Andrographolide Inhibits Lytic Reactivation of Epstein-Barr Virus by Modulating Transcription Factors in Gastric Cancer
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells Lines, Compound, and Experimental Design
2.2. Investigation of the Induction of Cell Cytotoxicity by Andrographolide
2.3. Andrographolide Treatment and Protein Extraction by TRIzol Reagent
2.4. Proteomic Analysis by Mass Spectrometry
2.5. Data Analysis and Molecular Docking
2.6. Quantification of Gene Expression by qRT-PCR
2.7. Quantification of Cell Apoptosis by Flow Cytometry
2.8. Statistical Analysis
3. Results
3.1. Andrographolide Alters Protein Expression Profile of EBVaGC Cells
3.2. Andrographolide Inhibits EBV Lytic Reactivation by Inhibition of TFs Expression
3.3. Andrographolide Modulates TFs Expression through the Direct Interaction of HDAC6 with TFs
3.4. Andrographolide Induces Cell Cytotoxicity in an EBV-Associated Gastric Cancer Cell Line
3.5. Andrographolide Induces Apoptosis of the EBVaGC Cell Line
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fukayama, M.; Hino, R.; Uozaki, H. Epstein-Barr virus and gastric carcinoma: Virus-host interactions leading to carcinoma. Cancer Sci. 2008, 99, 1726–1733. [Google Scholar] [CrossRef]
- Kenney, S.C.; Mertz, J.E. Regulation of the latent-lytic switch in Epstein-Barr virus. Sem. Cancer Biol. 2014, 26, 60–68. [Google Scholar] [CrossRef] [Green Version]
- Murata, T. Regulation of Epstein-Barr virus reactivation from latency. Microbiol. Immunol. 2014, 58, 307–317. [Google Scholar] [CrossRef]
- Chiu, S.H.; Wu, C.C.; Fang, C.Y.; Yu, S.L.; Hsu, H.Y.; Chow, Y.H.; Chen, J.Y. Epstein-Barr virus BALF3 mediates genomic instability and progressive malignancy in nasopharyngeal carcinoma. Oncotarget 2014, 5, 8583–8601. [Google Scholar] [CrossRef]
- Okhuarobo, A.; Ehizogie Falodun, J.; Erharuyi, O.; Imieje, V.; Falodun, A.; Langer, P. Harnessing the medicinal properties of Andrographis paniculata for diseases and beyond: A review of its phytochemistry and pharmacology. Asian Pac. J. Trop. Dis. 2014, 4, 213–222. [Google Scholar] [CrossRef]
- Sareer, O.; Ahad, A.; Umar, S. Prophylactic and lenitive effects of Andrographis paniculate against common human ailments: An exhaustive and comprehensive reappraisal. J. Pharm. Res. 2012, 2, 138–162. [Google Scholar]
- Akbar, S. Andrographis paniculata: A review of pharmacological activities and clinical effects. Altern. Med. Rev. 2011, 16, 66–77. [Google Scholar] [PubMed]
- Seubsasana, S.; Pientong, C.; Ekalaksananan, T.; Thongchai, S.; Aromdee, C. A potential andrographolide analogue against the replication of herpes simplex virus type 1 in vero cells. Med. Chem. 2011, 7, 237–244. [Google Scholar] [CrossRef]
- Panraksa, P.; Ramphan, S.; Khongwichit, S.; Smith, D.R. Activity of andrographolide against dengue virus. Antivir. Res. 2017, 139, 69–78. [Google Scholar] [CrossRef]
- Wintachai, P.; Kaur, P.; Lee, R.C.; Ramphan, S.; Kuadkitkan, A.; Wikan, N.; Smith, D.R. Activity of andrographolide against chikungunya virus infection. Sci. Rep. 2015, 5, 14179. [Google Scholar] [CrossRef] [Green Version]
