Biofilm Formation, Virulence-Associated Genes, and Antimicrobial Resistance in Proteus mirabilis Isolates from Urinary Tract Infections in Iran
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Isolates
2.2. Biofilm Formation Assay
2.3. Antibiotic Susceptibility Testing
2.4. Phenotypic Screening of ESBL and ESCR
2.5. Detection of Virulence and Biofilm-Associated Genes
Detection of β-Lactamase Genes
2.6. ERIC-PCR Genotyping
2.7. Statistical Analysis
3. Results
3.1. Distribution of Isolates and Biofilm Formation
3.2. Antibiotic Susceptibility Patterns
3.3. Distribution of Virulence- and Biofilm-Associated Genes
3.4. β-Lactamase Gene Profiles
3.5. Genotypic Diversity of Isolates
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| UTI | Urinary Tract Infection |
| AMR | Antimicrobial Resistance |
| MDR | Multidrug-Resistant |
| MLST | Multilocus Sequence Typing |
| ESBL | Extended-Spectrum β-Lactamase |
| ESCR | Extended-Spectrum Cephalosporin Resistance |
| CA-UTI | Catheter-Associated UTIs |
| WGS | Whole-Genome Sequencing |
| PCR | Polymerase Chain Reaction |
| ERIC-PCR | Enterobacterial Repetitive Intergenic Consensus PCR |
| LB | Luria–Bertani |
| CFU | Colony-Forming Unit |
| OD | Optical Density |
| ODc | Optical density cut-off value |
| PBS | Phosphate-Buffered Saline |
| TSB | Tryptic Soy Broth |
| CLSI | Clinical and Laboratory Standards Institute |
| ATCC | American Type Culture Collection |
| MHA | Mueller–Hinton Agar |
| DNA | Deoxyribonucleic Acid |
| ureC | Urease C gene |
| ureR | Urease Regulator gene |
| rsmA | Regulatory small RNA gene |
| hmpA | Hemophore-like protein gene |
| mrpA | Mating-pair formation protein A gene |
| mrpH | Mating-pair formation protein H gene |
| pmfA | Proteus mirabilis fimbriae gene |
| atfA | Adhesion and invasion protein gene |
| uca | Uropathogenic-associated adhesin gene |
| pta | Phosphotransferase gene |
| luxS | Quorum sensing gen |
| rsbA | Response regulator gene |
| zapA | ZAP-associated protein gene |
| zapD | ZAP-associated protein gene |
| acrA | Acridine resistance gene |
| acrB | Acridine resistance gene |
| hlyA | Hemolysin gene |
| blaTEM | Gene encoding TEM β-lactamase |
| blaCTX-M-2 | Gene encoding CTX-M-2 β-lactamase |
| blaKPC | Gene encoding KPC β-lactamase |
| blaCTX-M-9 | Gene encoding CTX-M-9 β-lactamas |
| blaOXA-1-like | Gene encoding OXA-1-like β-lactamase |
| blaSHV | Gene encoding SHV β-lactamase |
| blaGES | Gene encoding GES β-lactamase |
| blaPER | Gene encoding PER β-lactamase |
References
- Mancuso, G.; Midiri, A.; Gerace, E.; Marra, M.; Zummo, S.; Biondo, C. Urinary Tract Infections: The Current Scenario and Future Prospects. Pathogens 2023, 12, 623. [Google Scholar] [CrossRef] [Scilit]
- Flores-Mireles, A.L.; Walker, J.N.; Caparon, M.; Hultgren, S.J. Urinary Tract Infections: Epidemiology, Mechanisms of Infection and Treatment Options. Nat. Rev. Microbiol. 2015, 13, 269–284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmed, S.K.; Hussein, S.; Qurbani, K.; Ibrahim, R.H.; Fareeq, A.; Mahmood, K.A.; Mohamed, M.G. Antimicrobial Resistance: Impacts, Challenges, and Future Prospects. J. Med. Surg. Public Health 2024, 2, 100081. [Google Scholar] [CrossRef] [Scilit]
- Bitew, G.; Dagnew, M.; Dereje, M.; Birhanu, A.; Gashaw, Y.; Ambachew, A.; Tessema, B. Burden of Multi-Drug Resistant Bacterial Isolates and Its Associated Risk Factors Among UTI-Confirmed Geriatrics in Gondar Town. Sci. Rep. 2025, 15, 14270. [Google Scholar] [CrossRef] [Scilit]
