Safety Evaluation, Biogenic Amine Formation, and Enzymatic Activity Profiles of Autochthonous Enterocin-Producing Greek Cheese Isolates of the Enterococcus faecium/durans Group
Abstract
:1. Introduction
2. Materials and Methods
2.1. LAB Strains and Culture Conditions
2.2. Hemolytic Activity
2.3. Antibiotic Susceptibility
2.4. Detection of Vancomycin Resistance and Virulence Genes by PCR
2.5. Detection of Biogenic Amine Formation
2.6. Determination of Biogenic Amine Formation by HPLC
2.7. Enzymatic Activity Profiles
3. Results
3.1. Safety Characteristics of the Ent+ or m-Ent+ E. Faecium and E. Durans Cheese Isolates
3.2. Species-Dependent Differences of the Cheese Isolates in Their Enzymatic Activity Profiles
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Moreno, M.F.; Sarantinopoulos, P.; Tsakalidou, E.; De Vuyst, L. The role and application of enterococci in food and health. Int. J. Food Microbiol. 2006, 106, 1–24. [Google Scholar] [CrossRef]
- Giraffa, G. Functionality of enterococci in dairy products. Int. J. Food Microbiol. 2003, 88, 215–222. [Google Scholar] [CrossRef]
- Litopoulou-Tzanetaki, E.; Tzanetakis, N. Microbiological characteristics of Greek traditional cheeses. Small Rumin. Res. 2011, 101, 17–32. [Google Scholar] [CrossRef]
- Vandera, E.; Kakouri, A.; Koukkou, A.I.; Samelis, J. Major ecological shifts within the dominant nonstarter lactic acid bacteria in mature Greek Graviera cheese as affected by the starter culture type. Int. J. Food Microbiol. 2019, 290, 15–26. [Google Scholar] [CrossRef] [PubMed]
- Samelis, J.; Lianou, A.; Kakouri, A.; Delbès, C.; Rogelj, I.; Bogovič-Matijašić, B.; Montel, M.-C. Changes in the Microbial Composition of Raw Milk Induced by Thermization Treatments Applied Prior to Traditional Greek Hard Cheese Processing. J. Food Prot. 2009, 72, 783–790. [Google Scholar] [CrossRef] [PubMed]
- Vandera, E.; Parapouli, M.; Kakouri, A.; Koukkou, A.-I.; Hatziloukas, E.; Samelis, J. Structural enterocin gene profiles and mode of antilisterial activity in synthetic liquid media and skim milk of autochthonous Enterococcus spp. isolates from artisan Greek Graviera and Galotyri cheeses. Food Microbiol. 2020, 86, 103335. [Google Scholar] [CrossRef] [PubMed]
- Samelis, J.; Kakouri, A. Major technological differences between an industrial-type and five artisan-type Greek PDO Galotyri market cheeses as revealed by great variations in their lactic acid microbiota. AIMS Agric. Food 2019, 4, 685–710. [Google Scholar] [CrossRef]
- Graham, K.; Stack, H.; Rea, R. Safety, beneficial and technological properties of enterococci for use in functional food applications—A review. Crit. Rev. Food Sci. Nutr. 2020, 60, 3836–3861. [Google Scholar] [CrossRef] [PubMed]
- Sarantinopoulos, P.; Andrighetto, C.; Georgalaki, M.D.; Rea, M.C.; Lombardi, A.; Cogan, T.M.; Kalantzopoulos, G.; Tsakalidou, E. Biochemical properties of enterococci relevant to their technological performance. Int. Dairy J. 2001, 11, 621–647. [Google Scholar] [CrossRef]
- Khan, H.; Flint, S.; Yu, P.-L. Enterocins in food preservation. Int. J. Food Microbiol. 2010, 141, 1–10. [Google Scholar] [CrossRef]
- Franz, C.M.; Huch, M.; Abriouel, H.; Holzapfel, W.; Gálvez, A. Enterococci as probiotics and their implications in food safety. Int. J. Food Microbiol. 2011, 151, 125–140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hanchi, H.; Mottawea, W.; Sebei, K.; Hammami, R. The Genus Enterococcus: Between Probiotic Potential and Safety Concerns—An Update. Front. Microbiol. 2018, 9, 1791. [Google Scholar] [CrossRef] [PubMed]