- Fangkham, S.; Ekalaksananan, T.; Aromdee, C.; Seubsasana, S.; Kongyingyoes, B.; Patarapadungkit, N.; Pientong, C. The effect of andrographolide on Human papillomavirus type 16 (HPV16) positive cervical cancer cells (SiHa). Int. J. Infect. Dis. 2012, 16, e80. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.; Ma, Y.B.; Huang, X.Y.; Geng, C.A.; Zhao, Y.; Wang, L.J.; Chen, J.J. Synthesis, structure–activity relationships and biological evaluation of dehydroandrographolide and andrographolide derivatives as novel anti-hepatitis B virus agents. Med. Chem. Lett. 2014, 24, 2353–2359. [Google Scholar] [CrossRef]
- Ding, Y.; Chen, L.; Wu, W.; Yang, J.; Yang, Z.; Liu, S. Andrographolide inhibits influenza A virus-induced inflammation in a murine model through NF-κB and JAK-STAT signaling pathway. Microbes Infect. 2017, 19, 605–615. [Google Scholar] [CrossRef] [PubMed]
- Lin, T.P.; Chen, S.Y.; Duh, P.D.; Chang, L.K.; Liu, Y.N. Inhibition of the Epstein-Barr virus lytic cycle by andrographolide. Biol. Pharm. Bull. 2008, 31, 2018–2023. [Google Scholar] [CrossRef] [Green Version]
- Aromdee, C.; Suebsasana, S.; Ekalaksananan, T.; Pientong, C.; Thongchai, S. Stage of action of naturally occurring andrographolides and their semisynthetic analogues against herpes simplex virus type 1 in vitro. Planta Med. 2011, 77, 915–921. [Google Scholar] [CrossRef] [PubMed]
- Wu, B.; Chen, X.; Zhou, Y.; Hu, P.; Wu, D.; Zheng, G.; Cai, Y. Andrographolide inhibits proliferation and induces apoptosis of nasopharyngeal carcinoma cell line C666-1 through LKB1-AMPK-dependent signaling pathways. Die Pharm. 2018, 73, 594–597. [Google Scholar]
- Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef]
- Tyanova, S.; Temu, T.; Sinitcyn, P.; Carlson, A.; Hein, M.Y.; Geiger, T.; Cox, J. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat. Methods 2016, 13, 731–740. [Google Scholar] [CrossRef]
- Mi, H.; Muruganujan, A.; Huang, X.; Ebert, D.; Mills, C.; Guo, X.; Thomas, P.D. Protocol Update for large-scale genome and gene function analysis with the PANTHER classification system (v.14.0). Nat. Protoc. 2019, 14, 703–721. [Google Scholar] [CrossRef]
- Bardou, P.; Mariette, J.; Escudié, F.; Djemiel, C.; Klopp, C. Jvenn: An interactive Venn diagram viewer. BMC Bioinform. 2014, 15, 293. [Google Scholar] [CrossRef] [Green Version]
- Szklarczyk, D.; Morris, J.H.; Cook, H.; Kuhn, M.; Wyder, S.; Simonovic, M.; von Mering, C. The STRING database in 2017: Quality-controlled protein-protein association networks, made broadly accessible. Nucleic Acids Res. Spec. Publ. 2017, 45, 362–368. [Google Scholar] [CrossRef] [PubMed]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Schwede, T. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, 296–303. [Google Scholar] [CrossRef] [Green Version]
