Establishment and Preliminary Application of a Multiplex TaqMan Real-Time Fluorescence Quantitative PCR Assay for the Detection of Pneumocystis Species
Abstract
1. Introduction
2. Materials and Methods
2.1. Standard Strains, DNA and Test Samples
2.2. Primer and Probe Design and Synthesis
2.3. Synthesis of Plasmid Standards
2.4. Optimization of Single-Plex qPCR Reaction System and Conditions
2.5. Establishment of the Multiplex qPCR System
2.6. Establishment of Standard Curves
2.7. Specificity Tests
2.8. Sensitivity Tests
2.9. Repeatability Tests
2.10. Assessment of Extraction Efficiency and qPCR Inhibition (Spike-In Experiment)
2.11. Sample Detection
2.12. Sequencing Verification
2.13. Statistical Analysis
3. Results
3.1. Optimization Results of the Single-Plex qPCR Reaction System and Conditions
3.2. Establishment of the Multiplex qPCR Reaction System
3.3. Multiplex qPCR Standard Curves
3.4. Specificity Test Results
3.5. Sensitivity Test Results
3.6. Repeatability Test Results
3.7. Spike-In Experiment Results
3.8. Sample Detection Results
3.9. Sequencing Verification Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Keely, S.P.; Fischer, J.M.; Cushion, M.T.; Stringer, J.R. Phylogenetic identification of Pneumocystis murina sp. nov., a new species in laboratory mice. Microbiology 2004, 150, 1153–1165. [Google Scholar] [CrossRef] [Scilit]
- Stringer, J.R.; Beard, C.B.; Miller, R.F.; Cushion, M.T. A new name (Pneumocystis jiroveci) for Pneumocystis from humans. Emerg. Infect. Dis. 2002, 8, 891–896. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shiota, T.; Yamada, M.; Yoshida, Y. Morphology, development and behavior of Pneumocystis carinii observed by light-microscopy in nude mice. Zentralbl Bakteriol. Mikrobiol. Hyg. A 1986, 262, 230–239. [Google Scholar] [CrossRef] [Scilit]
- Atzori, C.; Aliouat, E.M.; Bartlett, M.S.; Dujardin, L.; Cargnel, A.; Dei-Cas, E. Current in vitro culture systems for Pneumocystis. FEMS Immunol. Med. Microbiol. 1998, 22, 169–172. [Google Scholar] [CrossRef]
- Vera, C.; Rueda, Z.V. Transmission and Colonization of Pneumocystis jirovecii. J. Fungi 2021, 7, 979. [Google Scholar] [CrossRef] [Scilit]
- Eddens, T.; Kolls, J.K. Pathological and protective immunity to Pneumocystis infection. Semin. Immunopathol. 2015, 37, 153–162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, L.; Cattamanchi, A.; Davis, J.L.; den Boon, S.; Kovacs, J.; Meshnick, S.; Miller, R.F.; Walzer, P.D.; Worodria, W.; Masur, H. HIV-associated Pneumocystis pneumonia. Proc. Am. Thorac. Soc. 2011, 8, 294–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tasaka, S. Pneumocystis Pneumonia in Human Immunodeficiency Virus-infected Adults and Adolescents: Current Concepts and Future Directions. Clin. Med. Insights Circ. Respir. Pulm. Med. 2015, 9, 19–28. [Google Scholar]
