Safe Cultivation of Medicago sativa in Metal-Polluted Soils from Semi-Arid Regions Assisted by Heat- and Metallo-Resistant PGPR
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Growth Conditions and Inoculation Treatments
2.2. Chlorophyll Fluorescence and Gas Exchange
2.3. Determination of Nutrient and Metal Content in Plants
2.4. Antioxidant Enzymes Determination
2.5. Global Stress Evaluation: Oxidative Stress Index (OSI)
2.6. Isolation of Plant RNA and qRT-PCR of Stress Related Genes
- ΔCq = AVECq(TargetAssay) – AVECq(ReferenceAssay)
- ΔΔCq = ΔCq(TestSample) − ΔCq(ReferenceSample)
- RQ = 2 − ΔΔCq
2.7. Observation of Biofilms by Scanning Electron Microscopy
2.8. Statistical Analysis
3. Results
3.1. Plant Growth Parameters
3.2. Physiological State of The Plants
3.3. Nutrient Composition of Plants
3.4. Determination of Antioxidant Enzymes
3.5. Evaluation of the Overall Stress: The Oxidative Stress Index (OSI)
3.6. Expression of Stress-Related Genes
3.7. Metal Accumulation in Plants
3.8. Colonization of Plant Roots by Bacterial Cells
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- FAO (Food and Agricultural Organization). 2015: International Year of Soil. Available online: http://www.fao.org/soils-2015/fr/ (accessed on 22 July 2019).
- Mahar, E.; Wang, P.; Ali, A.; Awasti, M.K.; Lahori, A.H.; Wang, Q.; Li, R.; Zhang, Z. Challenges and opportunities in the phytoremediation of heavy metals contaminated soils: A review. Ecotoxicol. Environ. Saf. 2016, 126, 111–121. [Google Scholar] [CrossRef] [PubMed]
- Zheljazkov, V.D.; Craker, L.E.; Xing, B.; Nielsen, N.E.; Wilcox, A. Aromatic plant production on metal contaminated soils. Sci. Total Environ. 2008, 395, 51–62. [Google Scholar] [CrossRef] [PubMed]
- Ali, H.; Khan, E.; Sajad, A. Phytoremediation of heavy metals—Concepts and applications. Chemosphere 2013, 91, 869–881. [Google Scholar] [CrossRef] [PubMed]
- Bolan, N.; Kunhikrishnan, A.; Thangarajan, R.; Kumpiene, J.; Park, J.; Makino, T.; Kirkham, M.B.; Scheckel, K. Remediation of heavy metal(loid)s contaminated soils--to mobilize or to immobilize? J. Hazard. Mater. 2014, 266, 141–166. [Google Scholar] [CrossRef] [PubMed]
- Zheljazkov, V.D.; Craker, L.E.; Xing, B. Effects of Cd, Pb, and Cu on growth and essential oil contents in dill, peppermint, and basil. Environ. Exp. Bot. 2006, 58, 9–16. [Google Scholar] [CrossRef]
- Zheljazkov, V.D.; Jeliazkova, E.A.; Kovacheva, N.; Dzhurmanski, A. Metal uptake by medicinal plant species grown in soils contaminated by a smelter. Environ. Exp. Bot. 2008, 64, 207–216. [Google Scholar] [CrossRef]
- Affholder, M.C.; Prudent, P.; Masotti, V.; Coulomb, B.; Rabier, J.; Nguyen-The, B.; Laffont-Schwob, I. Transfer of metals and metalloids from soil to shoots in wild rosemary (Rosmarinus officinalis L.) growing on a former lead smelter site: Human exposure risk. Sci. Total Environ. 2013, 454–455, 219–229. [Google Scholar] [CrossRef] [PubMed]
