Transcriptome Analysis of Testes and Uterus: Reproductive Dysfunction Induced by Toxoplasma gondii in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Experiment Set-Up
2.2. Evaluation of Sperm Quality Parameters
2.3. Ultrastructural Evaluation of Testicles
2.4. cDNA Library Construction and Sequencing
2.5. Sequence Assembly and Acquisition of Clean Reads
2.6. Identification and Bioinformatics Analysis of DEGs
2.7. Verification of mRNA by Quantitative Real-Time PCR Analysis
2.8. Validations of RNA-Seq Results by Western Blotting
3. Results
3.1. Assessment of Reproductive Damage
3.2. Identification of Expressed Transcripts
3.3. Gene Ontology of Differentially Expressed Genes
3.4. KEGG Enrichment Analysis
3.5. Verification Results by qRT-PCR Analyzing
3.6. Verification Results by Western Blotting
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Availability of Data and Materials
References
- Jones, J.L.; Dubey, J.P. Foodborne toxoplasmosis. Clin. Infect. Dis. 2012, 55, 845–851. [Google Scholar] [CrossRef]
- Smadja, D.; Cabre, P.; Prat, C.; Vernant, J.C. Loss of psychic auto-activation. Obsessive-compulsive behavior. Toxoplasmic abscess of the basal ganglia. Rev. Neurol. 1995, 151, 271–273. [Google Scholar]
- Johnson, S.K.; Fitza, M.A.; Lerner, D.A.; Calhoun, D.M.; Beldon, M.A.; Chan, E.T.; Johnson, P.T.J. Risky business: Linking Toxoplasma gondii infection and entrepreneurship behaviours across individuals and countries. Proc. Biol. Sci. 2018, 285, 20180822. [Google Scholar] [CrossRef] [Green Version]
- Hill, D.E.; Chirukandoth, S.; Dubey, J.P. Biology and epidemiology of Toxoplasma gondii in man and animals. Anim. Health Res. Rev. 2005, 6, 41–61. [Google Scholar] [CrossRef]
- Saadatnia, G.; Golkar, M. A review on human toxoplasmosis. Scand. J. Infect. Dis. 2012, 44, 805–814. [Google Scholar] [CrossRef]
- Barreto, F.; Hering, F.; Dall’oglio, M.F.; Martini filho, D.; Campagnari, J.C.; Srougi, M. Toxoplasmosis testicular: Un caso raro de masa testicular. Actas Urol. Esp. 2008, 32, 666–668. [Google Scholar] [CrossRef] [Green Version]
- Colosi, H.A.; Jalali-Zadeh, B.; Colosi, I.A.; Simon, L.M.; Costache, C.A. Influence ofToxoplasma gondiiInfection on Male Fertility: A Pilot Study on Immunocompetent Human Volunteers. Iran. J. Parasitol. 2015, 10, 402–409. [Google Scholar]
- Lopes, W.D.Z.; Costa, A.J.; Souza, F.A.; Rodrigues, J.D.F.; Costa, G.H.N.; Soares, V.E.; Silva, G.S. Semen variables of sheep (Ovis aries) experimentally infected with Toxoplasma gondii. Anim. Reprod. Sci. 2009, 111, 312–319. [Google Scholar] [CrossRef]
- Teixeira, W.F.P.; Tozato, M.E.G.; Pierucci, J.C.; Vital, G.P.; Cruz, A.C.; Lopes, W.D.Z.; Cursino, M.S.; Joaquim, S.F.; Soares, V.E.; Langoni, H. Investigation of Toxoplasma gondii in semen, testicle and epididymis tissues of primo-infected cats (Felis catus). Vet. Parasitol. 2017, 238, 90–93. [Google Scholar] [CrossRef] [Green Version]
- Bajic, G.; Degn, S.E.; Thiel, S.; Andersen, G.R. Complement activation, regulation, and molecular basis for complement-related diseases. Embo J. 2015, 34, 2735–2757. [Google Scholar] [CrossRef] [Green Version]
