Engineering Saccharomyces cerevisiae for Surface Display of a Functional H5 Influenza Virus-Specific Nanobody
Abstract
1. Introduction
2. Materials and Methods
2.1. Gene Retrieval and Plasmid Construction
2.2. Yeast Transformation and Construction of Dual-Plasmid Display Strains
2.3. Indirect Elisa for Detection of Surface Display in Yeast Strains
2.4. Fluorescence Microscopy and Flow Cytometry Analysis of Yeast Surface Display
2.5. Hemagglutination Inhibition (Hi) Assay of Yeast-Displayed Nb10
3. Results
3.1. Construction of a Dual-Plasmid Yeast Surface Display System
3.2. Surface Display of Aga2-Egfp and Egfp-Aga2 Fusion Proteins in Yeast Strains
3.3. Construction of the Nb10-Based Yeast Surface Display Plasmid
3.4. Surface Display of Nb10 on Yeast Cells
3.5. Quantitative Analysis of Nb10 Surface Display and Hemagglutination Inhibition Activity
4. Discussion
5. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Shi, J.; Zeng, X.; Cui, P.; Yan, C.; Chen, H. Alarming Situation of Emerging H5 and H7 Avian Influenza and Effective Control Strategies. Emerg. Microbes Infect. 2023, 12, 2155072. [Google Scholar] [CrossRef] [Scilit]
- Cui, Y.; Li, Y.; Li, M.; Zhao, L.; Wang, D.; Tian, J.; Bai, X.; Ci, Y.; Wu, S.; Wang, F.; et al. Evolution and Extensive Reassortment of H5 Influenza Viruses Isolated from Wild Birds in China over the Past Decade. Emerg. Microbes Infect. 2020, 9, 1793–1803. [Google Scholar] [CrossRef] [Scilit]
- Huang, P.; Sun, L.; Li, J.; Wu, Q.; Rezaei, N.; Jiang, S.; Pan, C. Potential Cross-Species Transmission of Highly Pathogenic Avian Influenza H5 Subtype (HPAI H5) Viruses to Humans Calls for the Development of H5-Specific and Universal Influenza Vaccines. Cell Discov. 2023, 9, 58. [Google Scholar] [PubMed]
- Coughlan, L.; Palese, P. Overcoming Barriers in the Path to a Universal Influenza Virus Vaccine. Cell Host Microbe 2018, 24, 18–24. [Google Scholar] [CrossRef] [Scilit]
- Lang, S.; Xie, J.; Zhu, X.; Wu, N.C.; Lerner, R.A.; Wilson, I.A. Antibody 27F3 Broadly Targets Influenza a Group 1 and 2 Hemagglutinins through a Further Variation in V(H)1-69 Antibody Orientation on the HA Stem. Cell Rep. 2017, 20, 2935–2943. [Google Scholar]
- Muyldermans, S. Nanobodies: Natural Single-Domain Antibodies. Annu. Rev. Biochem. 2013, 82, 775–797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salvador, J.P.; Vilaplana, L.; Marco, M.P. Nanobody: Outstanding Features for Diagnostic and Therapeutic Applications. Anal. Bioanal. Chem. 2019, 411, 1703–1713. [Google Scholar] [CrossRef] [Scilit]
- Bakherad, H.; Ghasemi, F.; Hosseindokht, M.; Zare, H. Nanobodies; New Molecular Instruments with Special Specifications for Targeting, Diagnosis and Treatment of Triple-Negative Breast Cancer. Cancer Cell Int. 2022, 22, 245. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.H.; Pan, Y.C.; Lim, S.K.; Mou, C.Y.; Hu, C.J.; Mou, K.Y. Combinatorial Leaky Probiotic for Anticancer Immunopotentiation and Tumor Eradication. Cell Rep. Med. 2024, 5, 101793. