Donated Human Milk as a Determinant Factor for the Gut Bifidobacterial Ecology in Premature Babies
Abstract
1. Introduction
2. Materials and Methods
2.1. Volunteers and Collection of Fecal Samples
2.2. Analyses of Intestinal Bifidobacterial Species
2.2.1. Analysis of Fecal Bifidobacterial Populations by ITS Region Profiling
2.2.2. Analysis of Fecal Bifidobacterial Populations by Specific Quantitative PCR
2.3. Determination of SCFA Levels in Fecal Water
2.4. Statistical Analysis
2.5. Nucleotide Sequence Accession Numbers
3. Results
3.1. Volunteer Characteristics
3.2. Impact of Donor Human Milk on Gut Bifidobacterial Composition
3.3. Effect of Feeding on Gut Bifidobacteria Diversity
3.4. Feeding Impact on Microbiota Metabolism
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Milani, C.; Duranti, S.; Bottacini, F.; Casey, E.; Turroni, F.; Mahony, J.; Belzer, C.; Delgado Palacio, S.; Arboleya Montes, S.; Mancabelli, L.; et al. The first microbial colonizers of the human gut: Composition, activities, and health implications of the infant gut microbiota. Microbiol. Mol. Biol. Rev. 2017, 81. [Google Scholar] [CrossRef] [PubMed]
- Henderickx, J.G.E.; Zwittink, R.D.; van Lingen, R.A.; Knol, J.; Belzer, C. The Preterm Gut Microbiota: An Inconspicuous Challenge in Nutritional Neonatal Care. Front. Cell. Infect. Microbiol. 2019, 9. [Google Scholar] [CrossRef] [PubMed]
- Arboleya, S.; Binetti, A.; Salazar, N.; Fernández, N.; Solís, G.; Hernández-Barranco, A.; Margolles, A.; de los Reyes-Gavilán, C.G.; Gueimonde, M. Establishment and development of intestinal microbiota in preterm neonates. FEMS Microbiol. Ecol. 2012, 79, 763–772. [Google Scholar] [CrossRef] [PubMed]
- Arboleya, S.; Sanchez, B.; Milani, C.; Duranti, S.; Solis, G.; Fernandez, N.; de los Reyes-Gavilan, C.G.; Ventura, M.; Margolles, A.; Gueimonde, M. Intestinal microbiota development in preterm neonates and effect of perinatal antibiotics. J. Pediatr. 2015, 166, 538–544. [Google Scholar] [CrossRef] [PubMed]
- Ambrogi, V.; Bottacini, F.; O’Sullivan, J.; O’Connell Motherway, M.; Linqiu, C.; Schoemaker, B.; Schoterman, M.; van Sinderen, D. Characterization of GH2 and GH42 β-galactosidases derived from bifidobacterial infant isolates. AMB Express 2019, 9, 9. [Google Scholar] [CrossRef]
- Arboleya, S.; Watkins, C.; Stanton, C.; Ross, R.P. Gut Bifidobacteria Populations in Human Health and Aging. Front. Microbiol. 2016, 7, 1204. [Google Scholar] [CrossRef]
- Taft, D.H.; Liu, J.; Maldonado-Gomez, M.X.; Akre, S.; Huda, M.N.; Ahmad, S.M.; Stephensen, C.B.; Mills, D.A. Bifidobacterial Dominance of the Gut in Early Life and Acquisition of Antimicrobial Resistance. mSphere 2018, 3. [Google Scholar] [CrossRef]
- Hard, A.L.; Nilsson, A.K.; Lund, A.M.; Hansen-Pupp, I.; Smith, L.E.H.; Hellstrom, A. Review shows that donor milk does not promote the growth and development of preterm infants as well as maternal milk. Acta Paediatr. 2019, 108, 998–1007. [Google Scholar] [CrossRef]
- WHO. Infant and Young Child Feeding. 2018. Available online: https://www.who.int/news-room/fact-sheets/detail/infant-and-young-child-feeding (accessed on 1 April 2020).