- Masarovičová, E.; KráĬová, K.; Kummerová, M. Principles of classification of medicinal plants as hyperaccumulators or excluders. Acta Physiol. Plant. 2010, 32, 823–829. [Google Scholar] [CrossRef]
- Arpadjan, S.; Ҫelik, G.; Taşkesen, S.; Güçer, Ş. Arsenic, cadmium and lead in medicinal herbs and their fractionation. Food Chem. Toxicol. 2008, 46, 2871–2875. [Google Scholar] [CrossRef]
- Stancheva, I.; Geneva, M.; Hristozkova, M.; Markovska, Y.; Salamon, I. Antioxidant capacity of sage grown on heavy metal-polluted soil, Russ. J. Plant Physiol. 2010, 57, 799–805. [Google Scholar] [CrossRef]
- Pandey, V.C.; Rai, A.; Korstad, J. Aromatic crops in phytoremediation: From contaminated to waste dumpsites. In Phytomanagement of Polluted Sites; Market Opportunities in Sustainable, Phytoremediation; Pandey, V.C., Bauddh, K., Eds.; Elsevier: Amsterdam, The Netherlands, 2019; pp. 255–275. [Google Scholar] [CrossRef]
- Pajuelo, E.; Rodríguez-Llorente, I.D.; Lafuente, A.; Caviedes, M.A. Legume–Rhizobium symbioses as a tool for bioremediation of heavy metal polluted soils. In Biomanagement of Metal-Contaminated Soils; Environmental Pollution Volume 20; Khan, M.S., Zaidi, A., Goel, R., Musarrat, J., Eds.; Springer: Dordrecht, The Netherlands, 2011; pp. 95–123. [Google Scholar] [CrossRef]
- Tak, H.I.; Ahmad, F.; Babalola, O.O. Advances in the application of plant growth-promoting rhizobacteria in phytoremediation of heavy metals. In Reviews of Environmental Contamination and Toxicology; Whitacre, D.M., Ed.; Springer: New York, NY, USA, 2013; Volume 223, pp. 33–52. [Google Scholar]
- Hao, X.; Taghavi, S.; Xie, P.; Orbach, M.J.; Alwathnani, H.A.; Rensing, C.; Wei, G. Phytoremediation of heavy and transition metals aided by legume-rhizobia symbiosis. Int. J. Phytoremediat. 2014, 16, 179–202. [Google Scholar] [CrossRef]
- Fagorzi, C.; Checcucci, A.; diCenzo, G.C.; Debiec-Andrzejewska, K.; Dziewit, L.; Pini, F.; Mengoni, A. Harnessing rhizobia to improve heavy-metal phytoremediation by legumes. Genes 2018, 9, 542. [Google Scholar] [CrossRef]
- Pajuelo, E.; Carrasco, J.A.; Romero, L.C.; Chamber, M.A.; Gotor, C. Evaluation of the metal phytoextraction potential of crop legumes. Regulation of the expression of O-acetylserine (thiol)lyase under metal stress. Plant Biol. 2007, 9, 672–681. [Google Scholar] [CrossRef] [PubMed]
- Safranova, V.I.; Piluzza, G.; Bullitta, S.; Belimov, A.A. Use of legume-microbe symbioses for phytoremediation of heavy metal polluted soils: Advantages and potential problems. In Handbook of Phytoremediation; Golubev, I.A., Ed.; Nova Science Publishers, Inc.: Hauppauge, NY, USA, 2011; pp. 443–469. [Google Scholar]
- Zubair, M.; Shakir, M.; Ali, Q.; Rani, N.; Fatima, N.; Farooq, S.; Shafiq, S.; Kanwal, N.; Ali, F.; Nasir, I.A. Rhizobacteria and phytoremediation of heavy metals. Environ. Technol. Rev. 2016, 5, 112–119. [Google Scholar] [CrossRef]