- Ortiz, B.; Muñoz-Tabora, J.; Aguilar, K.; Fontecha, G.; Matamoros, G.; Pineda-Garcia, L.; Alvarez-Corrales, N.; Palomares-Marín, J.; Cueto-Aragón, C.L.; de Armas, Y.; et al. Past Achievements, Present Gaps, and Future Priorities in Pneumocystis jirovecii Research: A Global Bibliometric Analysis. Pathogens 2026, 15, 530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roths, J.B.; Marshall, J.D.; Allen, R.D.; Carlson, G.A.; Sidman, C.L. Spontaneous Pneumocystis carinii pneumonia in immunodeficient mutant scid mice. Natural history and pathobiology. Am. J. Pathol. 1990, 136, 1173–1186. [Google Scholar]
- Magne, F.; Ruiz-Ruiz, S.; Pérez-Brocal, V.; Ponce, C.A.; Bustamante, R.; Martin, V.S.; Gutierrez, M.; Gatti, G.; Vargas, S.L.; Moya, A. Pneumocystis jirovecii is a potential pivotal ecological driver contributing to shifts in microbial equilibrium during the early-life lower airway microbiome assembly. Commun. Biol. 2025, 8, 609. [Google Scholar] [CrossRef] [Scilit]
- de la Horra, C.; Varela, J.M.; Fernández-Alonso, J.; Medrano, F.J.; Respaldiza, N.; Montes-Cano, M.A.; Calderón, E.J. Association between human-Pneumocystis infection and small-cell lung carcinoma. Eur. J. Clin. Investig. 2004, 34, 229–235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deckman, J.M.; Kurkjian, C.J.; McGillis, J.P.; Cory, T.J.; Birket, S.E.; Schutzman, L.M.; Murphy, B.S.; Garvy, B.A.; Feola, D.J. Pneumocystis infection alters the activation state of pulmonary macrophages. Immunobiology 2017, 222, 188–197. [Google Scholar] [CrossRef] [Scilit]
- Chesnay, A.; Paget, C.; Heuzé-Vourc’h, N.; Baranek, T.; Desoubeaux, G. Pneumocystis Pneumonia: Pitfalls and Hindrances to Establishing a Reliable Animal Model. J. Fungi 2022, 8, 129. [Google Scholar] [CrossRef] [Scilit]
- Atochina, E.N.; Beck, J.M.; Preston, A.M.; Haczku, A.; Tomer, Y.; Scanlon, S.T.; Fusaro, T.; Casey, J.; Hawgood, S.; Gow, A.J.; et al. Enhanced lung injury and delayed clearance of Pneumocystis carinii in surfactant protein A-deficient mice: Attenuation of cytokine responses and reactive oxygen-nitrogen species. Infect. Immun. 2004, 72, 6002–6011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Özer, E.; Eröksüz, Y.; Eröksüz, H.; Saki, C.E. Activation of Pneumocystis carinii Infections in Experimentally Immunosupressed Laborotory Mice. Turk. J. Vet. Anim. Sci. 1996, 20, 175–180. [Google Scholar] [CrossRef] [Scilit]
- Dai, G.; Wanek, A.; Eddens, T.; Volden, P.; Kolls, J.K. Toward a humanized mouse model of Pneumocystis pneumonia. JCI Insight 2021, 6, e139573. [Google Scholar] [CrossRef] [Scilit]
- GB/T 18448.4-2001; Laboratory Animal-Method for Examination of Pneumocystis carinii. General Administration of Quality Supervision, Inspection and Quarantine: Beijing, China; China Standard Press: Beijing, China, 2001.