- Schaffer, J.N.; Pearson, M.M. Proteus mirabilis and Urinary Tract Infections. Urin. Tract Infect. Mol. Pathog. Clin. Manag. 2017, 3, 383–433. [Google Scholar] [CrossRef] [Scilit]
- Armbruster, C.E.; Mobley, H.L.; Pearson, M.M. Pathogenesis of Proteus mirabilis infection. EcoSal Plus 2018, 8, 1–73. [Google Scholar] [CrossRef] [Scilit]
- Pareek, A.; Pant, M.; Gupta, M.M.; Kashania, P.; Ratan, Y.; Jain, V.; Chuturgoon, A.A. Moringa Oleifera: An Updated Comprehensive Review of Its Pharmacological Activities, Ethnomedicinal, Phytopharmaceutical Formulation, Clinical, Phytochemical, and Toxicological Aspects. Int. J. Mol. Sci. 2023, 24, 2098. [Google Scholar] [CrossRef] [Scilit]
- Sharma, S.; Mohler, J.; Mahajan, S.D.; Schwartz, S.A.; Bruggemann, L.; Aalinkeel, R. Microbial Biofilm: A Review on Formation, Infection, Antibiotic Resistance, Control Measures, and Innovative Treatment. Microorganisms 2023, 11, 1614, Correction in Microorganisms 2024, 12, 1961. https://doi.org/10.3390/microorganisms12101961. [Google Scholar] [CrossRef] [Scilit]
- Wasfi, R.; Hamed, S.M.; Amer, M.A.; Fahmy, L.I. Proteus mirabilis Biofilm: Development and Therapeutic Strategies. Front. Cell. Infect. Microbiol. 2020, 10, 414. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, F.; Huang, Z.; Yang, T.; Wang, G.; Li, P.; Yang, B.; Li, J. Pathogenesis of Proteus mirabilis in Catheter-Associated Urinary Tract Infections. Urol. Int. 2021, 105, 354–361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hussen, N.H.; Hamid, S.J.; Sabir, M.N.; Hasan, A.H.; Mohammed, S.J.; Shali, A.A.K. Novel Penicillin Derivatives Against Selected Multiple-Drug Resistant Bacterial Strains: Design, Synthesis, Structural Analysis, In Silico and In Vitro Studies. Curr. Org. Synth. 2024, 21, 684–703. [Google Scholar] [CrossRef] [Scilit]
- Abdulhameed, S.R.; Hussen, N.H.; Aziz, T.A.; Salh, H.J.H. Methoxy and Thiophene Chalcone Derivatives Against Multidrug-resistant Bacteria: Synthesis, in Vitro Evaluation, and Molecular Docking Insights. Chem. Biodivers. 2025, 22, e02016. [Google Scholar] [CrossRef] [Scilit]
- Chakkour, M.; Hammoud, Z.; Farhat, S.; El Roz, A.; Ezzeddine, Z.; Ghssein, G. Overview of Proteus mirabilis Pathogenicity and Virulence. Insights into the Role of Metals. Front. Microbiol. 2024, 15, 1383618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gmiter, D.; Kaca, W. Into the Understanding the Multicellular Lifestyle of Proteus mirabilis on Solid Surfaces. Front. Cell. Infect. Microbiol. 2022, 12, 864305. [Google Scholar] [CrossRef] [Scilit]
- Mirzaei, A.; Habibi, M.; Bouzari, S.; Asadi Karam, M.R. Characterization of Antibiotic-Susceptibility Patterns, Virulence Factor Profiles and Clonal Relatedness in Proteus mirabilis Isolates from Patients with Urinary Tract Infection in Iran. Infect. Drug Resist. 2019, 12, 3967–3979. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qu, X.; Zhou, J.; Huang, H.; Wang, W.; Xiao, Y.; Tang, B.; Xiao, X. Genomic Investigation of Proteus mirabilis Isolates Recovered from Pig Farms in Zhejiang Province, China. Front. Microbiol. 2022, 13, 952982. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soliman, S.; Abdalla, S.; Zedan, A.; Enany, S. Genomic Profiling of Pan-Drug Resistant Proteus mirabilis Isolates Reveals Antimicrobial Resistance and Virulence Gene Landscape. Funct. Integr. Genom. 2024, 24, 154. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.; Niu, Z.; Yin, K.; Liu, P.; Chen, L. Quick Identification and Quantification of Proteus mirabilis by Polymerase Chain Reaction (PCR) Assays. Ann. Microbiol. 2013, 63, 683–689. [Google Scholar] [CrossRef] [Scilit]