- Braiek, B.O.; Smaoui, S. Enterococci: Between emerging pathogens and potential probiotics. BioMed. Res. Int. 2019, 5938210. [Google Scholar] [CrossRef]
- Eaton, T.J.; Gasson, M.J. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange be-tween food and medical isolates. Appl. Environ. Microbiol. 2001, 67, 1628–1635. [Google Scholar] [CrossRef] [Green Version]
- Linares, D.M.; Martín, M.C.; Ladero, V.; Alvarez, M.A.; Fernández, M. Biogenic Amines in Dairy Products. Crit. Rev. Food Sci. Nutr. 2011, 51, 691–703. [Google Scholar] [CrossRef]
- Morandi, S.; Silvetti, T.; Lopez, J.M.; Brasca, M. Antimicrobial Activity, Antibiotic Resistance and the Safety of Lactic Acid Bacteria in Raw Milk Valtellina Casera Cheese. J. Food Saf. 2014, 35, 193–205. [Google Scholar] [CrossRef]
- Terzić-Vidojević, A.; Veljović, K.; Begović, J.; Filipić, B.; Popović, D.; Tolinački, M.; Miljković, M.; Kojić, M.; Golić, N. Diversity and antibiotic susceptibility of autochthonous dairy enterococci isolates: Are they safe candidates for autochthonous starter cultures? Front. Microbiol. 2015, 6, 954. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- El-Ghaish, S.; Hadji-Sfaxi, I.; Ahmadova, A.; Choiset, Y.; Rabesona, H.; Sitohy, M.; Haertlé, T.; Chobert, J. Characterization of two safe Enterococcus strains producing enterocins isolated from Egyptian dairy products. Benef. Microbes 2011, 2, 15–27. [Google Scholar] [CrossRef]
- Domingos-Lopes, M.F.P.; Stanton, C.; Ross, P.R.; Dapkevicius, M.L.E.; Silva, C.C.G. Genetic diversity, safety and technological characterization of lactic acid bacteria isolated from artisanal Pico cheese. Food Microbiol. 2017, 63, 178–190. [Google Scholar] [CrossRef] [PubMed]
- Fuka, M.M.; Maksimovic, A.Z.; Tanuwidjaja, I.; Hulak, N.; Schloter, M. Characterization of Enterococcal Community Isolated from an Artisan Istrian Raw Milk Cheese: Biotechnological and Safety Aspects. Food Technol. Biotechnol. 2017, 55, 368–380. [Google Scholar] [CrossRef]
- Cox, C.R.; Coburn, P.S.; Gilmore, M.S. Enterococcal cytolysin: A novel two component peptide system that serves as a bacterial defense against eukaryotic and prokaryotic cells. Curr. Prot. Pept. Sci. 2005, 6, 77–84. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.B.; Kopit, L.M.; Harris, L.J.; Marco, M.L. Draft Genome Sequence of the Quality Control Strain Enterococcus faecalis ATCC 29212. J. Bacteriol. 2012, 194, 6006–6007. [Google Scholar] [CrossRef] [Green Version]
- Yildiz, O.; Turkyilmaz, S. Investigation of virulence genes of Enterococcus faecalis strains isolated from mastitic bovine milk. Israel J. Vet. Med. 2015, 70, 15–21. [Google Scholar]
- Asimakoula, S.; Giaka, K.; Fanitsios, C.; Kakouri, A.; Vandera, E.; Samelis, J.; Koukkou, A.I. Monitoring growth compatibility and bacteriocin gene transcription of adjunct and starter lactic acid bacterial strains in milk. J. Food Prot. 2021, 84, 509–520. [Google Scholar] [CrossRef]
- Hudzicki, J. Kirby-Bauer Disk Diffusion Susceptibility Test Protocol Author Information; 2012 American Society for Micro-biology, 1–13 December 2009. Available online: https://www.asm.org/Protocols/Kirby-Bauer-Disk-Diffusion-Susceptibility-Test-Pro (accessed on 29 August 2018).