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.C.; Li, X.Y.; Deng, Q.; Ge, Y.J.; Yi, R.R.; Wang, H.J.; Wang, J.T.; Zhou, H.; Kong, X.F.; Liu, R.J.; et al. Development of a CD39 Nanobody and Its Enhancement to Chimeric Antigen Receptor T Cells Efficacy against Ovarian Cancer in Preclinical Studies. Theranostics 2024, 14, 6249–6267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Liu, P.; Dong, H.; Dekker, A.; Harmsen, M.M.; Guo, H.; Wang, X.; Sun, S. Foot-and-Mouth Disease Virus Antigenic Landscape and Reduced Immunogenicity Elucidated in Atomic Detail. Nat. Commun. 2024, 15, 8774. [Google Scholar] [CrossRef] [Scilit]
- Hassanzadeh-Ghassabeh, G.; Devoogdt, N.; De Pauw, P.; Vincke, C.; Muyldermans, S. Nanobodies and Their Potential Applications. Nanomedicine 2013, 8, 1013–1026. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Zhan, W.; Yang, Z.; Tu, C.; Hu, G.; Zhang, X.; Song, W.; Du, S.; Zhu, Y.; Huang, K.; et al. Broad Neutralization of SARS-CoV-2 Variants by an Inhalable Bispecific Single-Domain Antibody. Cell 2022, 185, 1389–1401.e18. [Google Scholar] [CrossRef] [Scilit]
- Xu, S.; Liu, Y.; Luo, C.; Zhou, M.; Wang, K.; Xie, Q.; Zhang, Q.; Zhang, Q.; Li, Q.; Pan, Z.; et al. Identification and Characterization of a Broadly Neutralizing and Protective Nanobody against the HA1 Domain of H5 Avian Influenza Virus Hemagglutinin. J. Virol. 2025, 99, e0209024. [Google Scholar] [CrossRef] [Scilit]
- Gee, M.H.; Han, A.; Lofgren, S.M.; Beausang, J.F.; Mendoza, J.L.; Birnbaum, M.E.; Bethune, M.T.; Fischer, S.; Yang, X.; Gomez-Eerland, R.; et al. Antigen Identification for Orphan T Cell Receptors Expressed on Tumor-Infiltrating Lymphocytes. Cell 2018, 172, 549–563.e16. [Google Scholar] [CrossRef] [Scilit]
- Cherf, G.M.; Cochran, J.R. Applications of Yeast Surface Display for Protein Engineering. Methods Mol. Biol. 2015, 1319, 155–175. [Google Scholar]
- Simons, J.F.; Lim, Y.W.; Carter, K.P.; Wagner, E.K.; Wayham, N.; Adler, A.S.; Johnson, D.S. Affinity Maturation of Antibodies by Combinatorial Codon Mutagenesis Versus Error-Prone PCR. MAbs 2020, 12, 1803646. [Google Scholar] [CrossRef] [Scilit]
- Mahdavi, S.Z.B.; Oroojalian, F.; Eyvazi, S.; Hejazi, M.; Baradaran, B.; Pouladi, N.; Tohidkia, M.R.; Mokhtarzadeh, A.; Muyldermans, S. An Overview on Display Systems (Phage, Bacterial, and Yeast Display) for Production of Anticancer Antibodies; Advantages and Disadvantages. Int. J. Biol. Macromol. 2022, 208, 421–442. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Wang, X.; Zhou, N.Y.; Ding, J. Yeast Surface Display Technology: Mechanisms, Applications, and Perspectives. Biotechnol. Adv. 2024, 76, 108422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, T.F.; de Picciotto, S.; Hackel, B.J.; Wittrup, K.D. Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display. Methods Enzymol. 2013, 523, 303–326. [Google Scholar] [PubMed]
- Luo, B.; Jin, M.M.; Li, X.; Makunga, N.P.; Hu, X. Yeast Surface Display for in Vitro Biosynthetic Pathway Reconstruction. ACS Synth. Biol. 2021, 10, 2938–2946. [Google Scholar] [CrossRef] [Scilit]
