | 2152 |
GCF_004333215.1_ASM433321v1 | MCC10079 | SAMN06368635 | 2.38272 | 59.9 | 77 | 1936 |
GCF_004333205.1_ASM433320v1 | MCC10078 | SAMN06368634 | 2.27198 | 59.8 | 58 | 1766 |
GCF_004333175.1_ASM433317v1 | MCC10080 | SAMN06368636 | 2.52893 | 60.2 | 59 | 2014 |
GCF_004333165.1_ASM433316v1 | MCC10081 | SAMN06368637 | 2.32346 | 59.9 | 56 | 1911 |
GCF_004333125.1_ASM433312v1 | MCC10084 | SAMN06368639 | 2.26435 | 60.1 | 46 | 1788 |
GCF_004333115.1_ASM433311v1 | MCC10086 | SAMN06368641 | 2.28382 | 59.8 | 48 | 1783 |
GCF_004333105.1_ASM433310v1 | MCC10087 | SAMN06368642 | 2.30319 | 60 | 49 | 1819 |
GCF_004333065.1_ASM433306v1 | MCC10089 | SAMN06368643 | 2.32481 | 60.3 | 41 | 1853 |
GCF_004333045.1_ASM433304v1 | MCC10096 | SAMN06368650 | 2.57129 | 59.7 | 39 | 2099 |
GCF_004333035.1_ASM433303v1 | MCC10090 | SAMN06368644 | 2.34731 | 59.8 | 49 | 1883 |
GCF_004333015.1_ASM433301v1 | MCC10091 | SAMN06368645 | 2.39421 | 60 | 64 | 1931 |
GCF_004333005.1_ASM433300v1 | MCC10103 | SAMN06368657 | 2.39468 | 59.9 | 16 | 1933 |
GCF_004332965.1_ASM433296v1 | MCC10100 | SAMN06368654 | 2.518 | 60.1 | 56 | 2037 |
GCF_004332945.1_ASM433294v1 | MCC10116 | SAMN06368666 | 2.62898 | 60 | 47 | 2167 |
GCF_004332935.1_ASM433293v1 | MCC10112 | SAMN06368662 | 2.27757 | 60 | 58 | 1804 |
GCF_004332925.1_ASM433292v1 | MCC10092 | SAMN06368646 | 2.23483 | 59.9 | 89 | 1742 |
GCF_004332895.1_ASM433289v1 | MCC10094 | SAMN06368648 | 2.50962 | 59.9 | 39 | 2078 |
GCF_004332865.1_ASM433286v1 | MCC10093 | SAMN06368647 | 2.45894 | 60.2 | 57 | 2000 |
GCF_004332855.1_ASM433285v1 | MCC10095 | SAMN06368649 | 2.35682 | 60.3 | 95 | 1915 |
GCF_004332835.1_ASM433283v1 | MCC10098 | SAMN06368652 | 2.32667 | 59.9 | 58 | 1815 |
GCF_004332825.1_ASM433282v1 | MCC10097 | SAMN06368651 | 2.28035 | 60 | 52 | 1805 |
GCF_004332765.1_ASM433276v1 | MCC10107 | SAMN06368659 | 2.38475 | 59.8 | 45 | 1931 |
GCF_004332755.1_ASM433275v1 | MCC10102 | SAMN06368656 | 2.53875 | 60.1 | 56 | 2077 |
GCF_004332745.1_ASM433274v1 | MCC10099 | SAMN06368653 | 2.34007 | 60.1 | 66 | 1870 |
GCF_004332735.1_ASM433273v1 | MCC10106 | SAMN06368658 | 2.41503 | 60.1 | 74 | 1947 |
GCF_004332725.1_ASM433272v1 | MCC10101 | SAMN06368655 | 2.41806 | 60.1 | 65 | 1953 |
GCF_004332665.1_ASM433266v1 | MCC10108 | SAMN06368660 | 2.41875 | 60.3 | 73 | 1972 |
GCF_004332655.1_ASM433265v1 | MCC10111 | SAMN06368661 | 2.43826 | 60 | 49 | 2007 |
GCF_004332645.1_ASM433264v1 | MCC10115 | SAMN06368665 | 2.43372 | 60.3 | 54 | 2017 |
GCF_004332635.1_ASM433263v1 | MCC10113 | SAMN06368663 | 2.46411 | 60 | 62 | 2021 |
GCF_004332625.1_ASM433262v1 | MCC10114 | SAMN06368664 | 2.45459 | 59.8 | 58 | 2005 |
GCF_002900845.1_ASM290084v1 | CECT 7210 | SAMEA3158508 | 2.4677 | 59.9 | 1 | 2009 |
GCF_002861445.1_ASM286144v1 | UMB0788 | SAMN08193649 | 2.45493 | 60.2 | 33 | 2051 |
GCF_002833285.1_ASM283328v1 | APC1466 | SAMN07958351 | 2.41998 | 59.8 | 51 | 1967 |