- Dimkpa, C.; Weinand, T.; Asch, F. Plant–rhizobacteria interactions alleviate abiotic stress conditions. Plant Cell Environ. 2009, 32, 1682–1694. [Google Scholar] [CrossRef] [PubMed]
- Mishra, J.; Singh, R.; Arora, N.K. Alleviation of heavy metal stress in plants and remediation of soil by rhizosphere microorganisms. Front. Microbiol. 2017, 8, 1706. [Google Scholar] [CrossRef] [PubMed]
- Ullah, A.; Heng, S.; Munis, M.F.H.; Fahad, S.; Yang, X. Phytoremediation of heavy metals assisted by plant growth promoting (PGP) bacteria: A review. Environ. Exp. Bot. 2015, 117, 28–40. [Google Scholar] [CrossRef]
- Gómez-Sagasti, M.T.; Marino, D. PGPRs and nitrogen-fixing legumes: A perfect team for efficient Cd phytoremediation. Front. Plant Sci. 2015, 6, 81. [Google Scholar] [CrossRef]
- Benidire, L.; Pereira, S.I.; Castro, P.M.; Boularbah, A. Assessment of plant growth promoting bacterial populations in the rhizosphere of metallophytes from the Kettara mine, Marrakech. Environ. Sci. Pollut. Res. Int. 2016, 23, 21751–21765. [Google Scholar] [CrossRef]
- Pérez-Montaño, F.; Alías-Villegas, C.; Bellogín, R.A.; del Cerro, P.; Espuny, M.R.; Jiménez-Guerrero, I.; López-Baena, F.J.; Ollero, F.J.; Cubo, T. Plant growth promotion in cereal and leguminous agricultural important plants: From microorganism capacities to crop production. Microbiol. Res. 2014, 169, 325–336. [Google Scholar] [CrossRef] [Green Version]
- Sánchez-Pardo, B.; Zornoza, P. Mitigation of Cu stress by legume–Rhizobium symbiosis in white lupin and soybean plants. Ecotoxicol. Environ. Saf. 2014, 102, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Navarro-Torre, S.; Barcia-Piedras, J.M.; Caviedes, M.A.; Pajuelo, E.; Redondo-Gómez, S.; Rodríguez-Llorente, I.D.; Mateos-Naranjo, E. Bioaugmentation with bacteria selected from the microbiome enhances Arthrocnemum macrostachyum metal accumulation and tolerance. Mar. Pollut. Bull. 2017, 117, 340–347. [Google Scholar] [CrossRef] [PubMed]
- Peng, J.F.; Song, Y.H.; Yuan, P.; Cui, X.Y.; Qiu, G.L. The remediation of heavy metals contaminated sediment. J. Hazard. Mater. 2009, 161, 633–640. [Google Scholar] [CrossRef] [PubMed]
- Roane, T.M.; Pepper, I.L.; Gentry, T.J. Microorganisms and metal pollutants. In Environmental Microbiology, 3rd ed.; Pepper, I.L., Gerba, C.P., Gentry, T.J., Eds.; Academic Press: Cambridge, MA, USA, 2015. [Google Scholar]
- Meier, S.; Borie, F.; Bolan, N.; Cornejo, P. Phytoremediation of Metal-Polluted Soils by Arbuscular Mycorrhizal Fungi. Crit. Rev. Environ. Sci. Technol. 2012, 42, 741–775. [Google Scholar] [CrossRef]
- Dalvi, A.A.; Bhalerao, S.A. Response of plants towards heavy metal toxicity: An overview of avoidance, tolerance and uptake mechanism. Ann. Plant Sci. 2013, 2, 362–368. [Google Scholar]
- Emamverdian, A.; Ding, Y.; Mokhberdoran, F.; Xie, Y. Heavy metal stress and some mechanisms of plant defense response. Sci. World J. 2015, 2015, 756120. [Google Scholar] [CrossRef] [PubMed]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef]