- Hoving, J.C.; Munyonho, F.T.; Kolls, J.K. Genetic Mouse Models of Pneumocystis Pneumonia. Methods Mol. Biol. 2023, 2667, 169–179. [Google Scholar] [PubMed]
- Edman, U.; Edman, J.C.; Lundgren, B.; Santi, D.V. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene. Proc. Natl. Acad. Sci. USA 1989, 86, 6503–6507. [Google Scholar]
- Guegan, H.; Robert-Gangneux, F. Molecular diagnosis of Pneumocystis pneumonia in immunocompromised patients. Curr. Opin. Infect. Dis. 2019, 32, 314–321. [Google Scholar] [CrossRef] [Scilit]
- Su, Y.; Meng, L.; Wang, J.; Zhao, Y.; Zheng, N. Simultaneous Detection of Eight Dairy-Derived Components Using Double-Tube Multiplex qPCR Based TaqMan Probe. Foods 2024, 13, 3213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sánchez, I.; Dashti, A.; Köster, P.C.; Bailo, B.; González, N.; Allende, J.; Stensvold, C.R.; Carmena, D.; González-Barrio, D. Development, Optimisation and Validation of a Novel Multiplex Real-Time PCR Method for the Simultaneous Detection of Cryptosporidium spp., Giardia duodenalis and Dientamoeba fragilis. Pathogens 2022, 11, 1277. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Liu, R.; Liu, H.; Chen, J.; Li, X.; Zhang, J.; Zhou, B. Development of a Multiplex Quantitative PCR for Detecting Porcine Epidemic Diarrhea Virus, Transmissible Gastroenteritis Virus, and Porcine Deltacoronavirus Simultaneously in China. Vet. Sci. 2023, 10, 402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lim, H.J.; Ahn, S.; No, J.H.; Park, M.Y.; Kim, M.J.; Sohn, Y.H.; Shin, K.S.; Park, J.E.; Yang, Y.J. Development of a Multiplex Real-Time PCR Assay for the Simultaneous Detection of Two Fungal Pathogens Causing Pneumonia. J. Fungi 2024, 10, 619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gago, S.; Esteban, C.; Valero, C.; Zaragoza, O.; Puig de la Bellacasa, J.; Buitrago, M.J. A multiplex real-time PCR assay for identification of Pneumocystis jirovecii, Histoplasma capsulatum, and Cryptococcus neoformans/Cryptococcus gattii in samples from AIDS patients with opportunistic pneumonia. J. Clin. Microbiol. 2014, 52, 1168–1176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schröder, H.M.; Niebergall-Roth, E.; Norrick, A.; Esterlechner, J.; Ganss, C.; Frank, M.H.; Kluth, M.A. Drug Regulatory-Compliant Validation of a qPCR Assay for Bioanalysis Studies of a Cell Therapy Product with a Special Focus on Matrix Interferences in a Wide Range of Organ Tissues. Cells 2023, 12, 1788. [Google Scholar] [CrossRef] [Scilit]
- Babb-Biernacki, S.J.; Esselstyn, J.A.; Doyle, V.P. Predicting Species Boundaries and Assessing Undescribed Diversity in Pneumocystis, an Obligate Lung Symbiont. J. Fungi 2022, 8, 799. [Google Scholar] [CrossRef] [Scilit]
- Linke, M.J.; Ashbaugh, A.D.; Demland, J.A.; Walzer, P.D. Pneumocystis murina colonization in immunocompetent surfactant protein A deficient mice following environmental exposure. Respir. Res. 2009, 10, 10. [Google Scholar] [CrossRef] [Scilit]