- Ali, H.H.; Yousif, M.G. Detection of some virulence factors genes of Proteus mirablis that isolated from urinary tract infection. Int. J. Adv. Res. 2015, 3, 156–163. [Google Scholar]
- Qasemi, A.; Rahimi, F.; Katouli, M. Clonal Groups of Extended-Spectrum β-Lactamase and Biofilm Producing Uropathogenic Escherichia coli in Iran. Pathog. Glob. Health 2022, 116, 485–497. [Google Scholar] [CrossRef] [Scilit]
- Rocha, S.P.; Elias, W.P.; Cianciarullo, A.M.; Menezes, M.A.; Nara, J.M.; Piazza, R.M.; Pelayo, J.S. Aggregative adherence of uropathogenic Proteus mirabilis to cultured epithelial cells. FEMS Immunol. Med. Microbiol. 2007, 51, 319–326. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.; Wen, S.; Zhao, L.; Xia, Q.; Pan, Y.; Liu, H.; Wang, H. Association among biofilm formation, virulence gene expression, and antibiotic resistance in Proteus mirabilis isolates from diarrhetic animals in Northeast China. BMC Vet. Res. 2020, 16, 176. [Google Scholar] [CrossRef] [Scilit]
- Filipiak, A.; Chrapek, M.; Literacka, E.; Wawszczak, M.; Głuszek, S.; Majchrzak, M.; Adamus-Białek, W. Pathogenic factors correlate with antimicrobial resistance among clinical Proteus mirabilis strains. Front. Microbiol. 2020, 11, 579389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zunino, P.; Geymonat, L.; Allen, A.G.; Legnani-Fajardo, C.; Maskell, D.J. Virulence of a Proteus mirabilis ATF isogenic mutant is not impaired in a mouse model of ascending urinary tract infection. FEMS Immunol. Med. Microbiol. 2000, 29, 137–143. [Google Scholar] [CrossRef] [PubMed]
- Sanches, M.S.; Baptista, A.A.S.; de Souza, M.; Menck-Costa, M.F.; Koga, V.L.; Kobayashi, R.K.T.; Rocha, S.P.D. Genotypic and phenotypic profiles of virulence factors and antimicrobial resistance of Proteus mirabilis isolated from chicken carcasses: Potential zoonotic risk. Braz. J. Microbiol. 2019, 50, 685–694. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cestari, S.E.; Ludovico, M.S.; Martins, F.H.; da Rocha, S.P.D.; Elias, W.P.; Pelayo, J.S. Molecular detection of HpmA and HlyA hemolysin of uropathogenic Proteus mirabilis. Curr. Microbiol. 2013, 67, 703–707. [Google Scholar] [CrossRef] [Scilit]
- Abbas, K.F.; Jawad, K.; Khafaji, A.L.; Maysaa, S.; Shukri, A.L. Molecular detection of some virulence genes in Proteus mirabilis isolated from Hillaprovince. Int. J. Res. Stud. Biosci. 2015, 3, 85–89. [Google Scholar]
- Viveiros, M.; Dupont, M.; Rodrigues, L.; Couto, I.; Davin-Regli, A.; Martins, M.; Amaral, L. Antibiotic stress, genetic response and altered permeability of E. coli. PLoS ONE 2007, 2, e365. [Google Scholar] [CrossRef] [Scilit]
- Srinivasan, R.; Vigneshwari, L.; Rajavel, T.; Durgadevi, R.; Kannappan, A.; Balamurugan, K.; Veera Ravi, A. Biogenic Synthesis of Silver Nanoparticles Using Piper Betle Aqueous Extract and Evaluation of Its Anti-Quorum Sensing and Antibiofilm Potential against Uropathogens with Cytotoxic Effects: An in Vitro and in Vivo Approach. Environ. Sci. Pollut. Res. 2018, 25, 10538–10554. [Google Scholar] [CrossRef] [Scilit]
- Aniba, R.; Dihmane, A.; Raqraq, H.; Ressmi, A.; Nayme, K.; Timinouni, M.; Hicham, B.B.; Khalil, A.; Barguigua, A. Characterization of Biofilm Formation in Uropathogenic Staphylococcus aureus and Their Association with Antibiotic Resistance. Microbe 2024, 2, 100029. [Google Scholar] [CrossRef] [Scilit]
- CLSI M100 ED30; Performance Standards for Antimicrobial Susceptibility Testing. CLSI: Wayne, PA, USA, 2020.