- Crider, S.R.; Horstman, W.G.; Massey, G.S. Toxoplasma orchitis: Report of a case and a review of the literature. Am. J. Med. 1988, 85, 421–424. [Google Scholar] [CrossRef]
- Pietroiusti, A.; Campagnolo, L.; Fadeel, B. Interactions of engineered nanoparticles with organs protected by internal biological barriers. Small 2013, 9, 1557–1572. [Google Scholar] [CrossRef] [Green Version]
- Blundell, C.; Tess, E.R.; Schanzer, A.S.; Coutifaris, C.; Su, E.J.; Parry, S.; Huh, D. A microphysiological model of the human placental barrier. Lab. Chip. 2016, 16, 3065–3073. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.Y.; Wang, Y.P.; Mahmmod, Y.S.; Wang, J.J.; Liu, T.H.; Zheng, Y.X.; Zhou, X.; Zhang, X.X.; Yuan, Z.G. A Double-Edged Sword: Complement Component 3 in Toxoplasma gondii Infection. Proteomics 2019, 19, e1800271. [Google Scholar] [CrossRef] [PubMed]
- Lockhart, D.J.; Winzeler, E.A. Genomics, gene expression and DNA arrays. Nature 2000, 405, 827–836. [Google Scholar] [CrossRef]
- Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef]
- Li, X.Z.; Wang, X.H.; Xia, L.J.; Weng, Y.B.; Hernandez, J.A.; Tu, L.Q.; Li, L.T.; Li, S.J.; Yuan, Z.G. Protective efficacy of recombinant canine adenovirus type-2 expressing TgROP18 (CAV-2-ROP18) against acute and chronic Toxoplasma gondii infection in mice. BMC Infect. Dis. 2015, 15, 114. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Newby, D.; Marks, L.; Cousins, F.; Duffie, E.; Lyall, F. Villous Explant Culture: Characterization and Evaluation of a Model to Study Trophoblast Invasion. Hypertens. Pregnancy 2005, 24, 75–91. [Google Scholar] [CrossRef]
- Robbins, J.R.; Zeldovich, V.B.; Poukchanski, A.; Boothroyd, J.C.; Bakardjiev, A.I. Tissue barriers of the human placenta to infection with Toxoplasma gondii. Infect. Immun. 2012, 80, 418–428. [Google Scholar] [CrossRef] [Green Version]
- Shiina, T.; Blancher, A.; Inoko, H.; Kulski, J.K. Comparative genomics of the human, macaque and mouse major histocompatibility complex. Immunology 2017, 150, 127–138. [Google Scholar] [CrossRef] [PubMed]
- Leroux, L.P.; Nishi, M.; El-Hage, S.; Fox, B.A.; Bzik, D.J.; Dzierszinski, F.S. Parasite Manipulation of the Invariant Chain and the Peptide Editor H2-DM Affects Major Histocompatibility Complex Class II Antigen Presentation during Toxoplasma gondii Infection. Infect. Immun. 2015, 83, 3865–3880. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tong, Z.B.; Nelson, L.M.; Dean, J. Materencodes a maternal protein in mice with a leucine-rich repeat domain homologous to porcine ribonuclease inhibitor. Mamm. Genome 2000, 11, 281–287. [Google Scholar] [CrossRef]
- Tong, Z.B.; Lyn, G.; Anto, D.P.; Konstantina, V.; Heidi, D.; Paola, S.; Carla, P.; Bondy, C.A.; Nelson, L.M. Developmental Expression and Subcellular Localization of Mouse MATER, an Oocyte-Specific Protein Essential for Early Development. Endocrinology 2004, 145, 1427–1434. [Google Scholar] [CrossRef] [Green Version]
