Influenza A Virus Detected in Native Bivalves in Waterfowl Habitat of the Delmarva Peninsula, USA
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Newell, R.I.E.; Kemp, W.M.; Hagy, J.D., III; Cerco, C.F.; Testa, J.M.; Boynton, W.R. Top-down control of phytoplankton by oysters in Chesapeake Bay, USA: Comment on Pomeroy et al. (2006). Mar. Ecol. Prog. Ser. 2007, 341, 293–298. [Google Scholar] [CrossRef] [Green Version]
- Gerritson, J.; Holland, A.F.; Irvine, D.F. Suspension-feeding bivalves and the fate of primary production: An estuarine model applied to Chesapeake Bay. Estuaries 1994, 17, 403–416. [Google Scholar] [CrossRef]
- Newell, R.I. Ecological changes in Chesapeake Bay: Are they the result of overharvesting the American oyster, Crassostrea virginica. In Chesapeake Research Consortium Publication 129; Chesapeake Research Consortium: Edgewater, Maryland, USA, 1988; pp. 536–546. [Google Scholar]
- Cerco, C.F.; Noel, M.R. Monitoring, modeling, and management impacts of bivalve filter feeders in the oligohaline and tidal fresh regions of the Chesapeake Bay system. Ecol. Model. 2010, 221, 1054–1064. [Google Scholar] [CrossRef]
- Graczyk, T.K.; Farley, C.A.; Fayer, R.; Lewis, E.J.; Troutt, J.M. Detection of Cryptosporidium oocysts and Giardia cysts in the tissues of eastern oysters (Crassostrea virginica) carrying principal oyster infectious diseases. J. Parasitol. 1998, 84, 1039–1042. [Google Scholar] [CrossRef] [PubMed]
- Murphree, R.L.; Tamplin, M.L. Uptake and retention of Vibrio cholera O1 in the Eastern oyster, (Crassostrea virginica). Appl. Environ. Microbiol. 1995, 61, 3656–3660. [Google Scholar] [PubMed]
- Cromeans, T.L.; Nainan, O.; Margolis, H.S. Detection of hepatitis A virus RNA in oyster meat. Appl. Environ. Microbiol. 1997, 63, 2460–2463. [Google Scholar] [Green Version]
- Graczyk, T.K.; Conn, D.B.; Lucy, G.; Minchin, D.; Tamang, L.; Moura, L.N.S.; DaSilva, A.J. Human waterborne parasites in zebra mussels (Dreissena polymorpha) from the Shannon River drainage area, Ireland. Parasitol. Res. 2004, 93, 385–391. [Google Scholar] [CrossRef]
- Graczyk, T.K.; Thompson, R.C.; Fayer, R.; Adams, P.; Morgan, U.M.; Lewis, E.J. Giardia duoenalis cysts of genotype A recovered from clams in the Chesapeake Bay subestuary, Rhode River. Am. J. Trop. Med. Hyg. 1999, 61, 526–529. [Google Scholar] [CrossRef]
- Lang, A.S.; Kelly, A.; Runstadler, J.A. Prevalence and diversity of avian influenza viruses in environmental reservoirs. J. Gen. Virol. 2008, 89, 509–519. [Google Scholar] [CrossRef]
- Densmore, C.L.; Iwanowicz, D.D.; Ottinger, C.A.; Hindman, L.J.; Bessler, A.M.; Iwanowicz, L.R.; Prosser, D.J.; Whitbeck, M.; Driscoll, C.P. Molecular detection of avian influenza virus from sediment samples in waterfowl habitat on the Delmarva Peninsula, United States. Avian. Dis. 2017, 61, 520–525. [Google Scholar] [CrossRef]
- Brown, J.D.; Goekjian, G.; Poulson, R.; Valeika, S.; Stallknecht, D.E. Avian influenza virus in water: Infectivity is dependent on pH, salinity and temperature. Vet. Microbiol. 2009, 136, 20–26. [Google Scholar] [CrossRef] [PubMed]
- Stumpf, P.; Failing, K.; Papp, T.; Nazir, J.; Böhm, R.; Marschang, R.E. Accumulation of a low pathogenic avian influenza virus in zebra mussels (Dreissena polymorpha). Avian. Dis. 2010, 54, 1183–1190. [Google Scholar] [CrossRef] [PubMed]
- Huyvaert, K.P.; Carlson, J.S.; Bentler, K.T.; Cobble, K.R.; Nolte, D.L.; Franklin, A.B. Freshwater clams as bioconcentrators of avian influenza virus in water. Vector Borne. Zoonotic. Dis. 2012, 12, 904–906. [Google Scholar] [CrossRef] [PubMed]
- Piffer, P.R.; Pintor de Aruda, E.; Passos, F.D. The biology and functional morphology of Macoma biota. Zoologia 2011, 28, 321–333. [Google Scholar] [CrossRef]
- Galimany, E.; Rose, J.M.; Dixon, M.S.; Wikfors, G.H. Quantifying feeding behavior of ribbed mussels (Guekensia demissa) in two urban sites (Long Island Sound, USA) with different seston characteristics. Estuaries Coast 2013, 36, 1265–1273. [Google Scholar] [CrossRef]
- Chesapeake Bay Mean Surface Salinity. Available online: https://www.chesapeakebay.net/what/maps/chesapeake_bay_mean_surface_salinity_spring_1985_2006 (accessed on 29 May 2019).