- Paredes-Páliz, K.; Rodríguez-Vázquez, R.; Duarte, B.; Caviedes, M.A.; Mateos-Naranjo, E.; Redondo-Gómez, S.; Caçador, M.I.; Rodríguez-Llorente, I.D.; Pajuelo, E. Investigating the mechanisms underlying phytoprotection by plant growth-promoting rhizobacteria in Spartina densiflora under metal stress. Plant Biol. 2018, 20, 497–506. [Google Scholar] [CrossRef]
- Hall, J.J. Cellular mechanisms for heavy metal detoxification and tolerance. J. Exp. Bot. 2002, 53, 1–11. [Google Scholar] [CrossRef]
- Hossain, M.A.; Piyatida, P.; da Silva, J.A.T.; Fujita, M. Molecular mechanism of heavy metal toxicity and tolerance in plants: Central role of glutathione in detoxification of reactive oxygen species and methylglyoxal and in heavy metal chelation. J. Bot. 2012, 1–37. [Google Scholar] [CrossRef]
- Choudhury, F.K.; Rivero, R.M.; Blumwald, E.; Mittler, R. Reactive oxygen species, abiotic stress and stress combination. Plant J. 2016, 90, 856–867. [Google Scholar] [CrossRef] [PubMed]
- Shri, M.; Kumar, S.; Chakrabarty, D.; Trivedi, P.K.; Mallick, S.; Misra, P.; Shukla, D.; Mishra, S.; Srivastava, S.; Tripathi, R.D.; et al. Effect of arsenic on growth, oxidative stress, and antioxidant system in rice seedlings. Ecotoxicol. Environ. Saf. 2009, 72, 1102–1110. [Google Scholar] [CrossRef] [PubMed]
- Lafuente, A.; Pérez-Palacios, P.; Doukkali, B.; Molina-Sánchez, M.D.; Jiménez-Zurdo, J.I.; Caviedes, M.A.; Rodríguez-Llorente, I.D.; Pajuelo, E. Unraveling the effect of arsenic on the model Medicago-Ensifer interaction: A transcriptomic meta-analysis. New Phytol. 2015, 205, 255–272. [Google Scholar] [CrossRef] [PubMed]
- El Alaoui, A. Potentiel des Bactéries et des Plantes dans la Réhabilitation des Sols Pollués par des Rejets Miniers de Draa Sfar et Kettara. Ph.D. Thesis, Faculty of Sciences Semlalia, Cadi Ayyad Univesity, Marrakech, Morocco, 2018; 182p. (In French). [Google Scholar]
- Vincent, J.M. A Manual for the Practical Study of Root Nodule Bacteria. In IBP (International Biological Programme); Handbook No. 15; Blackwell Scientific: Oxford, UK, 1970. [Google Scholar]
- Von Caemmerer, S.; Farquhar, G.D. Some relationships between the biochemistry of photosynthesis and the gas exchange of leaves. Planta 1981, 153, 376–387. [Google Scholar] [CrossRef] [PubMed]
- Redondo-Gómez, S.; Mateos-Naranjo, E.; Figueroa-Clemente, M.E.; Davy, A.J. Salt stimulation of growth and photosynthesis in an extreme halophyte, Arthrocnemum macrostachyum. Plant Biol. 2010, 12, 79–87. [Google Scholar] [CrossRef] [PubMed]
- Duarte, B.; Goessling, J.W.; Marques, J.C.; Caçador, I. Ecophysiological constraints of Aster tripolium under extreme thermal event impacts: Merging biophysical, biochemical and genetic insights. Plant Physiol. Biochem. 2015, 97, 217–228. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Palacios, P.; Agostini, E.; Ibáñez, S.G.; Talano, M.A.; Rodríguez-Llorente, I.G.; Caviedes, M.A.; Pajuelo, E. Removal of copper from aqueous solutions by rhizofiltration using genetically modified hairy roots expressing a bacterial Cu-binding protein. Environ. Technol. 2017, 38, 2877–2888. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Broughton, W.J.; Dilworth, M.J. Control of leghaemoglobin synthesis in snake beans. Biochem. J. 1971, 125, 1075–1080. [Google Scholar] [CrossRef] [Green Version]