- Wu, X. Maternal depletion of NLRP5 blocks early embryogenesis in rhesus macaque monkeys (Macaca mulatta). Hum. Reprod. 2009, 24, 415–424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pennetier, S.; Perreau, C.; Uzbekova, S.; Thelie, A.; Delaleu, B.; Mermillod, P.; Dalbies-Tran, R. MATER protein expression and intracellular localization throughout folliculogenesis and preimplantation embryo development in the bovine. BMC Dev. Biol. 2006, 6, 26. [Google Scholar] [CrossRef] [Green Version]
- Ma, J.; Milan, D.; Rocha, D. Chromosomal assignment of the porcine NALP5 gene, a candidate gene for female reproductive traits. Anim. Reprod. Sci. 2009, 112, 397–401. [Google Scholar] [CrossRef]
- Lu, Y.Q.; He, X.C.; Zheng, P. Decrease in expression of maternal effect gene Mater is associated with maternal ageing in mice. Mol. Hum. Reprod. 2016, 22, 252–260. [Google Scholar] [CrossRef] [Green Version]
- Fernandes, R.; Tsuda, C.; Perumalsamy, A.L.; Naranian, T.; Chong, J.; Acton, B.M.; Tong, Z.B.; Nelson, L.M.; Jurisicova, A. NLRP5 mediates mitochondrial function in mouse oocytes and embryos. Biol. Reprod. 2012, 86, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Poulson, N.D.; Lechler, T. Robust control of mitotic spindle orientation in the developing epidermis. J. Cell Biol. 2010, 191, 915–922. [Google Scholar] [CrossRef] [Green Version]
- Bultje, R.S.; Castaneda-Castellanos, D.R.; Jan, L.Y.; Jan, Y.N.; Kriegstein, A.R.; Shi, S.H. Mammalian Par3 regulates progenitor cell asymmetric division via notch signaling in the developing neocortex. Neuron 2009, 63, 189–202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Williams, S.E.; Fuchs, E. Oriented divisions, fate decisions. Curr. Opin. Cell Biol. 2013, 25, 749–758. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ballard, M.S.; Zhu, A.; Iwai, N.; Stensrud, M.; Mapps, A.; Postiglione, M.P.; Knoblich, J.A.; Hinck, L. Mammary Stem Cell Self-Renewal Is Regulated by Slit2/Robo1 Signaling through SNAI1 and mINSC. Cell Rep. 2015, 13, 290–301. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meunier, E.; Dick, M.S.; Dreier, R.F.; Schurmann, N.; Kenzelmann Broz, D.; Warming, S.; Roose-Girma, M.; Bumann, D.; Kayagaki, N.; Takeda, K.; et al. Caspase-11 activation requires lysis of pathogen-containing vacuoles by IFN-induced GTPases. Nature 2014, 509, 366–370. [Google Scholar] [CrossRef]
- Finethy, R.; Luoma, S.; Orench-Rivera, N.; Feeley, E.M.; Haldar, A.K.; Yamamoto, M.; Kanneganti, T.-D.; Kuehn, M.J.; Coers, J.r.; Weiss, D.S. Inflammasome Activation by Bacterial Outer Membrane Vesicles Requires Guanylate Binding Proteins. mBio 2015, 8, e01188–e01117. [Google Scholar] [CrossRef] [Green Version]
- Meunier, E.; Broz, P. Interferon-inducible GTPases in cell autonomous and innate immunity. Cell. Microbiol. 2016, 18, 168–180. [Google Scholar] [CrossRef] [Green Version]