- Shakya, P.; Shrestha, D.; Maharjan, E.; Sharma, V.K.; Paudyal, R. ESBL Production among Escherichia Coli and Klebsiella spp. Causing Urinary Tract Infection: A Hospital Based Study. Open Microbiol. J. 2017, 11, 23–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Howery, K.E.; Clemmer, K.M.; Rather, P.N. The Rcs Regulon in Proteus mirabilis: Implications for Motility, Biofilm Formation, and Virulence. Curr. Genet. 2016, 62, 775–789. [Google Scholar] [CrossRef] [Scilit]
- Dimude, J. CTX-M β-Lactamases and Associated Integrons: Their Dissemination in Gram-Negative Bacteria. Ph.D. Thesis, Brunel University London, Uxbridge, UK, 2013. [Google Scholar]
- Oliveira, W.D.; Barboza, M.G.L.; Faustino, G.; Inagaki, W.T.Y.; Sanches, M.S.; Kobayashi, R.K.T.; Rocha, S.P.D. Virulence, Resistance and Clonality of Proteus mirabilis Isolated from Patients with Community-Acquired Urinary Tract Infection (CA-UTI) in Brazil. Microb. Pathog. 2021, 152, 104642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tabatabaei, A.; Ahmadi, K.; Shabestari, A.N.; Khosravi, N.; Badamchi, A. Virulence Genes and Antimicrobial Resistance Pattern in Proteus mirabilis Strains Isolated from Patients Attended with Urinary Infections to Tertiary Hospitals, in Iran. Afr. Health Sci. 2021, 21, 1677–1684. [Google Scholar] [CrossRef] [Scilit]
- Agarwal, H.; Gurnani, B.; Pippal, B.; Jain, N. Capturing the Micro-Communities: Insights into Biogenesis and Architecture of Bacterial Biofilms. BBA Adv. 2025, 7, 100133. [Google Scholar] [CrossRef] [Scilit]
- Armbruster, C.E.; Mobley, H.L. Merging Mythology and Morphology: The Multifaceted Lifestyle of Proteus mirabilis. Nat. Rev. Microbiol. 2012, 10, 743–754. [Google Scholar] [CrossRef] [Scilit]
- Mancuso, G.; Trinchera, M.; Midiri, A.; Zummo, S.; Vitale, G.; Biondo, C. Novel Antimicrobial Approaches to Combat Bacterial Biofilms Associated with Urinary Tract Infections. Antibiotics 2024, 13, 154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alqurashi, E.; Elbanna, K.; Ahmad, I.; Abulreesh, H.H. Antibiotic Resistance in Proteus mirabilis: Mechanism, Status, and Public Health Significance. J. Pure Appl. Microbiol. 2022, 16, 1550–1561. [Google Scholar] [CrossRef] [Scilit]
- Masseron, A.; Poirel, L.; Ali, B.J.; Syed, M.A.; Nordmann, P. Molecular Characterization of Multidrug-Resistance in Gram-Negative Bacteria from the Peshawar Teaching Hospital, Pakistan. New Microbes New Infect. 2019, 32, 100605. [Google Scholar] [CrossRef] [Scilit]