- Tiwari, M.; Sharma, D.; Dwivedi, S.; Singh, M.; Tripathi, R.D.; Trivedi, P.K. Expression in Arabidopsis and cellular localization reveal involvement of rice NRAMP, OsNRAMP1, in arsenic transport and tolerance. Plant Cell Environ. 2014, 37, 140–152. [Google Scholar] [CrossRef]
- Takahashi, R.; Ishimaru, Y.; Senoura, T.; Shimo, H.; Ishikawa, S.; Arao, T.; Nakanishi, H.; Nishizawa, N.K. The OsNRAMP1 iron transporter is involved in Cd accumulation in rice. J. Exp. Bot. 2011, 62, 4843–4850. [Google Scholar] [CrossRef] [PubMed]
- Cobbett, C.; Goldsbrough, P. Phytochelatins and metallothioneins: Roles in heavy metal detoxification and homeostasis. Ann. Rev. Plant Biol. 2002, 53, 159–182. [Google Scholar] [CrossRef] [PubMed]
- Tripathi, R.D.; Tripathi, P.; Dwivedi, S.; Dubey, S.; Chatterjee, S.; Chakrabarty, D.; Trivedi, P.K. Arsenomics: Omics of arsenic metabolism in plants. Front. Physiol. 2012, 3, 275. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Wang, X.-Y.; Guo, W.-Z. The cytochrome P450 superfamily: Key players in plant development and defense. J. Integr. Agric. 2015, 14, 1673–1686. [Google Scholar] [CrossRef] [Green Version]
- Kováčik, J.; Grúz, J.; Klejdus, B.; Štork, F.; Marchiosi, R.; Ferrarese-Filho, O. Lignification and related parameters in copper-exposed Matricaria chamomilla roots: Role of H2O2 and NO in this process. Plant Sci. 2010, 179, 383–389. [Google Scholar] [CrossRef]
- Pawlak-Sprada, S.; Stobiecki, M.; Deckert, J. Activation of phenylpropanoid pathway in legume plants exposed to heavy metals. Part II. Profiling of isoflavonoids and their glycoconjugates induced in roots of lupine (Lupinus luteus) seedlings treated with cadmium and lead. Acta Biochim. Pol. 2011, 58, 217–223. [Google Scholar] [CrossRef] [PubMed]
- Steffens, B. The role of ethylene and ROS in salinity, heavy metal, and flooding responses in rice. Front. Plant Sci. 2014, 5, 685. [Google Scholar] [CrossRef]
- Mendez, M.O.; Maier, R.M. Phytostabilization of mine tailings in arid and semiarid environments. An emerging remediation technology. Environ. Health Perspect. 2008, 116, 278–283. [Google Scholar] [CrossRef]
- Pajuelo, E.; Rodríguez-Llorente, I.D.; Dary, M.; Palomares, A.J. Toxic effects of arsenic on Sinorhizobium-Medicago sativa symbiotic interaction. Environ. Pollut. 2008, 154, 203–211. [Google Scholar] [CrossRef]
- Peralta, J.R.; Gardea-Torresdey, J.L.; Tiemann, K.J.; Gomez, E.; Arteaga, S.; Rascon, E.; Parsons, J.G. Uptake and effects of five heavy metals on seed germination and plant growth in alfalfa (Medicago sativa L.). Bull. Environ. Contam. Toxicol. 2001, 66, 727–734. [Google Scholar] [CrossRef]