- Meunier, E.; Wallet, P.; Dreier, R.F.; Costanzo, S.; Anton, L.; Ruhl, S.; Dussurgey, S.; Dick, M.S.; Kistner, A.; Rigard, M.; et al. Guanylate-binding proteins promote activation of the AIM2 inflammasome during infection with Francisella novicida. Nat. Immunol. 2015, 16, 476–484. [Google Scholar] [CrossRef] [Green Version]
- Britzen-Laurent, N.; Bauer, M.; Berton, V.; Fischer, N.; Syguda, A.; Reipschlager, S.; Naschberger, E.; Herrmann, C.; Sturzl, M. Intracellular trafficking of guanylate-binding proteins is regulated by heterodimerization in a hierarchical manner. PLoS ONE 2010, 5, e14246. [Google Scholar] [CrossRef] [Green Version]
- Shenoy, A.R.; Wellington, D.A.; Kumar, P.; Kassa, H.; Booth, C.J.; Cresswell, P.; Macmicking, J.D. GBP5 Promotes NLRP3 Inflammasome Assembly and Immunity in Mammals. Science 2012, 336, 481–485. [Google Scholar] [CrossRef]
- Fisch, D.; Bando, H.; Clough, B.; Hornung, V.; Yamamoto, M.; Shenoy, A.R.; Frickel, E.M. Human GBP1 is a microbe-specific gatekeeper of macrophage apoptosis and pyroptosis. Embo J. 2019, 38, e100926. [Google Scholar] [CrossRef]
- Legewie, L.; Loschwitz, J.; Steffens, N.; Prescher, M.; Wang, X.; Smits, S.H.J.; Schmitt, L.; Strodel, B.; Degrandi, D.; Pfeffer, K. Biochemical and structural characterization of murine GBP7, a guanylate binding protein with an elongated C-terminal tail. Biochem. J. 2019, 476, 3161–3182. [Google Scholar] [CrossRef] [PubMed]
- Praefcke, G.J.K.; Geyer, M.; Schwemmle, M.; Kalbitzer, H.R.; Herrmann, C. Nucleotide-binding characteristics of human guanylate-binding protein 1 (hGBP1) and identification of the third GTP-binding motif. J. Mol. Biol. 1999, 292, 321–332. [Google Scholar] [CrossRef] [PubMed]
- Degrandi, D.; Konermann, C.; Beuter-Gunia, C.; Kresse, A.; Würthner, J.; Kurig, S.; Beer, S.; Pfeffer, K. Extensive characterization of IFN-induced GTPases mGBP1 to mGBP10 involved in host defense. J. Immunol. 2007, 179, 7729–7740. [Google Scholar] [CrossRef] [Green Version]
- Mears, H.V.; Sweeney, T.R. Better together: The role of IFIT protein-protein interactions in the antiviral response. J. Gen. Virol. 2018, 99, 1463–1477. [Google Scholar] [CrossRef]
- Johnson, B.; VanBlargan, L.A.; Xu, W.; White, J.P.; Shan, C.; Shi, P.Y.; Zhang, R.; Adhikari, J.; Gross, M.L.; Leung, D.W.; et al. Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability. Immunity 2018, 48, 487–499 e485. [Google Scholar] [CrossRef] [Green Version]
- Legrier, M.E.; Bieche, I.; Gaston, J.; Beurdeley, A.; Yvonnet, V.; Deas, O.; Thuleau, A.; Chateau-Joubert, S.; Servely, J.L.; Vacher, S.; et al. Activation of IFN/STAT1 signalling predicts response to chemotherapy in oestrogen receptor-negative breast cancer. Br. J. Cancer 2016, 144, 177–187. [Google Scholar] [CrossRef] [Green Version]
- Pidugu, V.K.; Wu, M.M.; Yen, A.H.; Pidugu, H.B.; Chang, K.W.; Liu, C.J.; Lee, T.C. IFIT1 and IFIT3 promote oral squamous cell carcinoma metastasis and contribute to the anti-tumor effect of gefitinib via enhancing p-EGFR recycling. Oncogene 2019, 38, 3232–3247. [Google Scholar] [CrossRef]