- Mehta, A.; Mungi, V.; Jain, S. Prevalence and Antimicrobial Susceptibility Profile of Clinical Isolates of Citrobacter spp. at a Tertiary Care Hospital in Madhya Pradesh. J. Res. Appl. Basic Med. Sci. 2024, 10, 285–290. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Yin, M.; Fang, C.; Fu, Y.; Dai, X.; Zeng, W.; Zhang, L. Genetic Analysis of Resistance and Virulence Characteristics of Clinical Multidrug-Resistant Proteus mirabilis Isolates. Front. Cell. Infect. Microbiol. 2023, 13, 1229194. [Google Scholar] [CrossRef] [Scilit]
- Bahr, G.; Gonzalez, L.J.; Vila, A.J. Metallo-β-Lactamases in the Age of Multidrug Resistance: From Structure and Mechanism to Evolution, Dissemination, and Inhibitor Design. Chem. Rev. 2021, 121, 7957–8094. [Google Scholar] [CrossRef] [Scilit]
- Fritzenwanker, M.; Falgenhauer, J.; Hain, T.; Imirzalioglu, C.; Chakraborty, T.; Yao, Y. The Detection of Extensively Drug-Resistant Proteus mirabilis Strains Harboring Both VIM-4 and VIM-75 Metallo-β-Lactamases from Patients in Germany. Microorganisms 2025, 13, 266. [Google Scholar] [CrossRef] [Scilit]
- Castanheira, M.; Simner, P.J.; Bradford, P.A. Extended-Spectrum β-Lactamases: An Update on Their Characteristics, Epidemiology and Detection. JAC-Antimicrob. Resist. 2021, 3, 092. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abou-assy, R.S.; Aly, M.M.; Amashah, R.H.; Jastaniah, S.D.; Al Deen, H.M. Epidemiology of Carbapenem Resistance Enterobacterales in Saudi Arabia: A Systematic Review. J. Contemp. Med. Sci. 2022, 8, 18–26. [Google Scholar] [CrossRef] [Scilit]
- Hafiz, T.A.; Alghamdi, G.S.; Alkudmani, Z.S.; Alyami, A.S.; AlMazyed, A.; Alhumaidan, O.S.; Mubaraki, M.; Alotaibi, F.E. Multidrug-Resistant Proteus mirabilis Infections and Clinical Outcome at Tertiary Hospital in Riyadh, Saudi Arabia. Infect. Drug Resist. 2024, 17, 571–581. [Google Scholar] [CrossRef] [Scilit]
- Hassuna, N.A.; Kotb, D.N.; Lami, M.; Abdelrahim, S.S. Characterization of Antimicrobial Resistance among Proteus mirabilis Isolates from Catheter-Associated Urinary Tract Infections and Non-Catheter-Associated Urinary Tract Infections in Egypt. BMC Infect. Dis. 2025, 25, 767. [Google Scholar] [CrossRef] [Scilit]
- Hunt, B.C.; Brix, V.; Vath, J.; Guterman, L.B.; Taddei, S.M.; Deka, N.; Learman, B.S.; Brauer, A.L.; Shen, S.; Qu, J.; et al. Metabolic Interplay between Proteus mirabilis and Enterococcus faecalis Facilitates Polymicrobial Biofilm Formation and Invasive Disease. mBio 2024, 15, e02164-24. [Google Scholar] [CrossRef] [Scilit]
- Elhoshi, M.; El-Sherbiny, E.; Elsheredy, A.; Aboulela, A.G. A Correlation Study between Virulence Factors and Multidrug Resistance among Clinical Isolates of Proteus mirabilis. Braz. J. Microbiol. 2023, 54, 1387–1397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gurkok, S.; Ozdal, M.; Cakici, T.; Kurbanoglu, E.B. Antimicrobial, Antibiofilm, and Antiurease Activities of Green-Synthesized Zn, Se, and ZnSe Nanoparticles against Streptococcus Salivarius and Proteus mirabilis. Bioprocess Biosyst. Eng. 2025, 48, 589–603. [Google Scholar] [CrossRef] [Scilit]