- Pounds, K.; Wall, L.A. CRISPR-Mediated Detection of Pneumocystis Transcripts in Bronchoalveolar, Oropharyngeal, and Serum Specimens for Pneumocystis Pneumonia Diagnosis. Pediatrics 2025, 156, S61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mazars, E.; Odberg-Ferragut, C.; Dei-Cas, E.; Fourmaux, M.; Aliouat, E.M.; Brun-Pascaud, M.; Mougeot, G.; Camus, D. Polymorphism of the thymidylate synthase gene of Pneumocystis carinii from different host species. J. Eukaryot. Microbiol. 1995, 42, 26–32. [Google Scholar] [CrossRef] [Scilit]
- Guillot, J.; Demanche, C.; Hugot, J.P.; Berthelemy, M.; Wakefield, A.E.; Dei-Cas, E.; Chermette, R. Parallel phylogenies of Pneumocystis species and their mammalian hosts. J. Eukaryot. Microbiol. 2001, 48, 113s–115s. [Google Scholar] [CrossRef] [Scilit]
- Dellière, S.; Gits-Muselli, M.; White, P.L.; Mengoli, C.; Bretagne, S.; Alanio, A. Quantification of Pneumocystis jirovecii: Cross-Platform Comparison of One qPCR Assay with Leading Platforms and Six Master Mixes. J. Fungi 2019, 6, 9. [Google Scholar] [CrossRef] [Scilit]
- Latinne, A.; Bezé, F.; Delhaes, L.; Pottier, M.; Gantois, N.; Nguyen, J.; Blasdell, K.; Dei-Cas, E.; Morand, S.; Chabé, M. Genetic diversity and evolution of Pneumocystis fungi infecting wild Southeast Asian murid rodents. Parasitology 2018, 145, 885–900. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, L.G.; Ai, L.; Chu, Y.H.; Wu, X.P.; Cai, Y.C.; Chen, Z.; Chen, S.H.; Chen, J.X. Establishment of animal model for Pneumocystis carinii and study on etiological and molecular biological detection technology. Zhongguo Xue Xi Chong Bing Fang Zhi Za Zhi 2015, 27, 162–185. [Google Scholar]
- Weisbroth, S.H.; Geistfeld, J.; Weisbroth, S.P.; Williams, B.; Feldman, S.H.; Linke, M.J.; Orr, S.; Cushion, M.T. Latent Pneumocystis carinii infection in commercial rat colonies: Comparison of inductive immunosuppressants plus histopathology, PCR, and serology as detection methods. J. Clin. Microbiol. 1999, 37, 1441–1446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kilic, A.; Elliott, S.; Hester, L.; Palavecino, E. Evaluation of the performance of DiaSorin molecular Pneumocystis jirovecii-CMV multiplex real-time PCR assay from bronchoalveolar lavage samples. J. Mycol. Med. 2020, 30, 100936. [Google Scholar] [CrossRef] [Scilit]
- Bustin, S.A.; Ruijter, J.M.; van den Hoff, M.J.B.; Kubista, M.; Pfaffl, M.W.; Shipley, G.L.; Tran, N.; Rödiger, S.; Untergasser, A.; Mueller, R.; et al. MIQE 2.0: Revision of the Minimum Information for Publication of Quantitative Real-Time PCR Experiments Guidelines. Clin. Chem. 2025, 71, 634–651. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Scilit]
- National Health Commission of the People’s Republic of China. Human Pathogenic Microorganism Catalog; National Health Commission of the People’s Republic of China: Beijing, China, 2023.
- Centers for Disease Control and Prevention; National Institutes of Health. Biosafety in Microbiological and Biomedical Laboratories, 6th ed.; HHS Publication No. (CDC) 300859; U.S. Department of Health and Human Services: Washington, DC, USA, 2020.