- Miller, J.; Tonkin, E.; Damarell, R.A.; McPhee, A.J.; Suganuma, M.; Suganuma, H.; Middleton, P.F.; Makrides, M.; Collins, C.T. A Systematic Review and Meta-Analysis of Human Milk Feeding and Morbidity in Very Low Birth Weight Infants. Nutrients 2018, 10, 707. [Google Scholar] [CrossRef]
- World Health Organization. Guidelines on Optimal Feeding of Low Birthweight Infants in Low and Middle-Income Countries; WHO: Geneva, Switzerland, 2011. [Google Scholar]
- Peila, C.; Moro, G.E.; Bertino, E.; Cavallarin, L.; Giribaldi, M.; Giuliani, F.; Cresi, F.; Coscia, A. The Effect of Holder Pasteurization on Nutrients and Biologically-Active Components in Donor Human Milk: A Review. Nutrients 2016, 8, 477. [Google Scholar] [CrossRef]
- Bardanzellu, F.; Fanos, V.; Reali, A. “Omics” in Human Colostrum and Mature Milk: Looking to Old Data with New Eyes. Nutrients 2017, 9, 843. [Google Scholar] [CrossRef]
- Parra-Llorca, A.; Gormaz, M.; Alcantara, C.; Cernada, M.; Nunez-Ramiro, A.; Vento, M.; Collado, M.C. Preterm Gut Microbiome Depending on Feeding Type: Significance of Donor Human Milk. Front. Microbiol. 2018, 9, 1376. [Google Scholar] [CrossRef] [PubMed]
- Cong, X.; Judge, M.; Xu, W.; Diallo, A.; Janton, S.; Brownell, E.A.; Maas, K.; Graf, J. Influence of Feeding Type on Gut Microbiome Development in Hospitalized Preterm Infants. Nurs. Res. 2017, 66, 123–133. [Google Scholar] [CrossRef] [PubMed]
- Ford, S.L.; Lohmann, P.; Preidis, G.A.; Gordon, P.S.; O’Donnell, A.; Hagan, J.; Venkatachalam, A.; Balderas, M.; Luna, R.A.; Hair, A.B. Improved feeding tolerance and growth are linked to increased gut microbial community diversity in very-low-birth-weight infants fed mother’s own milk compared with donor breast milk. Am. J. Clin. Nutr. 2019, 109, 1088–1097. [Google Scholar] [CrossRef]
- Milani, C.; Lugli, G.A.; Turroni, F.; Mancabelli, L.; Duranti, S.; Viappiani, A.; Mangifesta, M.; Segata, N.; van Sinderen, D.; Ventura, M. Evaluation of bifidobacterial community composition in the human gut by means of a targeted amplicon sequencing (ITS) protocol. FEMS Microbiol. Ecol. 2014, 90, 493–503. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Pena, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef]
- Bokulich, N.A.; Kaehler, B.D.; Rideout, J.R.; Dillon, M.; Bolyen, E.; Knight, R.; Huttley, G.A.; Gregory Caporaso, J. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2’s q2-feature-classifier plugin. Microbiome 2018, 6, 90. [Google Scholar] [CrossRef]
- Gueimonde, M.; Debor, L.; Tolkko, S.; Jokisalo, E.; Salminen, S. Quantitative assessment of faecal bifidobacterial populations by real-time PCR using lanthanide probes. J. Appl. Microbiol. 2007, 102, 1116–1122. [Google Scholar] [CrossRef]
- Matsuki, T.; Watanabe, K.; Fujimoto, J.; Kado, Y.; Takada, T.; Matsumoto, K.; Tanaka, R. Quantitative PCR with 16S rRNA-gene-targeted species-specific primers for analysis of human intestinal bifidobacteria. Appl. Environ. Microbiol. 2004, 70, 167–173. [Google Scholar] [CrossRef]
- Lahtinen, S.J.; Gueimonde, M.; Ouwehand, A.C.; Reinikainen, J.P.; Salminen, S.J. Probiotic bacteria may become dormant during storage. Appl. Environ. Microbiol. 2005, 71, 1662–1663. [Google Scholar] [CrossRef] [PubMed]