- Salama, L.A.; Saleh, H.H.; Abdel-Rhman, S.H.; Barwa, R.; Hassan, R. Assessment of Typing Methods, Virulence Genes Profile and Antimicrobial Susceptibility for Clinical Isolates of Proteus mirabilis. Ann. Clin. Microbiol. Antimicrob. 2025, 24, 4. [Google Scholar] [CrossRef] [Scilit]
- Sun, L.; Xu, J.; He, F. Genomic Characterisation of a Proteus mirabilis Clinical Isolate from China Carrying blaNDM-5 on an IncX3 Plasmid. J. Glob. Antimicrob. Resist. 2019, 19, 317–319. [Google Scholar] [CrossRef] [Scilit]



| Primer Name | Gene Encoded for | Sequence (5 > 3) | Amplicon Size (bp) | Reference |
|---|---|---|---|---|
| ureC | Urease | F: GTTATTCGTGATGGTATGGG | 533 | [19] |
| R: ATAAAGGTGGTTACGCCAGA | ||||
| ureR | F: GGTGAGATTTGTATTAATGG | 225 | [18] | |
| R: ATAATCTGGAAGATGACGAG | ||||
| Multiplex I TEM, SHV, and OXA-1-like | TEM variants, including TEM-1 and TEM-2 | CATTTCCGTGTCGCCCTTATTC | 800 | [20] |
| CGTTCATCCATAGTTGCCTGAC | ||||
| SHV variants, including SHV-1 | AGCCGCTTGAGCAAATTAAAC | 713 | ||
| ATCCCGCAGATAAATCACCAC | ||||
| OXA-1, OXA-4 and OXA-30 | GGCACCAGATTCAACTTTCAAG | 564 | ||
| GACCCCAAGTTTCCTGTAAGTG | ||||
| Multiplex II CTX-M group 1, group 2, and group 9 | variants of the CTX-M group 1, including CTX-M-1, CTX-M-3, and CTX-M-15 | TTAGGAARTGTGCCGCTGYA | 688 | |
| CGATATCGTTGGTGGTRCCAT | ||||
| variants of the CTX-M group 2, including CTX-M-2 | CGTTAACGGCACGATGAC | 404 | ||
| CGATATCGTTGGTGGTRCCAT | ||||
| variants of the CTX-M group 9, including CTX-M-9 and CTX-M-14 | TCAAGCCTGCCGATCTGGT | 561 | ||
| TGATTCTCGCCGCTGAAG | ||||
| CTX-M group 8/25 | CTX-M-8, CTX-M-25, CTX-M-26 and CTX-M-39 to CTX-M-41 | AACRCRCAGACGCTCTAC | 326 | |
| TCGAGCCGGAASGTGTYAT | ||||
| Multiplex III ACC, FOX, MOX, DHA, CIT, and EBC | ACC-1 and ACC-2 | CACCTCCAGCGACTTGTTAC | 346 | |
| GTTAGCCAGCATCACGATCC | ||||
| FOX-1 to FOX-5 | CTACAGTGCGGGTGGTTT | 162 | ||
| CTATTTGCGGCCAGGTGA | ||||
| MOX-1, MOX-2, CMY-1, CMY-8 to CMY-11 and CMY-19 | GCAACAACGACAATCCATCCT | 895 | ||
| GGGATAGGCGTAACTCTCCCAA | ||||
| DHA-1 and DHA-2 | TGATGGCACAGCAGGATATTC | 997 | ||
| GCTTTGACTCTTTCGGTATTCG | ||||
| LAT-1 to LAT-3, BIL-1, CMY-2 to CMY-7, CMY-12 to CMY-18 and CMY-21 to CMY-23 | CGAAGAGGCAATGACCAGAC | 538 | ||
| ACGGACAGGGTTAGGATAGY | ||||
| ACT-1 and MIR-1 | CGGTAAAGCCGATGTTGCG | 683 | ||
| AGCCTAACCCCTGATACA | ||||