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 26th ed.; CLSI Supplement M100S; Clinical and Laboratory Standards Insitute: Wayne, PA, USA, 2016. [Google Scholar]
- Parapouli, M.; Delbès-Paus, C.; Kakouri, A.; Koukkou, A.-I.; Montel, M.-C.; Samelis, J. Characterization of a Wild, Novel Nisin A-Producing Lactococcus Strain with an L. lactis subsp.cremorisGenotype and an L. lactis subsp.lactisPhenotype, Isolated from Greek Raw Milk. Appl. Environ. Microbiol. 2013, 79, 3476–3484. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- William, S.; Helene, F.; Copeland, A. Bacterial DNA Isolation CTAB Protocol Bacterial Genomic DNA Isolation Using CTAB; Doe Joint Genome Institute: Walnut Creek, CA, USA, 2012; p. 4.
- Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 2001. [Google Scholar]
- European Food Safety Authority (EFSA). Guidance on the safety assessment of Enterococcus faecium in animal nutrition. EFSA J. 2012, 10, 2682. [Google Scholar] [CrossRef]
- Petrich, A.; Luinstra, K.; Groves, D.; Chernesky, M.; Mahony, J. Direct detection of vanA and vanB genes in clinical specimens for rapid identification of vancomycin resistant enterococci (VRE) using multiplex PCR. Mol. Cell. Probes 1999, 13, 275–281. [Google Scholar] [CrossRef]
- Espeche, M.C.; Pellegrino, M.; Frola, I.; Larriestra, A.; Bogni, C.; Nader-Macías, M.F. Lactic acid bacteria from raw milk as potentially beneficial strains to prevent bovine mastitis. Anaerobe 2012, 18, 103–109. [Google Scholar] [CrossRef]
- Al-Talib, H.; Zuraina, N.; Kamarudin, B.; Yean, C.Y. Genotypic variations of virulent genes in Enterococcus faecium and Enter-ococcus faecalis isolated from three hospitals in Malaysia. Adv. Clin. Experim. Med. 2015, 24, 121–127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Werner, G.; Witte, W.; Klare, I.; van Schaik, W.; Fleige, C.; Geringer, U. IS element IS16 as a molecular screening tool to identify hospital-associated strains of Enterococcus faecium. BMC Inf. Dis. 2011, 11, 80. [Google Scholar] [CrossRef] [Green Version]
- Vankerckhoven, V.; Van Autgaerden, T.; Vael, C.; Lammens, C.; Chapelle, S.; Rossi, R.; Jabes, D.; Goossens, H. Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J. Clin. Microbiol. 2004, 42, 4473–4479. [Google Scholar] [CrossRef] [Green Version]
- Bover-Cid, S.; Holzapfel, W.H. Improved screening procedure for biogenic amine production by lactic acid bacteria. Int. J. Food Microbiol. 1999, 53, 33–41. [Google Scholar] [CrossRef]
- Eerola, S.; Hinkkanen, R.; Lindfors, E.; Hirvi, T. Liquid chromatographic determination of biogenic amines in dry sausages. J. AOAC Int. 1993, 76, 575–580. [Google Scholar] [CrossRef]
- Giraffa, G.; Olivari, A.; Neviani, E. Isolation of vancomycin-resistant Enterococcus faecium from Italian cheeses. Food Microbiol. 2000, 17, 671–677. [Google Scholar] [CrossRef]