- Ladman, B.S.; Driscoll, C.P.; Pope, C.R.; Slemons, R.D.; Gelb, J. Potential of low pathogenicity avian influenza viruses of wild bird origin to establish experimental infections in turkeys and chickens. Avian. Dis. 2010, 5, 1091–1094. [Google Scholar] [CrossRef] [PubMed]
- Slemons, R.D.; Hansen, W.R.; Converse, K.A.; Senne, D.A. Type A influenza virus surveillance in free-flying, nonmigratory ducks residing on the Eastern Shore of Maryland. Avian. Dis. 2003, 47, 1107–1110. [Google Scholar] [CrossRef]
- Prosser, D.J.; Densmore, C.L.; Hindman, L.J.; Iwanowicz, D.D.; Ottinger, C.A.; Iwanowicz, L.R.; Driscoll, C.P.; Nagel, J. Low-pathogenic avian influenza viruses in wild migratory waterfowl in a region of high poultry production, Delmarva, Maryland. Avian. Dis. 2016, 61, 128–134. [Google Scholar] [CrossRef]
- Rohani, P.; Breban, R.; Stallknecht, D.E.; Drake, J.M. Environmental transmission of low pathogenicity avian influenza viruses and its implications for pathogen invasion. Proc. Natl. Acad. Sci. USA 2009, 106, 10365–10369. [Google Scholar] [CrossRef] [Green Version]
- Numberger, D.; Dreler, C.; Vulliod, C.; Gabriel, G.; Greenwood, A.D.; Grossart, H. Recovery of influenza A viruses from lake water and sediments by experimental inoculation. PLoS ONE 2019. [Google Scholar] [CrossRef]
- Spackman, E.; Senne, D.A.; Myers, T.J.; Bulaga, L.L.; Garber, L.P.; Perdue, M.L.; Lohman, K.; Daum, L.T.; Suarez, D.L. Development of a real-time reverse transcriptase PCR assay for type A influenza virus and the Avian H5 and H7 hemagglutinin subtypes. J. Clin. Microbiol. 2002, 40, 3256–3260. [Google Scholar] [CrossRef] [PubMed]
Site Designation | Species | # Specimens Tested | # Positive Specimens | % Positive Specimens |
---|---|---|---|---|
Trippe Creek | Macoma balthica | 59 | 2 | 3.4 |
Goldsborough Creek | Macoma phenax | 40 | 4 | 10.0 |
Reed Creek | Guekensia demissa | 24 | 6 | 25.0 |
Site Designation | Approx. Latitude | Approx. Longitude | Species (# Specimens) | Mean Weight (mg) | Mean Length (mm) |
---|---|---|---|---|---|
Trippe Creek | 38.710299 | −76.110816 | Macoma balthica (59) | 1180 | 19 |
Macoma phenax (16) | 155 | 9 | |||
Goldsborough Creek | 38.694905 | −76.131430 | Macoma balthica (10) | 148 | 10 |
Macoma phenax (40) | 100 | 8 | |||
Mulinia sp. (7) | 287 | 10 | |||
Eastern Neck | 39.045982 | −76.223874 | Macoma balthica (48) | 1310 | 21 |
Macoma phenax (2) | 130 | 10 | |||
Rangia sp. (11) | 23,345 | 40 | |||
Mya sp. (1) | 2800 | 32 | |||
Mussel undet sp (1) | 160 | 11 | |||
Reed Creek | 39.050508 | −76.160033 | Guekensia demissa (24) | 6691 | 42 |
Rangia sp. (1) | 19,100 | 37 | |||
Barren Island | 38.333101 | −76.259680 | Macoma balthica (36) | 210 | 11 |
Mulinia sp. (8) | 213 | 9 |
Description | Sequence |
---|---|
Forward primer (M+25) | AGATGAGTACTTCTAACCGAGGTCG |
Reverse primer (M-124) | TGCAAAAACATCTTCAAGTCTCTG |
Synthetic Matrix Standard | TGAAAGATGAGTCTTCTAACCGAGGTCGAAACGTACGTTCTCTCTATCGTCCCGTCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAAGATGTTTTTGCAGGGAAGAACACCGATCTCGAGGCACTCATGGAATGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAGGGGATTTTAGGATTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAGAA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Densmore, C.L.; Iwanowicz, D.D.; McLaughlin, S.M.; Ottinger, C.A.; Spires, J.E.; Iwanowicz, L.R. Influenza A Virus Detected in Native Bivalves in Waterfowl Habitat of the Delmarva Peninsula, USA. Microorganisms 2019, 7, 334. https://doi.org/10.3390/microorganisms7090334
Densmore CL, Iwanowicz DD, McLaughlin SM, Ottinger CA, Spires JE, Iwanowicz LR. Influenza A Virus Detected in Native Bivalves in Waterfowl Habitat of the Delmarva Peninsula, USA. Microorganisms. 2019; 7(9):334. https://doi.org/10.3390/microorganisms7090334
Chicago/Turabian StyleDensmore, Christine L., Deborah D. Iwanowicz, Shawn M. McLaughlin, Christopher A. Ottinger, Jason E. Spires, and Luke R. Iwanowicz. 2019. "Influenza A Virus Detected in Native Bivalves in Waterfowl Habitat of the Delmarva Peninsula, USA" Microorganisms 7, no. 9: 334. https://doi.org/10.3390/microorganisms7090334
APA StyleDensmore, C. L., Iwanowicz, D. D., McLaughlin, S. M., Ottinger, C. A., Spires, J. E., & Iwanowicz, L. R. (2019). Influenza A Virus Detected in Native Bivalves in Waterfowl Habitat of the Delmarva Peninsula, USA. Microorganisms, 7(9), 334. https://doi.org/10.3390/microorganisms7090334