- Comeau, S.R.; Gatchell, D.W.; Vajda, S.; Camacho, C.J. ClusPro: An automated docking and discrimination method for the prediction of protein complexes. Bioinformatics 2004, 20, 45–50. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kozakov, D.; Hall, D.R.; Xia, B.; Porter, K.A.; Padhorny, D.; Yueh, C.; Vajda, S. The ClusPro web server for protein-protein docking. Nat. Protoc. 2017, 12, 255–278. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.P.; Zhao, Y.T.; Zhao, T.C. Histone deacetylases and mechanisms of regulation of gene expression. Crit. Rev. Oncog. 2015, 20, 35–47. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Tian, Y.; Zhu, W.-G. The roles of histone deacetylases and their inhibitors in cancer therapy. Cell Dev. 2020, 8, 576946. [Google Scholar] [CrossRef]
- Grunstein, M. Histone acetylation in chromatin structure and transcription. Nature 1997, 389, 349–352. [Google Scholar] [CrossRef]
- Wiart, C.; Kumar, K.; Yusof, M.Y.; Hamimah, H.; Fauzi, Z.M.; Sulaiman, M. Antiviral properties of ent-labdene diterpenes of Andrographis paniculata nees, inhibitors of herpes simplex virus type 1. Phytother. Res. 2005, 19, 1069–1070. [Google Scholar] [CrossRef]
- Chen, J.X.; Xue, H.J.; Ye, W.C.; Fang, B.H.; Liu, Y.H.; Yuan, S.H.; Wang, Y.Q. Activity of andrographolide and its derivatives against influenza virus in vivo and in vitro. Biol. Pharm. Bull. 2009, 32, 1385–1391. [Google Scholar] [CrossRef] [Green Version]
- Uttekar, M.M.; Das, T.; Pawar, R.S.; Bhandari, B.; Menon, V.; Nutan Bhat, S.V. Anti-HIV activity of semisynthetic derivatives of andrographolide and computational study of HIV-1 gp120 protein binding. Eur. J. Med. Chem. 2012, 56, 368–374. [Google Scholar] [CrossRef]
- Lu, J.; Chen, S.Y.; Chua, H.H.; Liu, Y.S.; Huang, Y.T.; Chang, Y.; Tsai, C.H. Upregulation of tyrosine kinase TKT by the Epstein-Barr virus transactivator Zta. J. Virol. 2000, 74, 7391–7399. [Google Scholar] [CrossRef] [Green Version]
- Liu, S.; Liu, P.; Borras, A.; Chatila, T.; Speck, S.H. Cyclosporin A-sensitive induction of the Epstein-Barr virus lytic switch is mediated via a novel pathway involving a MEF2 family member. EMBO J. 1997, 16, 143–153. [Google Scholar] [CrossRef] [Green Version]
- Yu, X.; Wang, Z.; Mertz, J.E. ZEB1 regulates the latent-lytic switch in infection by Epstein-Barr virus. PLoS Pathog. 2007, 3, e194. [Google Scholar] [CrossRef] [PubMed]
- Adamson, A.L.; Darr, D.; Holley-Guthrie, E.; Johnson, R.A.; Mauser, A.; Swenson, J.; Kenney, S. Epstein-Barr virus immediate-early proteins BZLF1 and BRLF1 activate the ATF2 transcription factor by increasing the levels of phosphorylated p38 and c-Jun N-terminal kinases. J. Virol. 2000, 74, 1224–1233. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Flemington, E.; Speck, S.H. Autoregulation of Epstein-Barr virus putative lytic switch gene BZLF1. J. Virol. 1990, 64, 1227–1232. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murata, T.; Noda, C.; Saito, S.; Kawashima, D.; Sugimoto, A.; Isomura, H.; Tsurumi, T. Involvement of Jun dimerization protein 2 (JDP2) in the maintenance of Epstein-Barr virus latency. J. Biol. Chem. 2011, 286, 22007–22016. [Google Scholar] [CrossRef] [Green Version]
- Montalvo, E.A.; Cottam, M.; Hill, S.; Wang, Y.J. YY1 binds to and regulates cis-acting negative elements in the Epstein-Barr virus BZLF1 promoter. Virol. J. 1995, 69, 4158–4165. [Google Scholar] [CrossRef] [Green Version]