- Franz, C.M.A.P.; Muscholl-Silberhorn, A.B.; Yousif, N.M.K.; Vancanneyt, M.; Swings, J.; Holzapfel, W.H. Incidence of viru-lence factors and antibiotic resistance among enterococci isolated from food. Appl. Environ. Microbiol. 2001, 67, 4385–4389. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vancanneyt, M.; Lombardi, A.; Andrighetto, C.; Knijff, E.; Torriani, S.; Björkroth, K.J.; Franz, C.M.A.P.; Moreno, M.R.F.; Revets, H.; De Vuyst, L.; et al. Intraspecies Genomic Groups in Enterococcus faecium and Their Correlation with Origin and Pathogenicity. Appl. Environ. Microbiol. 2002, 68, 1381–1391. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gaglio, R.; Couto, N.; Marques, C.; Lopes, M.F.S.; Moschetti, G.; Pomba, C.; Settanni, L. Evaluation of antimicrobial resistance and virulence of enterococci from equipment surfaces, raw materials and traditional cheeses. Int. J. Food Microbiol. 2016, 236, 107–114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Omar, N.B.; Castro, A.; Lucas, R.; Abriouel, H.; Yousif, N.M.; Franz, C.M.; Holzapfel, W.H.; Rubén, P.-P.; Martínez-Canãmero, M.; Gálvez, A. Functional and Safety Aspects of Enterococci Isolated from Different Spanish Foods. Syst. Appl. Microbiol. 2004, 27, 118–130. [Google Scholar] [CrossRef]
- Favaro, L.; Basaglia, M.; Casella, S.; Hue, I.; Dousset, X.; Franco, B.D.G.D.M.; Todorov, S.D. Bacteriocinogenic potential and safety evaluation of non-starter Enterococcus faecium strains isolated from home made white brine cheese. Food Microbiol. 2014, 38, 228–239. [Google Scholar] [CrossRef]
- Pimentel, L.L.; Semedo, T.; Tenreiro, R.; Crespo, M.T.B.; Pintado, M.M.E.; Malcata, F.X. Assessment of Safety of Enterococci Isolated throughout Traditional Terrincho Cheesemaking: Virulence Factors and Antibiotic Susceptibility. J. Food Prot. 2007, 70, 2161–2167. [Google Scholar] [CrossRef]
- Popović, N.; Dinić, M.; Tolinački, M.; Mihajlović, S.; Terzić-Vidojević, A.; Bojić, S.; Djokić, J.; Golić, N.; Veljović, K. New in-sight into biofilm formation ability, the presence of virulence genes and probiotic potential of Enterococcus sp. dairy isolates. Front. Microbiol. 2018, 9, 78. [Google Scholar] [CrossRef] [Green Version]
- Hammad, A.M.; Hassan, H.A.; Shimamoto, T. Prevalence, antibiotic resistance and virulence of Enterococcus spp. in Egyptian fresh raw milk cheese. Food Control 2015, 50, 815–820. [Google Scholar] [CrossRef]
- Aspri, M.; Bozoudi, D.; Tsaltas, D.; Hill, C.; Papademas, P. Raw donkey milk as a source of Enterococcus diversity: Assessment of their technological properties and safety characteristics. Food Control 2017, 73, 81–90. [Google Scholar] [CrossRef]
- Özkan, E.R.; Demirci, T.; Akin, N. In vitro assessment of probiotic and virulence potential of Enterococcus faecium strains de-rived from artisanal goatskin casing Tulum cheeses produced in central Taurus Mountains of Turkey. LWT Food Sci. Technol. 2021, 141, 110908. [Google Scholar] [CrossRef]