- Moris, G.; Arboleya, S.; Mancabelli, L.; Milani, C.; Ventura, M.; de Los Reyes-Gavilan, C.G.; Gueimonde, M. Fecal microbiota profile in a group of myasthenia gravis patients. Sci. Rep. 2018, 8, 14384. [Google Scholar] [CrossRef] [PubMed]
- Zakrzewski, M.; Proietti, C.; Ellis, J.J.; Hasan, S.; Brion, M.J.; Berger, B.; Krause, L. Calypso: A user-friendly web-server for mining and visualizing microbiome-environment interactions. Bioinformatics 2017, 33, 782–783. [Google Scholar] [CrossRef] [PubMed]
- Paulson, J.N.; Stine, O.C.; Bravo, H.C.; Pop, M. Differential abundance analysis for microbial marker-gene surveys. Nat. Methods 2013, 10, 1200–1202. [Google Scholar] [CrossRef]
- Gloor, G.B.; Macklaim, J.M.; Pawlowsky-Glahn, V.; Egozcue, J.J. Microbiome Datasets Are Compositional: And This Is Not Optional. Front. Microbiol. 2017, 8. [Google Scholar] [CrossRef]
- Fernandes, A.D.; Reid, J.N.S.; Macklaim, J.M.; McMurrough, T.A.; Edgell, D.R.; Gloor, G.B. Unifying the analysis of high-throughput sequencing datasets: Characterizing RNA-seq, 16S rRNA gene sequencing and selective growth experiments by compositional data analysis. Microbiome 2014, 2, 15. [Google Scholar] [CrossRef]
- WHO/UNICEF. Global Nutrition Targets 2025: Breastfeeding Policy Brief (WHO/NMH/NHD/14.7); World Health Organization: Geneva, Switzerland, 2014. [Google Scholar]
- Backhed, F.; Roswall, J.; Peng, Y.; Feng, Q.; Jia, H.; Kovatcheva-Datchary, P.; Li, Y.; Xia, Y.; Xie, H.; Zhong, H.; et al. Dynamics and Stabilization of the Human Gut Microbiome during the First Year of Life. Cell Host Microbe 2015, 17, 690–703. [Google Scholar] [CrossRef]
- Penders, J.; Thijs, C.; Vink, C.; Stelma, F.F.; Snijders, B.; Kummeling, I.; van den Brandt, P.A.; Stobberingh, E.E. Factors Influencing the Composition of the Intestinal Microbiota in Early Infancy. Pediatrics 2006, 118, 511–521. [Google Scholar] [CrossRef]
- Bezirtzoglou, E.; Tsiotsias, A.; Welling, G.W. Microbiota profile in feces of breast- and formula-fed newborns by using fluorescence in situ hybridization (FISH). Anaerobe 2011, 17, 478–482. [Google Scholar] [CrossRef]
- Tannock, G.W.; Lawley, B.; Munro, K.; Gowri Pathmanathan, S.; Zhou, S.J.; Makrides, M.; Gibson, R.A.; Sullivan, T.; Prosser, C.G.; Lowry, D.; et al. Comparison of the compositions of the stool microbiotas of infants fed goat milk formula, cow milk-based formula, or breast milk. Appl. Environ. Microbiol. 2013, 79, 3040–3048. [Google Scholar] [CrossRef]
- Le Huërou-Luron, I.; Blat, S.; Boudry, G. Breast- v. formula-feeding: Impacts on the digestive tract and immediate and long-term health effects. Nutr. Res. Rev. 2010, 23, 23–36. [Google Scholar] [CrossRef] [PubMed]
- Boyce, C.; Watson, M.; Lazidis, G.; Reeve, S.; Dods, K.; Simmer, K.; McLeod, G. Preterm human milk composition: A systematic literature review. Br. J. Nutr. 2016, 116, 1033–1045. [Google Scholar] [CrossRef] [PubMed]
- Bode, L. The functional biology of human milk oligosaccharides. Early Hum. Dev. 2015, 91, 619–622. [Google Scholar] [CrossRef] [PubMed]
- Rios-Covian, D.; Sanchez, B.; Martinez, N.; Cuesta, I.; Hernandez-Barranco, A.M.; de Los Reyes-Gavilan, C.G.; Gueimonde, M. A proteomic approach towards understanding the cross talk between Bacteroides fragilis and Bifidobacterium longum in coculture. Can. J. Microbiol. 2016, 62, 623–628. [Google Scholar] [CrossRef]