GCF_002833265.1_ASM283326v1 | APC1476 | SAMN07958355 | 2.53254 | 60 | 48 | 2094 |
GCF_002833255.1_ASM283325v1 | DPC6320 | SAMN07958364 | 2.33037 | 59.9 | 25 | 1807 |
GCF_002833215.1_ASM283321v1 | DPC6323 | SAMN07958366 | 2.39696 | 60.2 | 52 | 1911 |
GCF_002833205.1_ASM283320v1 | APC1462 | SAMN07958348 | 2.41778 | 60.3 | 27 | 1953 |
GCF_002833185.1_ASM283318v1 | APC1464 | SAMN07958349 | 2.34652 | 60.1 | 31 | 1873 |
GCF_002833175.1_ASM283317v1 | APC1465 | SAMN07958350 | 2.45221 | 59.7 | 57 | 1976 |
GCF_002833135.1_ASM283313v1 | APC1468 | SAMN07958352 | 2.39516 | 60.2 | 45 | 1966 |
GCF_002833125.1_ASM283312v1 | APC1473 | SAMN07958354 | 2.31707 | 59.8 | 39 | 1817 |
GCF_002833115.1_ASM283311v1 | APC1472 | SAMN07958353 | 2.36404 | 60.2 | 50 | 1863 |
GCF_002833075.1_ASM283307v1 | APC1477 | SAMN07958356 | 2.22881 | 59.8 | 24 | 1726 |
GCF_002833065.1_ASM283306v1 | APC1480 | SAMN07958358 | 2.47775 | 59.9 | 27 | 2022 |
GCF_002833055.1_ASM283305v1 | APC1478 | SAMN07958357 | 2.22335 | 59.8 | 21 | 1729 |
GCF_002833035.1_ASM283303v1 | APC1482 | SAMN07958359 | 2.33744 | 60.2 | 72 | 1858 |
GCF_002833015.1_ASM283301v1 | DPC6316 | SAMN07958362 | 2.39397 | 60.4 | 32 | 1912 |
GCF_002832995.1_ASM283299v1 | DPC6321 | SAMN07958365 | 2.38236 | 59.9 | 28 | 1894 |
GCF_002832985.1_ASM283298v1 | APC1503 | SAMN07958360 | 2.5627 | 59.7 | 39 | 2103 |
GCF_002832955.1_ASM283295v1 | APC1504 | SAMN07958361 | 2.31029 | 60.2 | 51 | 1860 |
GCF_002832945.1_ASM283294v1 | DPC6317 | SAMN07958363 | 2.44863 | 60.2 | 20 | 1918 |
GCF_002276185.1_ASM227618v1 | Indica | SAMN07503177 | 2.37423 | 60 | 43 | 1948 |
GCF_002076095.1_Bbif1886B | 1886B | SAMN06621706 | 2.47375 | 60.2 | 47 | 2083 |
GCF_002076015.1_Bbif1890B | 1890B | SAMN06621710 | 2.34167 | 59.9 | 109 | 1846 |
GCF_002075875.1_Bbif1898B | 1898B | SAMN06621716 | 2.47439 | 59.9 | 41 | 1998 |
GCF_001940535.1_BlonW11v1 | W11 | SAMN06109230 | 2.32998 | 59.9 | 22 | 1857 |
GCF_001892965.1_ASM189296v1 | 296B | SAMN05916052 | 2.25318 | 59.9 | 40 | 1685 |
GCF_001725985.1_ASM172598v1 | AH1206 | SAMN04576213 | 2.42129 | 60.2 | 1 | 1967 |
GCF_001719085.1_ASM171908v1 | 35624 | SAMN04254466 | 2.26406 | 60 | 1 | 1773 |
GCF_001686245.1_ASM168624v1 | LO-K29b | SAMD00047623 | 2.37271 | 60.1 | 97 | 1866 |
GCF_001686225.1_ASM168622v1 | LO-K29a | SAMD00047622 | 2.44918 | 60 | 85 | 1874 |
GCF_001686205.1_ASM168620v1 | LO-C29 | SAMD00047621 | 2.48387 | 60 | 49 | 1927 |
GCF_001686185.1_ASM168618v1 | LO-21 | SAMD00047620 | 2.65603 | 60.1 | 71 | 2034 |
GCF_001686165.1_ASM168616v1 | LO-10 | SAMD00047619 | 2.54024 | 60.3 | 80 | 1988 |
GCF_001686145.1_ASM168614v1 | LO-06 | SAMD00047618 | 2.43747 | 60 | 77 | 1926 |
GCF_001595465.1_ASM159546v1 | 379 | SAMN04155602 | 2.38762 | 60.2 | 24 | 1921 |
GCF_001546275.1_ASM154627v1 | CMW7750 | SAMN03842222 | 2.37208 | 60 | 39 | 1894 |