| Multiplex IV VEB, PER, and GES | GES-1 to GES-9 and GES-11 | AGTCGGCTAGACCGGAAAG | 399 | |
| TTTGTCCGTGCTCAGGAT | ||||
| PER-1 and PER-3 | GCTCCGATAATGAAAGCGT | 520 | ||
| TTCGGCTTGACTCGGCTGA | ||||
| VEB-1 to VEB-6 | CATTTCCCGATGCAAAGCGT | 648 | ||
| CGAAGTTTCTTTGGACTCTG | ||||
| Multiplex V GES and OXA-48-like | GES-1 to GES-9 and GES-11 | AGTCGGCTAGACCGGAAAG | 399 | |
| TTTGTCCGTGCTCAGGAT | ||||
| OXA-48-like | GCTTGATCGCCCTCGATT | 281 | ||
| GATTTGCTCCGTGGCCGAAA | ||||
| Multiplex VI IMP, VIM, and KPC | IMP variants except IMP-9, IMP-16, IMP-18, IMP-22 and IMP-25 | TTGACACTCCATTTACDG | 139 | |
| GATYGAGAATTAAGCCACYCT | ||||
| VIM variants, including VIM-1 and VIM-2 | GATGGTGTTTGGTCGCATA | 390 | ||
| CGAATGCGCAGCACCAG | ||||
| KPC-1 to KPC-5 | CATTCAAGGGCTTTCTTGCTGC | 538 | ||
| ACGACGGCATAGTCATTTGC | ||||
| mrpH | Mannose-Resistant/Proteus-like fimbriae | F: CCTTGTTATGGTTGGCCTGT | 444 | [21] |
| R: AGCCAGATGCGATAACCAAC | ||||
| pmfA | Major fimbrial subunit (PmfA) | F: CAAATTAATCTAGAACCACTC | 618 | [22] |
| R: ATTATAGAGGATCCCTTGAAGGTA | ||||
| uca | Fimbriae | F: GCTGGCTCATCTATGGCGTA | 453 | [23] |
| R: AGCGGTAGATTGTCCGGTTG | ||||
| atfA | A structural subunit (AtfA) | F: CATAATTTCTAGACCTGCCCTAGCA | 382 | [24] |
| R: ATTATAGAGGATCCCTTGAAGGTA | ||||
| ptA | Proteases | F: CCACTGCGATTATCCGCTCT | 686 | [25] |
| R: ATCGGCAGAAGTGACAAGCA | ||||
| hlyA | Hemolysin | F: AACAAGGATAAGCACTGTTCTGGCT | 1177 | [26] |
| R: ACCATATAAGCGGTCATTCCCGTCA | ||||
| rsbA | Histidine-containing phosphotransmitter | F: TTGAAGGACGCGATCAGACC | 467 | |
| R: ACTCTGCTGTCCTGTGGGTA | ||||
| luxS | Autoinducer | F: GTATGTCTGCACCTGCGGTA | 464 | [27] |
| R: TTTGAGTTTGTCTTCTGGTAGTGC | ||||
| acrA | Membrane fusion protein | F: TTGAAATTACGCTTCAGGAT | 189 | [28] |
| R: CTTAGCCCTAACAGGATGTG | ||||
| acrB | Inner membrane transporter | F: CGTACACAGAAAGTGCTCAA | 183 | [28] |
| R: CGCTTCAACTTTGTTTTCTT | ||||
| rsmA | Repressor of secondary metabolites | F: TAGCGAGTGTTGACGAGTGG | 562 | [22] |
| R: AGCGAGGTGAAGAACGAGAA | ||||
| hmpA | Flavohemoprotein | F: CCAGTGAATTAACGGCAGGT | 709 | [22] |
| R: CGTGCCCAGTAATGGCTAAT | ||||
| mrpA | MR/P fimbrial adhesion | F: TTTCAGGAAACAAAAGATG | 648 | [22] |
| R: TTCTTACTGATAAGACATTG | ||||
| zapD | Outer membrane protein | F: GGGGTAAAACAACGGCATCA | 217 | This study |
| R: ACATCAACCATCGTTCGCTG | ||||
| zapA | Metalloprotease | F: ACCGCAGGAAAACATATAGCCC | 540 | [22] |
| R: GCGACTATCTTCCGCATAATCA |
| Age Groups | Male (%) | Female (%) | Total (%) | p-Value |
|---|---|---|---|---|
| <1 | 2 (4.8) | 0 | 2 (1.9) | |
| 1–10 | 3 (7.1) | 8 (12.9) | 11 (10.6) | |
| 11–20 | 0 | 3 (4.8) | 3 (2.9) | |
| 21–30 | 2 (4.8) | 5 (8.1) | 7 (6.7) | |