- Skovbjerg, S.; Norden, R.; Martner, A.; Samuelsson, E.; Hynsjo, L.; Wold, A.E. Intact Pneumococci Trigger Transcription of Interferon-Related Genes in Human Monocytes, while Fragmented, Autolyzed Bacteria Subvert This Response. Infect. Immun. 2017, 85. [Google Scholar] [CrossRef] [Green Version]
- Liehl, P.; Meireles, P.; Albuquerque, I.S.; Pinkevych, M.; Baptista, F.; Mota, M.M.; Davenport, M.P.; Prudencio, M. Innate immunity induced by Plasmodium liver infection inhibits malaria reinfections. Infect. Immun. 2015, 83, 1172–1180. [Google Scholar] [CrossRef] [Green Version]
- Janssen, R.; Van Wengen, A.; Verhard, E.; De Boer, T.; Zomerdijk, T.; Ottenhoff, T.H.; Van Dissel, J.T. Divergent role for TNF-alpha in IFN-gamma-induced killing of Toxoplasma gondii and Salmonella typhimurium contributes to selective susceptibility of patients with partial IFN-gamma receptor 1 deficiency. J. Immunol. 2002, 169, 3900–3907. [Google Scholar] [CrossRef] [Green Version]
- Hall, J.C.; Casciola-Rosen, L.; Berger, A.E.; Kapsogeorgou, E.K.; Cheadle, C.; Tzioufas, A.G.; Baer, A.N.; Rosen, A. Precise probes of type II interferon activity define the origin of interferon signatures in target tissues in rheumatic diseases. Proc. Natl. Acad. Sci. USA 2012, 109, 17609–17614. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lacaze, P.; Raza, S.; Sing, G.; Page, D.; Forster, T.; Storm, P.; Craigon, M.; Awad, T.; Ghazal, P.; Freeman, T.C. Combined genome-wide expression profiling and targeted RNA interference in primary mouse macrophages reveals perturbation of transcriptional networks associated with interferon signalling. BMC Genom. 2009, 10, 372. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moody, L.R.; Herbst, A.J.; Aiken, J.M. Upregulation of interferon-gamma-induced genes during prion infection. J. Toxicol. Environ. Health A 2011, 74, 146–153. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Kim, C.C.; Batra, S.; McKerrow, J.H.; Loke, P. Delineation of diverse macrophage activation programs in response to intracellular parasites and cytokines. PLoS Negl. Trop. Dis. 2010, 4, e648. [Google Scholar] [CrossRef] [Green Version]
- Metz, P.; Dazert, E.; Ruggieri, A.; Mazur, J.; Kaderali, L.; Kaul, A.; Zeuge, U.; Windisch, M.P.; Trippler, M.; Lohmann, V.; et al. Identification of type I and type II interferon-induced effectors controlling hepatitis C virus replication. Hepatology 2012, 56, 2082–2093. [Google Scholar] [CrossRef]
- Sasai, M.; Pradipta, A.; Yamamoto, M. Host immune responses to Toxoplasma gondii. Int. Immunol. 2018, 30, 113–119. [Google Scholar] [CrossRef]
- Koblansky, A.A.; Jankovic, D.; Oh, H.; Hieny, S.; Sungnak, W.; Mathur, R.; Hayden, M.S.; Akira, S.; Sher, A.; Ghosh, S. Recognition of profilin by Toll-like receptor 12 is critical for host resistance to Toxoplasma gondii. Immunity 2013, 38, 119–130. [Google Scholar] [CrossRef] [Green Version]
Gene ID | Gene | Forward Primer | Reverse Primer | Product Length |
---|---|---|---|---|
23968 | Nlrp5 | ACTGGGAAAGAGATGCACCC | GCCATCATGCACAAACCCAC | 147 |
229900 | Gbp7 | AGCTCATTGGGTGCAAAAATCC | ACTTACCAGAACCAGGCACTAC | 73 |