GCF_001516925.1_ASM151692v1 | MC-42 | SAMN04263942 | 2.28825 | 59.8 | 29 | 1792 |
GCF_001447975.1_ASM144797v1 | 7 | SAMN04129533 | 2.23558 | 60 | 36 | 1766 |
GCF_001447955.1_ASM144795v1 | 9 | SAMN04129541 | 2.23377 | 60 | 31 | 1765 |
GCF_001446275.1_ASM144627v1 | CCUG30698 | SAMN03785819 | 2.458 | 60.2 | 1 | 1956 |
GCF_001446255.1_ASM144625v1 | NCIMB8809 | SAMN03785818 | 2.34099 | 60.1 | 1 | 1807 |
GCF_001293145.1_ASM129314v1 | BG7 | SAMN03271682 | 2.45576 | 60.0068 | 2 | 1926 |
GCF_001275745.1_assBLOI2 | BLOI2 | SAMN03775040 | 2.41759 | 60 | 72 | 1937 |
GCF_001051015.2_ASM105101v2 | CECT 7210 | SAMEA3158508 | 2.4677 | 59.9 | 1 | 1992 |
GCF_001050555.1_ASM105055v1 | CECT 7347 | SAMEA3146249 | 2.32722 | 60 | 128 | 1868 |
GCF_000829295.1_ASM82929v1 | 105-A | SAMD00019943 | 2.29014 | 60.1 | 1 | 1772 |
GCF_000786175.1_ASM78617v1 | VMKB44 | SAMN03105207 | 2.50193 | 60.3 | 34 | 2080 |
GCF_000772485.1_ASM77248v1 | GT15 | SAMN03093230 | 2.33752 | 60 | 1 | 1815 |
GCF_000741245.1_Biflon_sub.lon | LMG 13197 | SAMN02673437 | 2.3847 | 60.3 | 8 | 1803 |
GCF_000730135.1_ASM73013v1 | EK13 | SAMN02862997 | 2.47453 | 60 | 39 | 2043 |
GCF_000730105.1_ASM73010v1 | 1-5B | SAMN02862991 | 2.36751 | 60.1 | 25 | 1902 |
GCF_000730055.1_ASM73005v1 | 7-1B | SAMN02862992 | 2.40709 | 59.8 | 34 | 1904 |
GCF_000730045.1_ASM73004v1 | 72B | SAMN02862994 | 2.37445 | 60.3 | 30 | 1950 |
GCF_000730035.1_ASM73003v1 | 17-1B | SAMN02862993 | 2.4672 | 60.2 | 20 | 1962 |
GCF_000730025.1_ASM73002v1 | EK5 | SAMN02862996 | 2.23129 | 59.7 | 28 | 1780 |
GCF_000497735.1_BLONGv1.0 | E18 | SAMN02471972 | 2.37297 | 60 | 1 | 1912 |
GCF_000478525.1_blongD2957 | D2957 | SAMN02472064 | 2.33023 | 60.4 | 13 | 1812 |
GCF_000261265.1_Blongum44Bv1.0 | 44B | SAMN00829148 | 2.55922 | 59.7 | 62 | 2109 |
GCF_000261245.1_Blongum16Bv1.0 | 1-6B | SAMN00829154 | 2.68677 | 59.6 | 171 | 2215 |
GCF_000261225.1_Blongum35Bv1.0 | 35B | SAMN00829158 | 2.51443 | 60.1 | 131 | 1967 |
GCF_000261205.1_Blongum22Bv1.0 | 2-2B | SAMN00829155 | 2.6257 | 59.7 | 141 | 2089 |
GCF_000219455.1_ASM21945v1 | KACC 91563 | SAMN02603656 | 2.39576 | 59.8115 | 3 | 1856 |
GCF_000210755.1_ASM21075v1 | F8 | SAMEA3138379 | 2.38499 | 59.9 | 1 | 1884 |
GCF_000196575.1_ASM19657v1 | 157F | SAMD00060953 | 2.40883 | 60.111 | 3 | 1923 |
GCF_000196555.1_ASM19655v1 | JCM 1217 | SAMD00060951 | 2.38516 | 60.3 | 1 | 1870 |
GCF_000185665.1_ASM18566v1 | 12_1_47BFAA | SAMN02463822 | 2.40599 | 60.1 | 61 | 1981 |
GCF_000166895.2_ASM16689v2 | DJO10A | SAMN02441414 | 2.37528 | 59.9 | 120 | 1792 |
GCF_000166315.1_ASM16631v1 | BBMN68 | SAMN02603469 | 2.26594 | 59.9 | 1 | 1740 |
GCF_000155415.1_ASM15541v1 | CCUG 52486 | SAMN02463677 | 2.48085 | 60 | 22 | 2034 |
GCF_000008945.1_ASM894v1 | DJO10A | SAMN02603512 | 2.38953 | 60.1182 | 3 | 1932 |
GCF_000007525.1_ASM752v1 | NCC2705 | SAMN02603675 | 2.26027 | 60.1075 | 2 | 1773 |