- World Medical Association. World Medical Association Declaration of Helsinki. Ethical principles for medical research involving human subjects. Nurs. Ethics. 2002, 9, 105–109. [Google Scholar]
- Gits-Muselli, M.; White, P.L.; Mengoli, C.; Chen, S.; Crowley, B.; Dingemans, G.; Fréalle, E.; Gorton, R.L.; Guiver, M.; Hagen, F.; et al. The Fungal PCR Initiative’s evaluation of in-house and commercial Pneumocystis jirovecii qPCR assays: Toward a standard for a diagnostics assay. Med. Mycol. 2020, 58, 779–788. [Google Scholar] [CrossRef] [Scilit]
- Le Gal, S.; Robert-Gangneux, F.; Pépino, Y.; Belaz, S.; Damiani, C.; Guéguen, P.; Pitous, M.; Virmaux, M.; Lissillour, E.; Pougnet, L.; et al. A misleading false-negative result of Pneumocystis real-time PCR assay due to a rare punctual mutation: A French multicenter study. Med. Mycol. 2017, 55, 180–184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alanio, A.; Gits-Muselli, M.; Mercier-Delarue, S.; Dromer, F.; Bretagne, S. Diversity of Pneumocystis jirovecii during Infection Revealed by Ultra-Deep Pyrosequencing. Front. Microbiol. 2016, 7, 733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, L.; Weissenbacher-Lang, C.; Latinne, A.; Babb-Biernacki, S.; Blasi, B.; Cissé, O.H.; Kovacs, J.A. Evolving spectrum of Pneumocystis host specificity, genetic diversity, and evolution. FEMS Microbiol. Rev. 2025, 49, fuaf006. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Linssen, C.F.M.; Jacobs, J.A.; Beckers, P.; Templeton, K.E.; Bakkers, J.; Kuijper, E.J.; Melchers, W.J.G.; Drent, M.; Vink, C. Inter-laboratory comparison of three different real-time PCR assays for the detection of Pneumocystis jiroveci in bronchoalveolar lavage fluid samples. J. Med. Microbiol. 2006, 55, 1229–1235. [Google Scholar] [CrossRef] [Scilit]





| Primers and Probes | Sequences (5′-3′) | Product Length/bp | Gene and Position |
|---|---|---|---|
| P.m-MT-F | GAACGAATACCTAGCATGTATTGTG | 140 | mtLSUrRNA NC_020332.1 (2768–5511) |
| P.m-MT-R | TGCAGAGTCTGTAGCTTAAAGTAAA | ||
| P.m-MT-P | VIC-TCACATTGAAGGATGCCCTCTCGCAGG-BHQ1 | ||
| P.c-TS-F | GGATCATATTGAAGCACTACAACAA | 83 | TS XM018371599.1 |
| P.c-TS-R | CAGTGATTGAGCGATTTAAAGAAAG | ||
| P.c-TS-P | CY5-TTACACGCTCCCCACGACCTTTTCCCA-BHQ2 | ||
| P.j-mt-F | GACGTGCTGCAAAATTTTCTACAA | 128 | mtSSUrRNA NC_020331.1 (31,755–33,198) |
| P.j-mt-R | GACGATTACTAGCAATTCCAACTTC | ||
| P.j-mt-P | FAM-AAGAGCCGAGTTCCAGGCACTTATCCG-BHQ1 |
| Stage | Group | Template Composition | Spike-In (Copies/μL) | Purpose |
|---|---|---|---|---|
| DNA extraction | A | 200 μL negative lung homogenate/BALF | None | Background control |
| B | 180 μL negative lung homogenate/BALF + 20 μL plasmid | 103 | Extraction recovery monitoring | |
| C | 180 μL sterile PBS + 20 μL plasmid | 103 | Ideal recovery control | |
| D | 200 μL nuclease-free water | None | Extraction blank | |
| qPCR | E | 2 μL extract from Group A + 1 μL plasmid | 103 | Matrix inhibition assessment |