- Murata, T.; Hotta, N.; Toyama, S.; Nakayama, S.; Chiba, S.; Isomura, H.; Tsurumi, T. Transcriptional repression by sumoylation of Epstein-Barr virus BZLF1 protein correlates with association of histone deacetylase. J. Biol. Chem. 2010, 285, 23925–23935. [Google Scholar] [CrossRef] [Green Version]
- Jenkins, P.J.; Binné, U.K.; Farrell, P.J. Histone acetylation and reactivation of Epstein-Barr virus from latency. Virol. J. 2000, 74, 710–720. [Google Scholar] [CrossRef] [Green Version]
- Countryman, J.K.; Gradoville, L.; Miller, G. Histone hyperacetylation occurs on promoters of lytic cycle regulatory genes in Epstein-Barr virus-infected cell lines which are refractory to disruption of latency by histone deacetylase inhibitors. J. Virol. 2008, 82, 4706–4719. [Google Scholar] [CrossRef] [Green Version]
- Murata, T.; Kondo, Y.; Sugimoto, A.; Kawashima, D.; Saito, S.; Isomura, H.; Tsurumi, T. Epigenetic Histone Modification of Epstein-Barr Virus BZLF1 Promoter during Latency and Reactivation in Raji Cells. Virol. J. 2012, 86, 4752–4761. [Google Scholar] [CrossRef] [Green Version]
- Ichikawa, T.; Okuno, Y.; Sato, Y.; Goshima, F.; Yoshiyama, H.; Kanda, T.; Murata, T. Regulation of Epstein-Barr virus life cycle and cell proliferation by histone H3K27 methyltransferase EZH2 in Akata Cells. mSphere 2018, 3, e00478-18. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Jiang, C.; Trudeau Stephen, J.; Narita, Y.; Zhao, B.; Teng, M.; Damania, B. Histone loaders CAF1 and HIRA restrict Epstein-Barr virus B-cell lytic reactivation. mBio 2020, 11, e01063-20. [Google Scholar] [CrossRef]
- Liu, F.; Pore, N.; Kim, M.; Voong, K.R.; Dowling, M.; Maity, A.; Kao, G.D. Regulation of histone deacetylase 4 expression by the SP family of transcription factors. Mol. Biol. Cell 2006, 17, 585–597. [Google Scholar] [CrossRef] [Green Version]
- Doetzlhofer, A.; Rotheneder, H.; Lagger, G.; Koranda, M.; Kurtev, V.; Brosch, G.; Seiser, C. Histone deacetylase 1 can repress transcription by binding to Sp1. Mol. Cell. Biol. 1999, 19, 5504–5511. [Google Scholar] [CrossRef] [Green Version]
- Grégoire, S.; Xiao, L.; Nie, J.; Zhang, X.; Xu, M.; Li, J.; Yang, X.J. Histone deacetylase 3 interacts with and deacetylates myocyte enhancer factor 2. Mol. Cell. Biol. 2007, 27, 1280–1295. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Zhang, C.; Jiang, H.; Cheng, J. Andrographolide inhibits hypoxia-inducible factor-1 through phosphatidylinositol 3-kinase/AKT pathway and suppresses breast cancer growth. OncoTargets Ther. 2015, 8, 427–435. [Google Scholar] [CrossRef] [Green Version]
- Liu, S.H.; Lin, C.H.; Liang, F.P.; Chen, P.F.; Kuo, C.D.; Alam, M.M.; Fu, S.L. Andrographolide downregulates the v-Src and Bcr-Abl oncoproteins and induces Hsp90 cleavage in the ROS-dependent suppression of cancer malignancy. Biochem. Pharmacol. 2014, 87, 229–242. [Google Scholar] [CrossRef]
- Shen, K.; Ji, L.; Lu, B.; Xu, C.; Gong, C.; Morahan, G.; Wang, Z. Andrographolide inhibits tumor angiogenesis via blocking VEGFA/VEGFR2-MAPKs signaling cascade. Chem. Biol. Interact. 2014, 218, 99–106. [Google Scholar] [CrossRef]