- Pieniz, S.; de Moura, T.M.; Cassenego, A.P.V.; Andreazza, R.; Frazzon, A.P.G.; de Oliveira Camargo, F.A.; Brandelli, A. Evaluation of resistance genes and virulence factors in a food isolated Enterococcus durans with potential probiotic effect. Food Control 2015, 51, 49–54. [Google Scholar] [CrossRef] [Green Version]
- Ladero, V.; Fernández, M.; Calles-Enríquez, M.; Sánchez-Llana, E.; Cañedo, E.; Martín, M.C.; Alvarez, M.A. Is the production of the biogenic amines tyramine and putrescine a species-level trait in enterococci? Food Microbiol. 2012, 30, 132–138. [Google Scholar] [CrossRef] [PubMed]
- Espinosa-Pesqueira, D.; Roig-Sagués, A.X.; Hernández-Herrero, M.M. Screening method to evaluate amino ac-id-decarboxylase activity of bacteria present in Spanish artisanal ripened cheeses. Foods 2018, 7, 182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Coton, M.; Lebreton, M.; Salas, M.L.; Garnier, L.; Navarri, M.; Pawtowski, A.; Le Blay, G.; Valence, F.; Coton, E.; Mounier, J. Biogenic amine and antibiotic resistance profiles determined for lactic acid bacteria and a propionibacterium prior to use as antifungal bioprotective cultures. Int. Dairy J. 2018, 85, 21–26. [Google Scholar] [CrossRef]
- Durlu-Ozkaya, F.; Xanthopoulos, V.; Tunail, N.; Litopoulou-Tzanetaki, E. Technologically important properties of lactic acid bacteria isolates from Beyaz cheese made from raw ewes’ milk. J. Appl. Microbiol. 2001, 91, 861–870. [Google Scholar] [CrossRef] [PubMed]
- Manero, A.; Blanch, A.R. Identification of Enterococcus spp. with a Biochemical Key. Appl. Environ. Microbiol. 1999, 65, 4425–4430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giannou, E.; Kakouri, A.; Matijašic, B.B.; Rogelj, I.; Samelis, J. Fate of Listeria monocytogenes on fully ripened Greek Graviera cheese stored at 4, 12, or 25 oC in air or vacuum packages: In situ PCR detection of a cocktail of bacteriocins potentially contributing to pathogen inhibition. J. Food Prot. 2009, 72, 531–538. [Google Scholar] [CrossRef] [PubMed]
- Sameli, N.; Skandamis, P.N.; Samelis, J. Application of Enterococcus faecium KE82, an Enterocin A-B-P–Producing Strain, as an Adjunct Culture Enhances Inactivation of Listeria monocytogenes during Traditional Protected Designation of Origin Galotyri Processing. J. Food Prot. 2021, 84, 87–98. [Google Scholar] [CrossRef] [PubMed]
LAB Strain/Isolate Code | Origin/Isolation Source | Strain Genotype RAPD-Based | Strain Biotype | Structural Bacteriocin (Enterocin) Gene/s Possessed | Mode of Bacteriocin Activity 1 | References | GenBank Accession Number |
---|---|---|---|---|---|---|---|
Autochthonous Enterococcus strains under investigation | |||||||
Enterococcus faecium GL31 | Artisan Galotyri cheese PDO | EF1 | 1C | Ent+ (entA) | Bacteriostatic | [6,7] | MW709884 |
Enterococcus faecium KE64 | Graviera cheese (CSC-free) 2 | EF2 | 1B | Ent+ (entA) | Bactericidal | [4,6] | MW644963 |
Enterococcus faecium KE67 | Graviera cheese (CSC-free) | EF2 | 1B | Ent+ (entA) | Bactericidal | [4,6] | ND |