- Pádua, M.; Cavaco, A.M.; Aubert, S.; Bligny, R.; Casimiro, A. Effects of copper on the photosynthesis of intact chloroplasts: Interaction with manganese. Physiol. Plant. 2010, 138, 301–311. [Google Scholar] [CrossRef] [PubMed]
- Dong, J.; Wu, F.-B.; Zhang, G.-P. Effect of cadmium on growth and photosynthesis of tomato seedlings. J. Zhejiang Univ. Sci. B 2005, 6, 974–980. [Google Scholar] [CrossRef] [PubMed]
- Mesnoua, M.; Mateos-Naranjo, E.; Pérez-Romero, J.A.; Barcia-Piedras, J.M.; Lotmani, B.; Redondo-Gómez, S. Combined effect of Cr-toxicity and temperature rise on physiological and biochemical responses of Atriplex halimus L. Plant Physiol. Biochem. 2018, 132, 675–682. [Google Scholar] [CrossRef] [PubMed]
- Odoh, C.K.; Eze, C.N.; Apki, U.K.; Unah, V.U. Plant growth promoting rhizobacteria (PGPR): A novel agent for sustainable food production. Am. J. Agric. Biol. Sci. 2019, 14, 35–54. [Google Scholar] [CrossRef]
- Glick, B.R. Bacteria with ACC deaminase can promote plant growth and help to feed the world. Microbiol. Res. 2014, 169, 30–39. [Google Scholar] [CrossRef] [PubMed]
- Goswami, D.; Thakker, J.N.; Dhandhukia, P.C. Portraying mechanics of plant growth promoting rhizobacteria (PGPR): A review. Cogent Food Agric. 2016, 2, 1127500. [Google Scholar] [CrossRef]
- Yang, J.; Kloepper, J.W.; Ryu, C. Rhizosphere bacteria help plants to tolerate abiotic stress. Trends Plant Sci. 2009, 14, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Egamberdieva, D.; Kucharova, Z. Selection for root colonising bacteria stimulating wheat growth in saline soils. Biol. Fertil. Soils 2009, 45, 563–571. [Google Scholar] [CrossRef]
- Navarro-Torre, S.; Barcia-Piedras, J.M.; Mateos-Naranjo, E.; Redondo-Gómez, S.; Camacho, M.; Caviedes, M.A.; Pajuelo, E.; Rodríguez-Llorente, I.D. Assessing the role of endophytic bacteria in the halophyte Arthrocnemum macrostachyum salt tolerance. Plant Biol. 2017, 19, 249–256. [Google Scholar] [CrossRef]
- Dubey, S.; Shri, M.; Misra, P.; Lakhwani, D.; Bag, S.K.; Asif, M.H.; Trivedi, P.K.; Tripathi, R.D.; Chakrabarty, D. Heavy metals induce oxidative stress and genome-wide modulation in transcriptome of rice root. Funct. Integr. Genom. 2014, 4, 401–417. [Google Scholar] [CrossRef]
- Chen, T.; Duan, L.; Zhou, B.; Yu, H.; Zhu, H.; Cao, Y.; Zhang, Z. Interplay of Pathogen-induced defense responses and symbiotic establishment in Medicago truncatula. Front. Microbiol. 2017, 8, 973. [Google Scholar] [CrossRef] [PubMed]
- Zipfel, C.; Oldroyd, G.E. Plant signalling in symbiosis and immunity. Nature 2017, 543, 328–336. [Google Scholar] [CrossRef] [PubMed]
- Paredes-Páliz, K.I.; Mateos-Naranjo, E.; Doukkali, B.; Caviedes, M.A.; Redondo-Gómez, S.; Rodríguez-Llorente, I.D.; Pajuelo, E. Modulation of Spartina densiflora plant growth and metal accumulation upon selective inoculation treatments: Comparison of gram-negative and gram-positive rhizobacteria. Mar. Pollut. Bull. 2017, 125, 77–85. [Google Scholar] [CrossRef] [PubMed]