GCF_000003135.1_ASM313v1 | ATCC 55813 | SAMN00001475 | 2.39636 | 60.1 | 114 | 1901 |
GCF_003094635.1_ASM309463v1 | DS9_3 | SAMN06464100 | 2.39717 | 59.9 | 13 | 1955 |
GCF_003094855.1_ASM309485v1 | DS15_3 | SAMN06464097 | 2.39818 | 59.9 | 21 | 1956 |
GCF_003094935.1_ASM309493v1 | DS18_3 | SAMN06464098 | 2.44826 | 59.7 | 174 | 2002 |
GCF_003094955.1_ASM309495v1 | DS1_3 | SAMN06464096 | 2.41728 | 60 | 170 | 1958 |
GCF_003094975.1_ASM309497v1 | DS7_3 | SAMN06464099 | 2.23729 | 60 | 17 | 1765 |
GCF_003094995.1_ASM309499v1 | DS32_3 | SAMN08949007 | 2.23593 | 60.1 | 28 | 1761 |
Scaffold Number | Length | Gap | Average Length | N50 | N90 | GC Content (%) | |
---|---|---|---|---|---|---|---|
FGSZY6M4 | 52 | 2,321,455 | 3574 | 44,643.37 | 202,550 | 83,023 | 59.72 |
RG4-1 | 51 | 2,601,515 | 3420 | 51,010.1 | 224,480 | 60,103 | 60.21 |
M1-20-R01-3 | 46 | 2,237,922 | 3258 | 48,650.48 | 232,217 | 63,500 | 60.02 |
Gene | Non-Unique Gene Name | Annotation | Avg Group Size Nuc | Gene Tag |
---|---|---|---|---|
group_8150 | hypothetical protein | 227 | RG4-1_00079 | |
group_8151 | hypothetical protein | 296 | RG4-1_00112 | |
group_8152 | hypothetical protein | 257 | RG4-1_00222 | |
group_8153 | xerC_1 | Tyrosine recombinase XerC | 1286 | RG4-1_00224 |
group_8154 | Helix-turn-helix domain protein | 185 | RG4-1_00225 | |
group_8155 | Helix-turn-helix domain protein | 395 | RG4-1_00226 | |
group_8156 | Helix-turn-helix domain protein | 341 | RG4-1_00227 | |
group_8157 | site-specific tyrosine recombinase XerC | 1349 | RG4-1_00228 | |
group_8158 | hypothetical protein | 209 | RG4-1_00545 | |
group_8160 | hypothetical protein | 236 | RG4-1_00568 | |
group_8161 | hypothetical protein | 272 | RG4-1_01044 | |
group_8162 | mdeA_1 | Methionine gamma-lyase | 1277 | RG4-1_01045 |
group_8163 | Phage-related minor tail protein | 3317 | RG4-1_01165 | |
group_8164 | Phage tail protein | 788 | RG4-1_01166 | |
group_8165 | hypothetical protein | 1115 | RG4-1_01167 | |
group_8166 | smc_4 | Chromosome partition protein Smc | 1124 | RG4-1_01168 |
group_8167 | hypothetical protein | 359 | RG4-1_01169 | |
group_8168 | hypothetical protein | 1871 | RG4-1_01170 | |
group_8169 | hypothetical protein | 185 | RG4-1_01171 | |
group_8170 | acm | Lysozyme M1 precursor | 1280 | RG4-1_01174 |
yoaD | Putative 2-hydroxyacid dehydrogenase YoaD | 968 | RG4-1_01873 | |
group_8172 | araN_4 | putative arabinose-binding protein precursor | 1331 | RG4-1_01874 |
ycjP_2 | Inner membrane ABC transporter permease protein YcjP | 830 | RG4-1_01875 | |
group_8174 | ycjO_1 | Inner membrane ABC transporter permease protein YcjO | 899 | RG4-1_01876 |
group_8175 | hypothetical protein | 161 | RG4-1_01877 | |
group_8176 | nanE | Putative N-acetylmannosamine-6-phosphate 2-epimerase | 689 | RG4-1_01878 |
group_8177 | nanA | N-acetylneuraminate lyase | 917 | RG4-1_01879 |
bglK | Beta-glucoside kinase | 914 | RG4-1_01880 | |