Enterococcus faecium KE77 | Graviera cheese (CSC-free) | EF3 | 1G | m-Ent+ (entA-B-P-31) | Bactericidal | [4,6] | MW644967 |
Enterococcus faecium KE82 | Graviera cheese (CSC-free) | EF4 | 1D | m-Ent+ (entA-B-P) | Bactericidal | [4,6] | MW644969 |
Enterococcus faecium KE118 | Graviera cheese (CSC-free) | EF4 | 1A | m-Ent+ (entA-B-P) | Bacteriostatic | [4,6] | ND |
Enterococcus durans KE96 | Graviera cheese (CSC-free) | ED1 | 2A | Ent+ (entP) | Bactericidal | [4,6] | ND |
Enterococcus durans KE100 | Graviera cheese (CSC-free) | ED1 | 2A | Ent+ (entP) | Bactericidal | [4,6] | MW644971 |
Enterococcus durans KE108 | Graviera cheese (CSC-free) | ED2 | 2B | Ent+ (entP-bac31-cyl) | Bacteriostatic | [4,6] | MW644972 |
Reference/Control LAB strains | |||||||
Enterococcus faecium KE85 | Graviera cheese (CSC-free) | Not tested | 1D | None (Ent-negative) | None | [4,6] | ND |
Enterococcus faecium 315VR | Clinical/Human/vanA+ | Unknown | NA | Not reported | Not reported | See text | Not reported |
Enterococcus faecalis ATCC® 29212TM | Virulent (gelE; ace) | Unknown | NA | Not reported | Not reported | [22,23] | ATCC strain |
Streptococcus thermophilus ST1 | CSC strain of natural origin | Not tested | NA | None | None | [24] | Not reported |
Lactococcus lactis ssp. cremoris M78 | Greek raw ewe’s milk | M78 = M104 | NA | Nisin A (nisA) | Bactericidal | [5,27] | JX402634 |
Lactiplantibacillus plantarum H25 | Graviera cheese (with CSC) | Lb. plantarum | NA | None | None | [4,24] | ND |
Target Gene | Primer Pair | Primer Sequence (5′-3′) | Amplicon Size (bp) | Temp (°C) | References |
---|---|---|---|---|---|
Antibiotic resistance structural genes | |||||
vanA (Vancomycin) | vanA1 | GCTGCGATATTCAAAGCTCA | 545 | 50 | Petrich et al., [31] |
vanA2 | CAGTACAATGCGGCCGTTA | ||||
vanB (Vancomycin) | vanB1 | ATGGGAAGCCGATAGTCTC | 368 | 50 | Petrich et al., [31] |
vanB3 | GTTACGCCAAAGGACGAAC | ||||
Virulence determinants | |||||
agg (Aggregation protein) | Agg-F | AAGAAAAAGAAGTAGACCAAC | 1553 | 53 | Espeche et al., [32] |
Agg-R | AAACGGCAAGACAAGTAAATA | ||||
ace (Accessory colonization factor) | Ace-F | CAGGCCAACATCAAGCAACA | 125 | 65 | Al-Talib et al., [33] |
Ace-R | GCTTGCCTCGCCTTCTACAA | ||||
espA (Enterococcal surface protein) | EspA-F | TTTGGGGCAACTGGAATAGT | 407 | 60 | Al-Talib et al., [33] |
EspA-R | CCCAGCAAATAGTCCATCAT | ||||
IS16 (Transposable element) | IS16-F | CATGTTCCACGAACCAGAG | 547 | 55 | Werner et al., [34] EFSA [30] |
IS16-R | TCAAAAAGTGGGCTTGGC | ||||
hyl (Hyaluronidase) | HyI-F | ACAGAAGAGCTGCAGGAAATG | 276 | 58 | Vankerckhoven et al., [35] |
HyI-R | GACTGACGTCCAAGTTTCCAA | ||||
gelE (Gelatinase) | GelE-F | CGAAGTTGGAAAAGGAGGC | 372 | 50 | Al-Talibet al., [33] |
GelE-R | GGTGAAGAAGTTACTCTGA |
Strain (Isolate) | Type of | Antibiotic Tested (μg/disc) | |||||||
---|---|---|---|---|---|---|---|---|---|
Hemolytic Activity | AMP 10 | CHL 30 | CIP 5 | ERY 15 | GEN 10 | PEN 10U | TET 30 | VAN 30 | |
Ent+ or m-Ent+ isolates | |||||||||