- Lu, C.Y.; Yang, Y.C.; Li, C.C.; Liu, K.L.; Lii, C.K.; Chen, H.W. Andrographolide inhibits TNFα-induced ICAM-1 expression via suppression of NADPH oxidase activation and induction of HO-1 and GCLM expression through the PI3K/Akt/Nrf2 and PI3K/Akt/AP-1 pathways in human endothelial cells. Biochem. Pharmacol. 2014, 91, 40–50. [Google Scholar] [CrossRef]
- Nateewattana, J.; Dutta, S.; Reabroi, S.; Saeeng, R.; Kasemsook, S.; Chairoungdua, A.; Piyachaturawat, P. Induction of apoptosis in cholangiocarcinoma by an andrographolide analogue is mediated through topoisomerase II alpha inhibition. Eur. J. Pharmacol. 2014, 723, 148–155. [Google Scholar] [CrossRef]
- Yang, S.H.; Wang, S.M.; Syu, J.P.; Chen, Y.; Wang, S.D.; Peng, Y.S.; Kung, H.N. Andrographolide induces apoptosis of C6 glioma cells via the ERK-p53-caspase 7-PARP pathway. Biomed. Res. Int. 2014, 2014, 312847. [Google Scholar] [CrossRef] [Green Version]
- Cheung, H.Y.; Cheung, S.H.; Li, J.; Cheung, C.S.; Lai, W.P.; Fong, W.F.; Leung, F.M. Andrographolide Isolated from Andrographis paniculata Induces cell cycle arrest and mitochondrial-mediated apoptosis in human leukemic HL-60 cells. Planta Med. 2005, 71, 1106–1111. [Google Scholar] [CrossRef]
- Wu, C.C.; Fang, C.Y.; Cheng, Y.J.; Hsu, H.Y.; Chou, S.P.; Huang, S.Y.; Chen, J.Y. Inhibition of Epstein-Barr virus reactivation by the flavonoid apigenin. J. Biomed. Sci. 2018, 24, 2. [Google Scholar] [CrossRef] [Green Version]
- Wu, C.C.; Fang, C.Y.; Huang, S.Y.; Chiu, S.H.; Lee, C.H.; Chen, J.Y. Perspective: Contribution of Epstein-Barr virus (EBV) Reactivation to the Carcinogenicity of Nasopharyngeal Cancer Cells. Cancers 2018, 10, 120. [Google Scholar] [CrossRef] [Green Version]
- Yang, S.; Evens, A.M.; Prachand, S.; Singh, A.T.K.; Bhalla, S.; David, K.; Gordon, L.I. Mitochondrial-mediated apoptosis in lymphoma cells by the diterpenoid lactone andrographolide, the active component of Andrographis paniculata. Clin. Cancer Res. 2010, 16, 4755–4768. [Google Scholar] [CrossRef] [Green Version]
- Fang, C.Y.; Lee, C.H.; Wu, C.C.; Chang, Y.T.; Yu, S.L.; Chou, S.P.; Chen, J.Y. Recurrent chemical reactivations of EBV promotes genome instability and enhances tumor progression of nasopharyngeal carcinoma cells. Int. J. Cancer 2009, 124, 2016–2025. [Google Scholar] [CrossRef]
Genes | Primer Sequences (5′–3′) | |
---|---|---|
MEF2D | F | CATGCCCACTGCCTACAACA |
R | TGACATTGCCTAGCGACAGC | |
SP1 | F | GACAGTGAAGGAAGGGGCTC |
R | AATGGCCTCTCGCCTGTATG | |
HDAC5 | F | CCTCAACCATTCCCTCCCAC |
R | GTTCAGAGGCTGTTTTGCGG | |
HDAC6 | F | TGGCTATTGCATGTTCAACCA |
R | GTCGAAGGTGAACTGTGTTCCT | |
HDAC9 | F | CCCCTGCTGCCTCTGTTTTA |
R | GGAATTGCCACAAACGCACT | |
GAPDH | F | TCATCAGCAATGCCTCCTGCA |
R | TGGGTGGCAGTGATGGCA |
Interaction of Proteins | The Probability of Protein–Protein Interaction | |||
---|---|---|---|---|
Sseg | Sdom | Snet | Sall | |
HDAC6–MEF2D | 0.9884 | 0.5146 | 0.8351 | 0.9922 |
HDAC6–SP1 | 0.6846 | 0.3897 | 0.8351 | 0.3417 |
HDAC9–MEF2D | 0.9962 | 0.9965 | 0.8351 | 0.9991 |