rpiR | HTH-type transcriptional regulator RpiR | 905 | RG4-1_01881 | |
group_8180 | Chitinase class I | 551 | RG4-1_02208 | |
group_8181 | Thaumatin family protein | 284 | RG4-1_02209 | |
group_8182 | hypothetical protein | 197 | RG4-1_02210 |
Gene | Non-Unique Gene Name | Annotation | Avg Group Size Nuc | Gene Tag |
---|---|---|---|---|
group_6841 | hypothetical protein | 194 | M1-20-R01-3_00305 | |
group_6842 | hypothetical protein | 998 | M1-20-R01-3_00310 | |
group_6843 | hypothetical protein | 221 | M1-20-R01-3_00311 | |
group_6844 | hypothetical protein | 233 | M1-20-R01-3_00316 | |
group_6845 | hypothetical protein | 257 | M1-20-R01-3_00318 | |
group_6846 | hypothetical protein | 623 | M1-20-R01-3_00319 | |
group_6847 | hypothetical protein | 587 | M1-20-R01-3_00320 | |
group_6848 | hypothetical protein | 1745 | M1-20-R01-3_00324 | |
group_6849 | hypothetical protein | 236 | M1-20-R01-3_00325 | |
group_6850 | hypothetical protein | 581 | M1-20-R01-3_00326 | |
group_6851 | hypothetical protein | 191 | M1-20-R01-3_00327 | |
group_6852 | YcfA-like protein | 224 | M1-20-R01-3_00328 | |
group_6853 | hypothetical protein | 413 | M1-20-R01-3_00329 | |
group_6854 | hypothetical protein | 617 | M1-20-R01-3_00562 |
Gene | Non-Unique Gene Name | Annotation | Avg Group Size Nuc | Gene Tag |
---|---|---|---|---|
group_3844 | hypothetical protein | 203 | FGSZY6M4_00001 | |
group_3845 | pepD_1 | Dipeptidase | 1637 | FGSZY6M4_00002 |
group_3846 | epsH | Putative glycosyltransferase EpsH | 1034 | FGSZY6M4_00003 |
group_3847 | transcriptional regulator BetI | 821 | FGSZY6M4_00004 | |
group_3850 | N-acetylmuramoyl-L-alanine amidase | 878 | FGSZY6M4_00052 | |
group_3869 | hypothetical protein | 419 | FGSZY6M4_00335 | |
group_3870 | putative ABC transporter ATP-binding protein/MT1014 | 434 | FGSZY6M4_00336 | |
zur_2 | Zinc uptake regulation protein | 500 | FGSZY6M4_00339 | |
group_3880 | hypothetical protein | 578 | FGSZY6M4_00378 | |
group_3899 | hypothetical protein | 518 | FGSZY6M4_00692 | |
yhcR_2 | Endonuclease YhcR precursor | 3566 | FGSZY6M4_01406 | |
group_3960 | hypothetical protein | 332 | FGSZY6M4_01466 | |
group_3961 | hypothetical protein | 692 | FGSZY6M4_01467 | |
group_3962 | YcaO-like family protein | 1610 | FGSZY6M4_01468 | |
group_3963 | ABC-2 type transporter | 731 | FGSZY6M4_01469 | |
group_3964 | yxlF | putative ABC transporter ATP-binding protein YxlF | 908 | FGSZY6M4_01470 |
group_3965 | hypothetical protein | 188 | FGSZY6M4_01471 | |
group_3966 | hypothetical protein | 1079 | FGSZY6M4_01472 | |
group_3967 | hypothetical protein | 1061 | FGSZY6M4_01473 | |
group_3968 | hypothetical protein | 2594 | FGSZY6M4_01474 | |
group_3969 | Nitroreductase family protein | 1532 | FGSZY6M4_01475 | |
group_3970 | YcaO-like family protein | 1607 | FGSZY6M4_01476 | |