E. faecium KE64 | α | S (17.5) | S (23.9) | I (18.0) | R (12.1) | S (10.4) | R (13.2) | S (27.5) | S (18.5) |
E. faecium KE67 | α | S (18.4) | S (24.6) | I (16.5) | R (11.7) | S (9.6) | R (12.5) | S (26.9) | S (18.6) |
E. faecium KE77 | α | S (26.4) | S (25.5) | I (18.2) | I (18.5) | S (14.4) | S (22.8) | S (28.1) | S (19.8) |
E. faecium KE82 | α | S (17.3) | S (24.9) | R (12.0) | R (11.0) | S (11.3) | R (11.3) | S (28.3) | S (19.4) |
E. faecium KE118 | α | S (17.0) | S (22.7) | R (13.0) | R (12.7) | S (11.6) | S (14.5) | S (25.9) | S (18.6) |
E. faecium GL31 | α | S (23.6) | S (23.2) | R (14.4) | I (13.5) | S (11.8) | S (19.4) | S (25.3) | S (18.1) |
E. durans KE96 | α/γ | S (22.2) | S (22.1) | I (18.5) | I (21.6) | S (10.6) | S (19.2) | S (22.9) | S (17.8) |
E. durans KE100 | α/γ | S (20.0) | S (21.7) | I (20.4) | I (20.9) | S (10.7) | S (17.1) | S (23.0) | S (18.0) |
E. durans KE108 | α | S (23.4) | S (26.9) | I (19.8) | S (24.0) | S (10.2) | S (19.3) | S (24.0) | S (19.0) |
E. faecium KE85 (Ent-/control) | α | S (16.6) | S (26.3) | R (12.8) | I (17.4) | S (10.3) | R (13.2) | R (9.6) | S (21.4) |
Virulent Enterococcus spp. | |||||||||
E. faecium 315VR (vanA+) | β | R (0.0) | S (25.6) | R (0.0) | R (0.0) | R (0.0) | R (0.0) | R (9.5) | R (9.5) |
E. faecalis ATCC 29212 | β | S (23.0) | S (23.7) | I (18.3) | I (15.3) | S (7.6) | S (20.2) | I (16.6) | I (15.6) |
Starter LAB strains | |||||||||
S. thermophilus ST1 | γ | S (28.4) | S (27.2) | S (20.0) | S (27.3) | NT | S (17.3) | S (25.1) | S (19.9) |
Lc. lactis ssp. cremoris M78 | γ | S (23.2) | S (24.0) | R (13.2) | S (23.8) | R (0.0) | S (14.2) | R (9.9) | S (17.2) |
Lb. plantarum H25 | α | S (26.0) | S (26.5) | R (9.5) | NT | R (0.0) | S (19.1) | I (17.3) | R (0.0) |
Isolate/Strain | BA Broth without Amino ACIDS Added | BA Broth with 1% Histidine Added | BA Broth with 1% Tyrosine Added |
---|---|---|---|
Ent+ or m-Ent+ isolates | |||
E. faecium KE64 | -/NT | -/NT | ++/NT |
E. faecium KE67 | -/NT | -/NT | ++/NT |
E. faecium KE77 | (+)/18.4; 35.3 | -/74.0 | ++/1683.8 |
E. faecium KE82 | -/NT | -/traces | ++/2706.4 |
E. faecium KE118 | (+)/NT | -/NT | ++/NT |
E. faecium GL31 | (+)/NT | (+)/16.0 | ++/1247.3 |
E. durans KE96 | (+)/NT | (+)/15.2 | ++/1849.2 |
E. durans KE100 | (+)/NT | (+)/15.3 | ++/1631.6 |
E. durans KE108 | -/13.3; 7.3 | -/17.8 | ++/2154.5 |
E. faecium KE85 (Ent-/control) | - | -/15.2 | ++/2249.1 |
Virulent Enterococcus spp. | |||
E. faecium 315VR (vanA+) | (+)/NT | -/NT | +/NT |
E. faecalis ATCC 29212 | -/NT | -/NT | +/NT |
Starter LAB strains | |||
S. thermophilus ST1 | NG | NG | NG |
Lc. lactis ssp. cremoris M78 | -/13.6; 31.6 | -/8.1 | -/53.8 |
Lb. plantarum H25 | -/18.1; 187.1 | -/17.0 | -/35.1 |
Control Starter or Adjunct LAB Strains 2 | Ent+ E. faecium Isolates | Ent+ E. durans Isolates | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Enzyme Assayed for | S. thermophilus ST1 | Lc. lactis M78 | Lb. plantarum H25 | E. faecium KE85 Ent- | KE64 KE67 | KE77 | KE82 | KE118 | GL31 | KE96 | KE100 | KE108 |