- Leigh, J.A.; Signer, E.R.; Walker, G.C. Exopolysaccharide-deficient mutants of Rhizobium meliloti that form ineffective nodules. Proc. Natl. Acad. Sci. USA 1985, 82, 6231–6235. [Google Scholar] [CrossRef] [PubMed]
- Kawaharada, Y.; Kelly, S.; Nielsen, M.W.; Hjuler, C.T.; Gysel, K.; Muszynski, A.; Carlson, R.W.; Thygesen, M.B.; Sandal, N.; Asmussen, M.H.; et al. Receptor-mediated exopolysaccharide perception controls bacterial infection. Nature 2015, 523, 308–312. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marczak, M.; Mazur, A.; Koper, P.; Żebracki, K.; Skorupska, A. Synthesis of rhizobial exopolysaccharides and their importance for symbiosis with legume plants. Genes 2017, 8, 360. [Google Scholar] [CrossRef] [PubMed]
- Volesky, B. Biosorption and me. Water Res. 2007, 41, 4017–4029. [Google Scholar] [CrossRef]
- Ayangbenro, A.S.; Babalola, O.O. A New Strategy for Heavy Metal Polluted Environments: A Review of Microbial Biosorbents. Int. J. Environ. Res. Public Health 2017, 14, E94. [Google Scholar] [CrossRef]
- Krishnan, H.B.; Lorio, J.; Kim, W.S.; Jiang, G.; Kim, K.Y.; DeBoer, M.; Pueppke, S.G. Extracellular proteins involved in soybean cultivar-specific nodulation are associated with pilus-like surface appendages and exported by a type III protein secretion system in Sinorhizobium fredii USDA257. Mol. Plant-Microbe Interact. 2003, 16, 617–625. [Google Scholar] [CrossRef]
- Deakin, W.J.; Broughton, W.J. Symbiotic use of pathogenic strategies: Rhizobial protein secretion systems. Nat. Rev. Microbiol. 2009, 7, 312–320. [Google Scholar] [CrossRef]
- Okazaki, S.; Kaneko, T.; Sato, S.; Saeki, K. Hijacking of leguminous nodulation signaling by the rhizobial type III secretion system. Proc. Natl. Acad. Sci. USA 2013, 110, 17131–17136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Puhar, A.; Sansonetti, P.J. Type III secretion system. Curr. Biol. 2014, 24, R784–R791. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Name | Tm | Primer Sequence 5’-3’ | Expected Band Size | Amplification |
---|---|---|---|---|---|
His1 | Histone 1 | 63 °C | FW:5’AGACCACCAAGTACTACTGCAC 3’ RV:5’ ATACCAGCCCTCAAACCACCA 3’ | 150 bp | Positive |
GR | Glutathione reductase | 63 °C | FW:5’ GTGCTTCGTGGATGTGTTCCAAAG 3’ RV:5’ GTGCTCCAGTCATGCTTCGGATCAG 3’ | 121 bp | Positive |
NRAMP1 | Natural resistance-associated macrophage proteins transporters | 57 °C | FW:5’ GTTATGCCGCACAATCTTTTC 3’ RV:5’ AGAGCCAATCCTCTTTCTCTATC 3’ | 119 bp | Positive |
PS | Phtochelatin synthase | 56 °C | FW:5’ TTTCAAGTATCCTCCTCACTGGGTTC 3’ RV:5’ TTCATCTTTACARCTCACAGTAT 3’ | 154 pb | Positive |
CP450 | Cytochrome P450 | 56 °C | FW:5’AAAGAAGTGTTGAGGCTGCA 3’ RV:5’ ATAGCCCACATGTTGACCAT 3’ | 128 pb | Positive |
PAL | Phenylalanine ammonia lyase | 66 °C | FW:5’ GAAGGTGGACGCCGCCGAGGC 3’ RV:5’ GAGCCCACGGAGGTGCCAT 3’ | 108 pb | Negative |