| F | 2 μL nuclease-free water + 1 μL plasmid | 103 | Baseline control for inhibition | |
| G | 2 μL extract from Groups B and C | None | Extraction recovery determination | |
| H | 2 μL nuclease-free water | None | No-template control | |
| I | 2 μL extract from Group A | None | Matrix negative control | |
| J | 2 μL extract from Group D | None | Full-process blank control |
| Plasmid | Concentration (Copies/μL) | Multiplex qPCR Sensitivity Test | Single-Plex qPCR Sensitivity Test | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Mean ± SD | CV (%) | Detection Rate (%) | 95% CI | Mean ± SD | CV (%) | Detection Rate (%) | 95% CI | ||
| P.m-MT | 10 | 34.322 ± 0.441 | 1.283 | 100% (22/22) | (84.6%, 100%) | 33.176 ± 0.715 | 2.155 | 100% (22/22) | (84.6%, 100%) |
| 8 | 34.611 ± 0.701 | 2.025 | 100% (22/22) | (84.6%, 100%) | 33.465 ± 0.842 | 2.516 | 100% (22/22) | (84.6%, 100%) | |
| 6 | 34.653 ± 0.359 | 1.036 | 100% (22/22) | (84.6%, 100%) | 33.705 ± 0.641 | 1.902 | 100% (22/22) | (84.6%, 100%) | |
| 5 | 35.150 ± 0.478 | 1.358 | 100% (22/22) | (84.6%, 100%) | 33.916 ± 0.715 | 2.108 | 100% (22/22) | (84.6%, 100%) | |
| 1 | 37.050 ± 0.803 | 2.167 | 50% (11/22) | (28.4%, 71.6%) | 36.294 ± 0.854 | 2.353 | 95.5% (21/22) | (73.5%, 99.9%) | |
| P.c-TS | 10 | 33.052 ± 0.462 | 1.396 | 100% (22/22) | (84.6%, 100%) | 34.443 ± 0.861 | 2.500 | 100% (22/22) | (84.6%, 100%) |
| 8 | 33.564 ± 0.670 | 1.995 | 100% (22/22) | (84.6%, 100%) | 34.207 ± 0.740 | 2.163 | 100% (22/22) | (84.6%, 100%) | |
| 6 | 33.994 ± 0.590 | 1.734 | 95.5% (21/22) | (73.5%, 99.9%) | 34.660 ± 0.881 | 2.542 | 100% (22/22) | (84.6%, 100%) | |
| 5 | 34.190 ± 0.734 | 2.147 | 86.7% (19/22) | (63.2%, 95.1%) | 34.720 ± 0.854 | 2.460 | 100% (22/22) | (84.6%, 100%) | |
| 1 | 35.823 ± 0.772 | 2.154 | 31.8% (7/22) | (16.0%, 55.2%) | 35.176 ± 0.603 | 1.714 | 90.9% (20/22) | (68.5%, 96.5%) | |
| P.j-mt | 10 | 34.546 ± 0.543 | 1.570 | 100% (22/22) | (84.6%, 100%) | 33.599 ± 0.550 | 1.637 | 100% (22/22) | (84.6%, 100%) |
| 8 | 34.484 ± 0.568 | 1.647 | 100% (22/22) | (84.6%, 100%) | 34.084 ± 0.767 | 2.250 | 100% (22/22) | (84.6%, 100%) | |
| 6 | 35.277 ± 0.627 | 1.777 | 90.9% (20/22) | (68.5%, 96.5%) | 34.581 ± 0.696 | 2.013 | 100% (22/22) | (84.6%, 100%) | |
| 5 | 35.392 ± 0.634 | 1.791 | 90.9% (20/22) | (68.5%. 96.5%) | 34.370 ± 0.780 | 2.269 | 95.5% (21/22) | (73.5%, 99.9%) | |
| 1 | 36.696 ± 0.835 | 2.275 | 63.6% (14/22) | (40.8%, 82.2%) | 35.667 ± 0.665 | 1.864 | 50% (11/22) | (28.4%, 71.6%) | |
| Plasmid | Concentration (Copies/μL) | Intra-Group Repeatability Test | Inter-Group Repeatability Test | ||
|---|---|---|---|---|---|
| Mean ± SD | CV/% | Mean ± SD | CV/% | ||
| Pm-MT | 1 × 103 | 26.059 ± 0.046 | 0.18 | 26.142 ± 0.083 | 0.32 |
| 1 × 105 | 19.259 ± 0.050 | 0.26 | 19.337 ± 0.042 | 0.22 | |
| 1 × 107 | 12.476 ± 0.051 | 0.41 | 12.620 ± 0.055 | 0.43 | |
| Pc-TS | 1 × 103 | 27.004 ± 0.022 | 0.08 | 27.172 ± 0.055 | 0.20 |
| 1 × 105 | 19.741 ± 0.051 | 0.26 | 20.082 ± 0.052 | 0.26 | |