Alkaline phosphatase | - | 5 | 5 | 3 | 2 | 4 | 3 | 3 | 3 | 3 | 3 | 3 |
Esterase (C 4) | 2–3 | 3 | 3 | 4 | 3 | 3 | 4 | 3 | 3 | 3 | 4 | 3 |
Esterase Lipase (C 8) | - | 4 | 3 | 3 | 3 | 3 | 4 | 3 | 4 | 4 | 4 | 4 |
Lipase (C 14) | - | - | 2 | - | - | - | - | - | - | - | - | - |
Leucine arylamidase | 5 | 5 | 5 | 3 | 3 | 4 | 5 | 3 | 4 | 5 | 5 | 4 |
Valine arylamidase | 2 | 4 | 5 | - | 3 | 2 | 3 | 2 | 3 | 4 | 4 | 4 |
Cystine arylamidase | 2 | 4 | 5 | - | 3 | 3 | 4 | 4 | 4 | 4 | 4 | 4 |
Trypsin | - | - | - | - | - | - | - | - | - | - | - | - |
α-chymotrypsin | - | 3 | - | 2 | 1–2 | 2 | 4 | - | 1 | - | - | - |
Acid phosphatase | 3–4 | 5 | 5 | - | 4 | 4 | 5 | 5 | 5 | 5 | 5 | 5 |
Naphthol-AS-BI-phosphohydrolase | 2 | 5 | 4 | - | 3 | 3 | 3 | 4 | 3 | 3 | 3 | 3 |
α-galactosidase | - | - | 5 | - | - | 2 | - | - | - | - | - | - |
β-galactosidase | 4 | - | 5 | - | 1–2 | - | - | - | - | - | - | - |
β-glucuronidase | - | - | 2–3 | - | - | - | - | - | - | - | - | - |
α-glucosidase | - | 5 | 5 | - | - | 2 | - | - | - | - | - | - |
β-glucosidase | - | - | 4 | - | - | - | - | - | - | - | - | - |
N-acetyl-β-glucosaminidase | - | - | 5 | - | - | - | - | - | - | - | - | - |
α-mannosidase | - | - | - | - | - | - | - | - | - | - | - | - |
α-fucosidase | - | - | - | - | - | - | - | - | - | - | - | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsanasidou, C.; Asimakoula, S.; Sameli, N.; Fanitsios, C.; Vandera, E.; Bosnea, L.; Koukkou, A.-I.; Samelis, J. Safety Evaluation, Biogenic Amine Formation, and Enzymatic Activity Profiles of Autochthonous Enterocin-Producing Greek Cheese Isolates of the Enterococcus faecium/durans Group. Microorganisms 2021, 9, 777. https://doi.org/10.3390/microorganisms9040777
Tsanasidou C, Asimakoula S, Sameli N, Fanitsios C, Vandera E, Bosnea L, Koukkou A-I, Samelis J. Safety Evaluation, Biogenic Amine Formation, and Enzymatic Activity Profiles of Autochthonous Enterocin-Producing Greek Cheese Isolates of the Enterococcus faecium/durans Group. Microorganisms. 2021; 9(4):777. https://doi.org/10.3390/microorganisms9040777
Chicago/Turabian StyleTsanasidou, Charikleia, Stamatia Asimakoula, Nikoletta Sameli, Christos Fanitsios, Elpiniki Vandera, Loulouda Bosnea, Anna-Irini Koukkou, and John Samelis. 2021. "Safety Evaluation, Biogenic Amine Formation, and Enzymatic Activity Profiles of Autochthonous Enterocin-Producing Greek Cheese Isolates of the Enterococcus faecium/durans Group" Microorganisms 9, no. 4: 777. https://doi.org/10.3390/microorganisms9040777
APA StyleTsanasidou, C., Asimakoula, S., Sameli, N., Fanitsios, C., Vandera, E., Bosnea, L., Koukkou, A.-I., & Samelis, J. (2021). Safety Evaluation, Biogenic Amine Formation, and Enzymatic Activity Profiles of Autochthonous Enterocin-Producing Greek Cheese Isolates of the Enterococcus faecium/durans Group. Microorganisms, 9(4), 777. https://doi.org/10.3390/microorganisms9040777