- Sun, W.; Yang, Z.; Lin, H.; Liu, M.; Zhao, C.; Hou, X.; Hu, Z.; Cui, B. Improvement in Affinity and Thermostability of a Fully Human Antibody against Interleukin-17a by Yeast-Display Technology and CDR Grafting. Acta Pharm. Sin. B 2019, 9, 960–972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pepper, L.R.; Cho, Y.K.; Boder, E.T.; Shusta, E.V. A Decade of Yeast Surface Display Technology: Where Are We Now? Comb. Chem. High Throughput Screen. 2008, 11, 127–134. [Google Scholar] [CrossRef] [Scilit]
- Angelini, A.; Chen, T.F.; de Picciotto, S.; Yang, N.J.; Tzeng, A.; Santos, M.S.; Van Deventer, J.A.; Traxlmayr, M.W.; Wittrup, K.D. Protein Engineering and Selection Using Yeast Surface Display. Methods Mol. Biol. 2015, 1319, 3–36. [Google Scholar]
- Uchański, T.; Zögg, T.; Yin, J.; Yuan, D.; Wohlkönig, A.; Fischer, B.; Rosenbaum, D.M.; Kobilka, B.K.; Pardon, E.; Steyaert, J. An Improved Yeast Surface Display Platform for the Screening of Nanobody Immune Libraries. Sci. Rep. 2019, 9, 382. [Google Scholar] [CrossRef] [Scilit]
- VanAntwerp, J.J.; Wittrup, K.D. Fine Affinity Discrimination by Yeast Surface Display and Flow Cytometry. Biotechnol. Prog. 2000, 16, 31–37. [Google Scholar] [CrossRef] [Scilit]
- Chao, G.; Lau, W.L.; Hackel, B.J.; Sazinsky, S.L.; Lippow, S.M.; Wittrup, K.D. Isolating and Engineering Human Antibodies Using Yeast Surface Display. Nat. Protoc. 2006, 1, 755–768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuroda, K.; Ueda, M. Cell Surface Engineering of Yeast for Applications in White Biotechnology. Biotechnol. Lett. 2011, 33, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Dhakal, S.; Macreadie, I. The Use of Yeast in Biosensing. Microorganisms 2022, 10, 1772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, M. Surface Display Technology for Biosensor Applications: A Review. Sensors 2020, 20, 2775. [Google Scholar] [CrossRef] [Scilit]
- He, Y.; Xu, Z.; Kasputis, T.; Zhao, X.; Ibañez, I.; Pavan, F.; Bok, M.; Malito, J.P.; Parreno, V.; Yuan, L.; et al. Development of Nanobody-Displayed Whole-Cell Biosensors for the Colorimetric Detection of SARS-CoV-2. ACS Appl. Mater. Interfaces 2023, 15, 37184–37192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teymennet-Ramírez, K.V.; Martínez-Morales, F.; Trejo-Hernández, M.R. Yeast Surface Display System: Strategies for Improvement and Biotechnological Applications. Front. Bioeng. Biotechnol. 2021, 9, 794742. [Google Scholar] [CrossRef] [Scilit]
- Feldhaus, M.J.; Siegel, R.W.; Opresko, L.K.; Coleman, J.R.; Feldhaus, J.M.; Yeung, Y.A.; Cochran, J.R.; Heinzelman, P.; Colby, D.; Swers, J.; et al. Flow-Cytometric Isolation of Human Antibodies from a Nonimmune Saccharomyces cerevisiae Surface Display Library. Nat. Biotechnol. 2003, 21, 163–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Primer | Sequences (5′-3′) |
|---|---|
| AGA1-F | GAACCCTAAAGGGAGCCCCCGATTTAG |
| AGA1-R | GTCTCCCCGCGCGTTAGTGAATAG |
| AGA2-EGFP-fused-F | CTAGCAGCTGGAATATTAAGC |