14468 | Gbp2b | GCCTCGCCTGTGTATCAGGA | GGAAAGTTGCTTCCTGTCTCC | 82 |
15959 | Ifit3 | TCCTCCAAAAGGCAGCTCAG | TCCCTGTAACGGCACATGAC | 133 |
233752 | Insc | GCAGGTAGACTCGGTTCAGC | AGGTCACCTTGCGTGTCTTC | 117 |
110557 | H2-Q6 | CCCCAGGTCTTATGGTGCTG | TGCCAAGTCAGGGTGATGTC | 78 |
15018 | H2-Q7 | CCCAGGTCTTATGGTGCTGTC | TCAGCTCCTCCCCATTCAAC | 97 |
15015 | H2-Q4 | GAAAGCCAAGGGCAATGAGC | CCGCGCTCTGGTTGTAGTAG | 74 |
14964 | H2-D1 | GACAACAAGGAGTTCGTGCG | CACTCGGAACCACTGCTCTT | 144 |
11461 | β-actin | AGAGAAGCTGTGCTATGTTGCT | GGAACCGCTCGTTGCCAATA | 128 |
Sample | Raw Data | Valid Data | Valid Ratio (Reads) | Q20% | Q30% | GC Content% | ||
---|---|---|---|---|---|---|---|---|
Read | Base | Read | Base | |||||
MaleCtrl-1 | 51722480 | 7.76 G | 51153928 | 7.67 G | 98.9 | 99.68 | 96.19 | 50 |
MaleTox-1 | 53513324 | 8.03 G | 52647430 | 7.90 G | 98.38 | 99.65 | 96.94 | 50 |
FemaleCtrl-1 | 49853240 | 7.48 G | 48944858 | 7.34 G | 98.18 | 99.75 | 97.42 | 49.5 |
FemaleTox-1 | 44228168 | 6.63 G | 43353818 | 6.50 G | 98.02 | 99.63 | 96.99 | 50 |
MaleCtrl-2 | 50455024 | 7.57 G | 49652644 | 7.45 G | 98.41 | 99.64 | 96.95 | 50.5 |
MaleTox-2 | 59110516 | 8.87 G | 58525676 | 8.78 G | 99.01 | 99.73 | 97.16 | 50.5 |
FemaleCtrl-2 | 53600952 | 7.33 G | 52597978 | 7.18 G | 98.13 | 98.68 | 96.15 | 51 |
FemaleTox-2 | 43890326 | 6.58 G | 42897454 | 6.44 G | 97.74 | 98.93 | 93.25 | 49.5 |
MaleCtrl-3 | 48768472 | 7.32 G | 48078448 | 7.21 G | 98.59 | 99.69 | 96.9 | 49 |
MaleTox-3 | 54269660 | 8.14 G | 53547754 | 8.03 G | 98.67 | 99.69 | 97.05 | 49.5 |
FemaleCtrl-3 | 52033912 | 7.81 G | 51570014 | 7.74 G | 99.11 | 99.65 | 96.78 | 50.5 |
FemaleTox-3 | 44641116 | 6.70 G | 43937778 | 6.59 G | 98.42 | 99.69 | 96.97 | 50 |
KEGG ID | Pathway | Description | Gene Numbers in Testes | Gene Numbers in Uterus |
---|---|---|---|---|
mmu05320 | Autoimmune thyroid disease | Includes Graves’ disease (GD) and autoimmune atrophic thyroiditis or primary myxedema, Hashimoto’s thyroiditis (HT) or chronic autoimmune thyroiditis and its variants. | 8 | 7 |
mmu05166 | HTLV-I infection | A retrovirus, involved in many naturally occurring neoplasms in various animal species. | 9 | 17 |
mmu05330 | Allograft rejection | The rejection of a donor tissue graft by the immune system of a recipient. | 8 | 7 |
mmu05332 | Graft-versus-host disease | An immunological disorder that affects many organ systems by allografts. | 8 | 6 |
mmu01100 | Metabolic pathways | Metabolic process consisting of a series of biochemical reactions, such as glycolytic pathway, tricarboxylic acid cycle pathway, gluconeogenesis pathway, fatty acid synthesis pathway. | 21 | 79 |
mmu04940 | Type I diabetes mellitus | An autoimmune disease of endocrine system characterized by minimal or absent production of insulin by the pancreas. | 8 | 7 |
mmu04514 | Cell adhesion molecules (CAMs) | A group of membrane glycoprotein and carbohydrate molecules that mediate the adhesion of cells to cells or of cells to the extracellular matrix. | 8 | 15 |