ETR | Ethylene receptor | 56 °C | FW:5’ GVTGTTGCTCTTCTCATGC 3’ RV:5’ TGATTCATGACAGCYAGAAAATC 3’ | 116 pb | Negative |
CHS4 | Chalcone synthase | 59 °C | FW:5’ TCAGCTCAAGATGGATTGAAGA 3’ RV: 5’ GCCAATTAACACACCCCATT 3’ | - | Negative |
LYSM | Receptor of nod factor | 48 °C | FW:5’ TCTAGTCAACTCCAGCATGGTC 3’ RV:5’ CCTTGGAGAAACAACAGTAGTAGACTC 3’ | - | Negative |
ENOD2 | Early nodulin 2 | 64 °C | FW:5’ CGACCACATGTGCATCCACCGGCC 3’ RV:5’ CGGGTTTCTCATGAGGTGGTTGG 3’ | - | Negative |
SAMPLE | TISSUE | Ca (g/100g) | K (g/100g) | Mg (g/100g) | Na (g/100g) | P (g/100g) | S (g/100g) |
---|---|---|---|---|---|---|---|
C-B | SHOOT | 2.03 ± 0.03 | 2.58 ± 0.04 | 0.29 ± 0.01 | 0.07 ± 0.01 | 0.20 ± 0.03 | 0.63 ± 0.04 |
ROOT | 0.19 ± 0.02 | 1.34 ± 0.02 | 0.16 ± 0.02 | 0.06 ± 0.01 | 0.23 ± 0.02 | 0.23 ± 0.02 | |
LMC-B | SHOOT | 1.38 ± 0.02 | 2.69 ± 0.02 | 0.36 ± 0.03 | 0.12 ± 0.02 | 0.22 ± 0.02 | 0.48 ± 0.02 |
ROOT | 0.59 ± 0.01 | 3.39 ± 0.05 | 0.36 ± 0.01 | 0.16 ± 0.02 | 0.40 ± 0.03 | 0.58 ± 0.05 | |
HMC-B | SHOOT | 1.94 ± 0.02 | 2.42 ± 0.01 | 0.33 ± 0.02 | 0.07 ± 0.01 | 0.19 ± 0.01 | 0.57 ± 0.03 |
ROOT | 0.37 ± 0.03 | 1.73 ± 0.02 | 0.34 ± 0.02 | 0.15 ± 0.02 | 0.27 ± 0.03 | 0.44 ± 0.02 | |
C+B | SHOOT | 1.37 ± 0.02 | 2.09 ± 0.01 | 0.22 ± 0.02 | 0.13 ± 0.02 | 0.55 ± 0.03 | 0.38 ± 0.01 |
ROOT | 0.30 ± 0.01 | 0.95 ± 0.02 | 0.22 ± 0.01 | 0.39 ± 0.03 | 0.49 ± 0.04 | 0.22 ± 0.04 | |
LMC+B | SHOOT | 1.33 ± 0.02 | 2.59 ± 0.03 | 0.34 ± 0.02 | 0.51 ± 0.02 | 0.33 ± 0.02 | 0.41 ± 0.02 |
ROOT | 0.21 ± 0.02 | 1.70 ± 0.02 | 0.17 ± 0.01 | 0.32 ± 0.03 | 0.47 ± 0.01 | 0.24 ± 0.03 | |
LMC+B | SHOOT | 2.00 ± 0.03 | 4.00 ± 0.02 | 0.45 ± 0.03 | 0.42 ± 0.04 | 0.45 ± 0.02 | 0.64 ± 0.03 |
ROOT | 0.28 ± 0.02 | 1.88 ± 0.01 | 0.21 ± 0.02 | 0.38 ± 0.01 | 0.57 ± 0.03 | 0.31 ± 0.04 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Raklami, A.; Oufdou, K.; Tahiri, A.-I.; Mateos-Naranjo, E.; Navarro-Torre, S.; Rodríguez-Llorente, I.D.; Meddich, A.; Redondo-Gómez, S.; Pajuelo, E. Safe Cultivation of Medicago sativa in Metal-Polluted Soils from Semi-Arid Regions Assisted by Heat- and Metallo-Resistant PGPR. Microorganisms 2019, 7, 212. https://doi.org/10.3390/microorganisms7070212
Raklami A, Oufdou K, Tahiri A-I, Mateos-Naranjo E, Navarro-Torre S, Rodríguez-Llorente ID, Meddich A, Redondo-Gómez S, Pajuelo E. Safe Cultivation of Medicago sativa in Metal-Polluted Soils from Semi-Arid Regions Assisted by Heat- and Metallo-Resistant PGPR. Microorganisms. 2019; 7(7):212. https://doi.org/10.3390/microorganisms7070212
Chicago/Turabian StyleRaklami, Anas, Khalid Oufdou, Abdel-Ilah Tahiri, Enrique Mateos-Naranjo, Salvadora Navarro-Torre, Ignacio D. Rodríguez-Llorente, Abdelilah Meddich, Susana Redondo-Gómez, and Eloísa Pajuelo. 2019. "Safe Cultivation of Medicago sativa in Metal-Polluted Soils from Semi-Arid Regions Assisted by Heat- and Metallo-Resistant PGPR" Microorganisms 7, no. 7: 212. https://doi.org/10.3390/microorganisms7070212