- Sela, D.A.; Chapman, J.; Adeuya, A.; Kim, J.H.; Chen, F.; Whitehead, T.R.; Lapidus, A.; Rokhsar, D.S.; Lebrilla, C.B.; German, J.B.; et al. The genome sequence of Bifidobacterium longum subsp. infantis reveals adaptations for milk utilization within the infant microbiome. Proc. Natl. Acad. Sci. USA 2008, 105, 18964–18969. [Google Scholar] [CrossRef]
- Arboleya, S.; Bottacini, F.; O’Connell-Motherway, M.; Ryan, C.A.; Ross, R.P.; van Sinderen, D.; Stanton, C. Gene-trait matching across the Bifidobacterium longum pan-genome reveals considerable diversity in carbohydrate catabolism among human infant strains. BMC Genom. 2018, 19, 33. [Google Scholar] [CrossRef]
- Bottacini, F.; Morrissey, R.; Esteban-Torres, M.; James, K.; van Breen, J.; Dikareva, E.; Egan, M.; Lambert, J.; van Limpt, K.; Knol, J.; et al. Comparative genomics and genotype-phenotype associations in Bifidobacterium breve. Sci. Rep. 2018, 8, 10633. [Google Scholar] [CrossRef]




| Target | Primer Sequence (5’-3’) | T (°C) | Reference |
|---|---|---|---|
| Bifidobacterium bifidum | TGACCGACCTGCCCCATGCT | 61 | [21] |
| CCCATCCCACGCCGATAGAAT | |||
| Bifidobacterium breve | AATGCCGGATGCTCCATCACAC | 61 | [21] |
| GCCTTGCTCCCTAACAAAAGAGG | |||
| Bifidobacterium catenulatum group | GCCGGATGCTCCGACTCCT | 64 | [21] |
| ACCCGAAGGCTTGCTCCCGAT | |||
| Bifidobacterium longum group | TTCCAGTTGATCGCATGGTCTTCT | 65 | [21] |
| GGCTACCCGTCGAAGCCACG | |||
| Bifidobacterium dentium | ATCCCGGGGGTTCGCCT | 61 | [22] |
| GAAGGGCTTGCTCCCGA | |||
| Bifidobacterium adolescentis group | CTCCAGTTGGATGCATGTC | 61 | [22] |
| CGAAGGCTTGCTCCCAGT | |||
| Bifidobacterium angulatum | CAGTCCATCGCATGGTGGT | 61 | [22] |
| GAAGGCTTGCTCCCCAAC | |||
| Bifidobacterium animalis | ACCAACCTGCCCTGTGCACCG | 67 | [23] |
| CCATCACCCCGCCAACAAGCT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arboleya, S.; Saturio, S.; Suárez, M.; Fernández, N.; Mancabelli, L.; de los Reyes-Gavilán, C.G.; Ventura, M.; Solís, G.; Gueimonde, M. Donated Human Milk as a Determinant Factor for the Gut Bifidobacterial Ecology in Premature Babies. Microorganisms 2020, 8, 760. https://doi.org/10.3390/microorganisms8050760
Arboleya S, Saturio S, Suárez M, Fernández N, Mancabelli L, de los Reyes-Gavilán CG, Ventura M, Solís G, Gueimonde M. Donated Human Milk as a Determinant Factor for the Gut Bifidobacterial Ecology in Premature Babies. Microorganisms. 2020; 8(5):760. https://doi.org/10.3390/microorganisms8050760
Chicago/Turabian StyleArboleya, Silvia, Silvia Saturio, Marta Suárez, Nuria Fernández, Leonardo Mancabelli, Clara G. de los Reyes-Gavilán, Marco Ventura, Gonzalo Solís, and Miguel Gueimonde. 2020. "Donated Human Milk as a Determinant Factor for the Gut Bifidobacterial Ecology in Premature Babies" Microorganisms 8, no. 5: 760. https://doi.org/10.3390/microorganisms8050760
APA StyleArboleya, S., Saturio, S., Suárez, M., Fernández, N., Mancabelli, L., de los Reyes-Gavilán, C. G., Ventura, M., Solís, G., & Gueimonde, M. (2020). Donated Human Milk as a Determinant Factor for the Gut Bifidobacterial Ecology in Premature Babies. Microorganisms, 8(5), 760. https://doi.org/10.3390/microorganisms8050760