group_3971 | hypothetical protein | 1691 | FGSZY6M4_01477 | |
group_3972 | hypothetical protein | 176 | FGSZY6M4_01478 | |
group_4002 | hypothetical protein | 254 | FGSZY6M4_01825 | |
group_4004 | hypothetical protein | 308 | FGSZY6M4_01832 | |
group_4005 | hypothetical protein | 227 | FGSZY6M4_01836 | |
group_4008 | hypothetical protein | 365 | FGSZY6M4_01863 | |
group_4009 | hypothetical protein | 359 | FGSZY6M4_01864 | |
group_4010 | hypothetical protein | 197 | FGSZY6M4_01866 | |
group_4011 | hypothetical protein | 455 | FGSZY6M4_01867 | |
group_4012 | whiB1_2 | Transcriptional regulator WhiB1 | 245 | FGSZY6M4_01868 |
group_4013 | hypothetical protein | 329 | FGSZY6M4_01869 | |
group_4014 | hypothetical protein | 170 | FGSZY6M4_01871 | |
group_4036 | hypothetical protein | 4835 | FGSZY6M4_01918 | |
group_4037 | hypothetical protein | 566 | FGSZY6M4_01919 | |
group_4038 | hypothetical protein | 440 | FGSZY6M4_01920 | |
group_4039 | hypothetical protein | 176 | FGSZY6M4_01921 | |
group_4040 | hypothetical protein | 527 | FGSZY6M4_01922 | |
group_4041 | hypothetical protein | 368 | FGSZY6M4_01923 | |
group_4042 | hypothetical protein | 566 | FGSZY6M4_01939 | |
group_4048 | hypothetical protein | 338 | FGSZY6M4_01977 | |
group_4049 | hypothetical protein | 419 | FGSZY6M4_01981 | |
group_4050 | hypothetical protein | 1190 | FGSZY6M4_01982 | |
bvgA | Virulence factors putative positive transcription regulator BvgA | 668 | FGSZY6M4_01983 | |
group_4052 | enterobactin exporter EntS | 1262 | FGSZY6M4_01984 | |
group_4053 | hypothetical protein | 197 | FGSZY6M4_01985 | |
aacA-aphD | Bifunctional AAC/APH | 1340 | FGSZY6M4_01986 | |
group_4055 | Zein seed storage protein | 755 | FGSZY6M4_01993 |
Strain | Primer Sequence (5′-3′) | Primer Length (bp) | Primer Score | Product Length (bp) |
---|---|---|---|---|
RG4-1 | F: ACCATCTGGGTGGAGAAAGTG | 21 | 100 | 115 |
R: TGGCGGAAATGAACTCGTAAT | 21 | 100 | ||
M1-20-R01-3 | F: GATGGCACCAGCACAGG | 17 | 100 | 199 |
R: GGAGCACGGCGACTATG | 17 | 100 | ||
FGSZY6M4 | F: TCCCGAATCCGACTATGA | 18 | 100 | 144 |
R: TCGCTGCCAACTACTAAAA | 19 | 100 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiao, Y.; Wang, C.; Zhao, J.; Zhang, H.; Chen, W.; Zhai, Q. Quantitative Detection of Bifidobacterium longum Strains in Feces Using Strain-Specific Primers. Microorganisms 2021, 9, 1159. https://doi.org/10.3390/microorganisms9061159
Xiao Y, Wang C, Zhao J, Zhang H, Chen W, Zhai Q. Quantitative Detection of Bifidobacterium longum Strains in Feces Using Strain-Specific Primers. Microorganisms. 2021; 9(6):1159. https://doi.org/10.3390/microorganisms9061159
Chicago/Turabian StyleXiao, Yue, Chen Wang, Jianxin Zhao, Hao Zhang, Wei Chen, and Qixiao Zhai. 2021. "Quantitative Detection of Bifidobacterium longum Strains in Feces Using Strain-Specific Primers" Microorganisms 9, no. 6: 1159. https://doi.org/10.3390/microorganisms9061159