HDAC9–SP1 | 0.8130 | 0.5146 | 0.8351 | 0.9011 |
Protein ID | Protein Name | Protein Symbol | Fold Increase |
---|---|---|---|
O75962 | Triple functional domain protein | TRIO | 1.89 |
P32248 | Chemokine receptor type 7 | CCR7 | 2.76 |
P62873 | Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 | GNB1 | 3.39 |
F4I6D6 | RNA polymerase I-specific transcription initiation factor RRN3 | RRN3 | 13.59 |
Q16594 | Transcription initiation factor TFIID subunit 9 | TAF9 | 13.09 |
O00755 | Protein Wnt-7a | WNT7A | 15.96 |
Q13489 | Baculoviral IAP repeat-containing protein 3 | BIRC3 | 12.79 |
O14757 | Serine/threonine-protein kinase Chk1 | CHEK1 | 12.35 |
O00115 | Deoxyribonuclease-2-alpha | DNASE2 | 3.29 |
Q9NPG1 | Frizzled class receptor 3 | FZD3 | 14.08 |
O43424 | Glutamate ionotropic receptor delta type subunit 2 | GRID2 | 5.13 |
O00198 | Activator of apoptosis harakiri | HRK | 13.74 |
P05981 | Serine protease hepsin | HPN | 12.36 |
Q53GA4 | Pleckstrin homology-like domain family A member 2 | PHLDA2 | 2.11 |
P07237 | Protein disulfide-isomerase | P4HB | 14.79 |
Q13591 | Semaphorin-5A | SEMA5A | 13.11 |
Q07817 | Bcl-2-like protein 1 | BCL2L1 | 2.42 |
O43521 | Bcl-2-like protein 11 | BCL2L11 | 11.48 |
Q13164 | Mitogen-activated protein kinase 7 | MAPK7 | 3.07 |
O95819 | Mitogen-activated protein 4 kinase 4 | MAP4K4 | 2.04 |
Q06643 | Lymphotoxin-beta | LTB | 6.77 |
P08648 | Integrin subunit alpha-5 | ITGA5 | 5.47 |
Q14974 | Importin subunit beta-1 | KPNB1 | 4.81 |
Q9GZU2 | Paternally-expressed gene 3 protein | PEG3 | 3.60 |
Q14432 | cGMP-inhibited 3′,5′-cyclic phosphodiesterase A | PDE3A | 14.85 |
Q14249 | Endonuclease G | ENDOG | 13.32 |
Q96PG8 | p53 up-regulated modulator of apoptosis | PUMA | 15.36 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Malat, P.; Ekalaksananan, T.; Heawchaiyaphum, C.; Suebsasana, S.; Roytrakul, S.; Yingchutrakul, Y.; Pientong, C. Andrographolide Inhibits Lytic Reactivation of Epstein-Barr Virus by Modulating Transcription Factors in Gastric Cancer. Microorganisms 2021, 9, 2561. https://doi.org/10.3390/microorganisms9122561
Malat P, Ekalaksananan T, Heawchaiyaphum C, Suebsasana S, Roytrakul S, Yingchutrakul Y, Pientong C. Andrographolide Inhibits Lytic Reactivation of Epstein-Barr Virus by Modulating Transcription Factors in Gastric Cancer. Microorganisms. 2021; 9(12):2561. https://doi.org/10.3390/microorganisms9122561
Chicago/Turabian StyleMalat, Praphatson, Tipaya Ekalaksananan, Chukkris Heawchaiyaphum, Supawadee Suebsasana, Sittiruk Roytrakul, Yodying Yingchutrakul, and Chamsai Pientong. 2021. "Andrographolide Inhibits Lytic Reactivation of Epstein-Barr Virus by Modulating Transcription Factors in Gastric Cancer" Microorganisms 9, no. 12: 2561. https://doi.org/10.3390/microorganisms9122561
APA StyleMalat, P., Ekalaksananan, T., Heawchaiyaphum, C., Suebsasana, S., Roytrakul, S., Yingchutrakul, Y., & Pientong, C. (2021). Andrographolide Inhibits Lytic Reactivation of Epstein-Barr Virus by Modulating Transcription Factors in Gastric Cancer. Microorganisms, 9(12), 2561. https://doi.org/10.3390/microorganisms9122561