| AGA2-EGFP-fused-R | TGTGCAATTGCGTAAACTCG |
| Nb10-AGA2-F | GCTTCAGTTTTAGCACAGGTTCAGTTACAAG |
| Nb10-AGA2-R | TCAGCGGGTTTAAACTCACGTAGAATCGAG |
| YSD2-AGA2-F | GTTTAAACCCGCTGATCTGATAACAAC |
| YSD2-AGA2-R | TGCTAAAACTGAAGCAATAACAG |
| Names | Relevant Characteristic(s) | Source |
|---|---|---|
| pYSD1-AGA1 | Yeast surface display vector expressing Aga1p as the cell wall anchor protein | General Biosystems |
| pYSD2-AGA2-EGFP | Yeast expression vector encoding a C-terminal EGFP fusion to Aga2p for display efficiency evaluation | General Biosystems |
| pYSD2-EGFP-AGA2 | Yeast expression vector encoding a N-terminal EGFP fusion to Aga2p for display efficiency evaluation | General Biosystems |
| pYSD2-Nb10 | Yeast expression vector encoding Nb10–Aga2p fusion for nanobody surface display | This research |
| Names | Relevant Characteristic(s) | Source |
|---|---|---|
| E. coli DH5α | deoR endA1 gyrA96 hsdR17 (rk-mk+) recA1 relA1 supE44 thi-1 Δ(lacZYA-argF) U169 Φ80lacZ ΔM15F-λ - | Vazyme |
| INVSc1 | MATa his3ΔLEU2 TRP1-289 URA3-52/MATα his3ΔLEU2 TRP1-289 URA3-52 | This research |
| INVSc1 pYSD1-AGA1 (YSD-AGA1) | Saccharomyces cerevisiae INVSc1 strain carrying pYSD1-AGA1 expression vector for surface display | This research |
| INVSc1 pYSD1-AGA1/ pYSD2-AGA2-EGFP (YSD-AGA2-EGFP) | Saccharomyces cerevisiae INVSc1 strain carrying pYSD1-AGA1 and pYSD2-AGA2-EGFP expression vector for surface display | This research |
| INVSc1 pYSD1-AGA1/ pYSD2-EGFP-AGA2 (YSD-EGFP-AGA2) | Saccharomyces cerevisiae INVSc1 strain carrying pYSD1-AGA1 and pYSD2-EGFP-AGA2 expression vector for surface display | This research |
| INVSc1 pYSD1-AGA1/ pYSD2-Nb10-AGA2 (YSD-Nb10) | Saccharomyces cerevisiae INVSc1 strain carrying pYSD1-AGA1 and pYSD2-Nb10-AGA2 expression vector for Nb10 surface display | This research |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Xu, S.; Xie, Q.; Xie, X.; Wei, X.; Liu, Y.; Zhu, J.; Li, Y.; Luo, C.; Liao, M.; Feng, S. Engineering Saccharomyces cerevisiae for Surface Display of a Functional H5 Influenza Virus-Specific Nanobody. Microorganisms 2026, 14, 1305. https://doi.org/10.3390/microorganisms14061305
Xu S, Xie Q, Xie X, Wei X, Liu Y, Zhu J, Li Y, Luo C, Liao M, Feng S. Engineering Saccharomyces cerevisiae for Surface Display of a Functional H5 Influenza Virus-Specific Nanobody. Microorganisms. 2026; 14(6):1305. https://doi.org/10.3390/microorganisms14061305
Chicago/Turabian StyleXu, Siqi, Qianmei Xie, Xueer Xie, Xiaomeng Wei, Yangjun Liu, Jiaqi Zhu, Yan Li, Chenying Luo, Ming Liao, and Saixiang Feng. 2026. "Engineering Saccharomyces cerevisiae for Surface Display of a Functional H5 Influenza Virus-Specific Nanobody" Microorganisms 14, no. 6: 1305. https://doi.org/10.3390/microorganisms14061305
APA StyleXu, S., Xie, Q., Xie, X., Wei, X., Liu, Y., Zhu, J., Li, Y., Luo, C., Liao, M., & Feng, S. (2026). Engineering Saccharomyces cerevisiae for Surface Display of a Functional H5 Influenza Virus-Specific Nanobody. Microorganisms, 14(6), 1305. https://doi.org/10.3390/microorganisms14061305