Gene Symbol | Fold Change in Testes | Fold Change in Uterus | Description |
---|---|---|---|
Kcnk2 | −3.528649146 | −24.02119933 | A two-pore domain potassium channel involved in maintaining cellular membrane resting potentials. |
Nlrp5 | −2.342730135 | −304.5906692 | Closely related to early embryo development. |
Gbp7 | 3.563261125 | 4.890800334 | A GBP family member with an unusual and extended C-terminus. |
Gbp2b | −4.040695723 | −7.340503123 | Gbp2b plays an important role in activating inflammatory bodies and mediating resistance to intracellular pathogens. |
Ceacam10 | 5.871390465 | 10.7128078 | Ceacam10 is a kind of glycoprotein in mouse seminal vesicle secretions that enhances sperm motility and is essential during placental and embryonic development. |
Kcnq2 | −4.833063041 | 15.11249898 | KCNQ2 combines with KCNQ3 to form a potassium ion channel, it is important in the regulation of neuronal excitability. |
Pappa2 | −15.07331338 | −13.54553907 | Affects fetal bone development. Decreased expression of Pappa2 will affect the body size of the fetus at birth. |
Ifit3 | 4.073777097 | 5.433739017 | It plays a vital role in the resistance of interferon-α to pathogens. |
Insc | 5.101441093 | −11.00866683 | Induced spindles to perform unequal mitosis on cells and promote cell differentiation. |
H2-Q6 | 3.454653679 | 5.466215554 | The H2 system determines which components of the cell membrane can induce cellular and humoral responses with proper donor-acceptor binding. They are of great significance in regulating innate and adaptive immune responses and are closely related to many infectious and/or autoimmune diseases. |
H2-Q7 | 2.322132722 | 4.201589866 | |
H2-D1 | 2.911529549 | 2.438249553 | |
H2-Q4 | 4.134029458 | 4.313827783 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Liu, T.; Mahmmod, Y.S.; Yang, Z.; Tan, J.; Ren, Z.; Zhang, X.; Yang, X.; Zhang, X.-X.; Yuan, Z.-G. Transcriptome Analysis of Testes and Uterus: Reproductive Dysfunction Induced by Toxoplasma gondii in Mice. Microorganisms 2020, 8, 1136. https://doi.org/10.3390/microorganisms8081136
Wang J, Liu T, Mahmmod YS, Yang Z, Tan J, Ren Z, Zhang X, Yang X, Zhang X-X, Yuan Z-G. Transcriptome Analysis of Testes and Uterus: Reproductive Dysfunction Induced by Toxoplasma gondii in Mice. Microorganisms. 2020; 8(8):1136. https://doi.org/10.3390/microorganisms8081136
Chicago/Turabian StyleWang, Junjie, Tanghui Liu, Yasser S. Mahmmod, Zipeng Yang, Jiexing Tan, Zhaowen Ren, Xirui Zhang, Xiaoying Yang, Xiu-Xiang Zhang, and Zi-Guo Yuan. 2020. "Transcriptome Analysis of Testes and Uterus: Reproductive Dysfunction Induced by Toxoplasma gondii in Mice" Microorganisms 8, no. 8: 1136. https://doi.org/10.3390/microorganisms8081136
APA StyleWang, J., Liu, T., Mahmmod, Y. S., Yang, Z., Tan, J., Ren, Z., Zhang, X., Yang, X., Zhang, X.-X., & Yuan, Z.-G. (2020). Transcriptome Analysis of Testes and Uterus: Reproductive Dysfunction Induced by Toxoplasma gondii in Mice. Microorganisms, 8(8), 1136. https://doi.org/10.3390/microorganisms8081136