| 1 × 107 | 12.851 ± 0.068 | 0.53 | 13.223 ± 0.072 | 0.54 | |
| Pj-mt | 1 × 103 | 26.836 ± 0.031 | 0.12 | 26.734 ± 0.049 | 0.18 |
| 1 × 105 | 19.319 ± 0.041 | 0.21 | 19.513 ± 0.034 | 0.17 | |
| 1 × 107 | 11.778 ± 0.092 | 0.78 | 12.505 ± 0.086 | 0.69 | |
| Multiplex qPCR Result | Single-Plex qPCR Result | No. of Samples | Concordance Rate |
|---|---|---|---|
| Mice-Positive | Mice-Positive | 30 | 100% |
| Mice-Negative | Mice-Negative | 260 | 100% |
| Rat-Positive | Rat-Positive | 8 | 100% |
| Rat-Negative | Rat-Negative | 31 | 100% |
| Staining Method | Samples Tested (n) | Positive Detected (n) | Detection Rate (%) | Missed Detection Rate (%) |
|---|---|---|---|---|
| Giemsa | 38 | 0 | 0.0 | 100.0 |
| Toluidine Blue | 5 | 3 | 60.0 | 40.0 |
| Sample Group | Total Samples (N) | Detection Method | No. of Samples Tested | Positive Detected (n) | Detection Rate (%) | Negative Detected (n) | Reason for Not Testing |
|---|---|---|---|---|---|---|---|
| Background Colony Mice | 260 | Multiplex qPCR | 260 | 0 | 0.0 | 260 | N/A |
| Single-plex qPCR | 260 | 0 | 0.0 | 260 | N/A | ||
| Giemsa Staining | 68 | 0 | 0.0 | 68 | Time constraints (n = 192) | ||
| Toluidine Blue Staining | 0 | N/A | N/A | N/A | Not performed | ||
| P.murina Experimentally Infected Mice | 30 | Multiplex qPCR | 30 | 30 | 100.0 | 0 | N/A |
| Single-plex qPCR | 30 | 30 | 100.0 | 0 | N/A | ||
| Giemsa Staining | 30 | 0 | 0.0 | 30 | N/A | ||
| Toluidine Blue Staining | 5 | 3 | 60.0 | 2 | Sample limitation (n = 25) | ||
| P. carinii Experimentally Infected Rat | 8 | Multiplex qPCR | 8 | 8 | 100.0 | 0 | N/A |
| Single-plex qPCR | 8 | 8 | 100.0 | 0 | N/A | ||
| Giemsa Staining | 8 | 0 | 0.0 | 8 | N/A | ||
| Toluidine Blue Staining | 0 | N/A | N/A | N/A | Not performed |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Sun, Q.; Xie, Y.; Feng, Y.; Gao, Q.; Fu, R.; Xing, J. Establishment and Preliminary Application of a Multiplex TaqMan Real-Time Fluorescence Quantitative PCR Assay for the Detection of Pneumocystis Species. Microorganisms 2026, 14, 1308. https://doi.org/10.3390/microorganisms14061308
Sun Q, Xie Y, Feng Y, Gao Q, Fu R, Xing J. Establishment and Preliminary Application of a Multiplex TaqMan Real-Time Fluorescence Quantitative PCR Assay for the Detection of Pneumocystis Species. Microorganisms. 2026; 14(6):1308. https://doi.org/10.3390/microorganisms14061308
Chicago/Turabian StyleSun, Qiuyang, Yuanzhi Xie, Yufang Feng, Qiang Gao, Rui Fu, and Jin Xing. 2026. "Establishment and Preliminary Application of a Multiplex TaqMan Real-Time Fluorescence Quantitative PCR Assay for the Detection of Pneumocystis Species" Microorganisms 14, no. 6: 1308. https://doi.org/10.3390/microorganisms14061308
APA StyleSun, Q., Xie, Y., Feng, Y., Gao, Q., Fu, R., & Xing, J. (2026). Establishment and Preliminary Application of a Multiplex TaqMan Real-Time Fluorescence Quantitative PCR Assay for the Detection of Pneumocystis Species. Microorganisms, 14(6), 1308. https://doi.org/10.3390/microorganisms14061308