| 31–40 | 3 (7.1) | 9 (14.5) | 12 (11.5) | |
| 41–50 | 5 (11.9) | 5 (8.1) | 10 (9.6) | |
| 51–60 | 2 (4.8) | 6 (9.7) | 8 (7.7) | |
| 61–70 | 6 (14.3) | 10 (16.1) | 16 (15.4) | |
| 71–80 | 9 (21.4) | 12 (19.4) | 21 (20.2) | |
| 81–90 | 8 (19.1) | 3 (4.8) | 11 (10.6) | |
| 91–100 | 2 (4.8) | 1 (1.6) | 3 (2.9) | |
| Total | 42 (40.4) | 62 (59.6) | 104 | 0.0071 |
| Antibiotics | Strong n = 53 n (%) | Moderate n = 47 n (%) | Weak n = 4 n (%) | Fisher’s Exact Test * p-Value ** |
|---|---|---|---|---|
| Ampicillin | 15 (28.3) | 14 (25.53) | 2 (50) | 1 |
| Piperacillin/tazobactam | 0 (0) | 0 (0) | 0 (0) | NA |
| Ceftriaxone | 6 (11.32) | 10 (21.27) | 1 (25) | 0.319 |
| Cefoxitin | 0 (0) | 0 (0) | 0 (0) | NA |
| Imipenem | 1 (1.89) | 0 (0) | 0 (0) | 1 |
| Meropenem | 0 (0) | 0 (0) | 0 (0) | NA |
| Gentamicin | 14 (26.41) | 14 (25.53) | 2 (50) | 0.606 |
| Amikacin | 2 (3.77) | 0 (0) | 0 (0) | 0.535 |
| Kanamycin | 22 (41.51) | 20 (42.55) | 1 (25) | 0.886 |
| Ciprofloxacin | 13 (24.52) | 10 (21.27) | 2 (50) | 0.481 |
| Ofloxacin | 10 (18.87) | 13 (27.66) | 1 (25) | 0.543 |
| Levofloxacin | 13 (24.52) | 12 (25.53) | 1 (25) | 1 |
| Trimethoprim/Sulfamethoxazole | 31 (58.49) | 22 (46.81) | 1 (25) | 0.102 |
| Amoxicillin/Clavulanic acid | 2 (3.77) | 1 (2.13) | 0 (0) | 1 |
| Ceftazidime | 10 (18.87) | 3 (6.38) | 1 (25) | 0.192 |
| Cefepime | 6 (11.32) | 3 (6.38) | 0 (0) | 1 |
| Cefotaxime | 9 (16.98) | 11 (23.40) | 2 (50) | 0.293 |
| Virulence Genes | Biofilm Formation | ||||
|---|---|---|---|---|---|
| Strong n (%) | Moderate n (%) | Weak n (%) | Total n (%) | Fisher’s Exact Test (p-Value) ** | |
| ureC | 53 (100) | 47 (100) | 4 (100) | 104 (100) | NA * |
| ureR | 53 (100) | 47 (100) | 4 (100) | 104 (100) | NA |
| rsmA | 48 (90.6) | 46 (97.9) | 4 (100) | 98 (94.2) | 0.111 |
| hmpA | 51 (96.2) | 46 (97.9) | 4 (100) | 101 (97.1) | 0.644 |
| mrpA | 49 (92.5) | 42 (89.4) | 4 (100) | 95 (91.4) | 0.814 |
| mrpH | 39 (73.6) | 37 (78.7) | 3 (75) | 79 (76) | 0.154 |
| pmfA | 52 (98.1) | 44 (93.6) | 4 (100) | 100 (96.2) | 0.307 |
| atfA | 50 (94.3) | 46 (97.9) | 4 (100) | 100 (96.2) | 1 |
| uca | 46 (86.8) | 41 (87.2) | 3 (75) | 90 (86.5) | 0.141 |
| pta | 50 (94.3) | 45 (95.7) | 4 (100) | 99 (95.2) | 1 |
| luxS | 53 (100) | 47 (100) | 4 (100) | 104 (100) | NA |
| rsbA | 53 (100) | 46 (97.9) | 4 (100) | 103 (99) | 0.49 |
| acrA | 53 (100) | 47 (100) | 4 (100) | 104 (100) | NA |
| acrB | 50 (94.34) | 44 (93.62) | 4 (100) | 98 (94) | 0.075 |
| hlyA | 0 | 0 | 0 | 0 | NA |
| Biofilm Formation | Group 1 | Group 2 | Group 3 | |||
|---|---|---|---|---|---|---|
| Cluster A (%) | Cluster B (%) | Cluster C (%) | Cluster D (%) | Cluster E (%) | Cluster F (%) | |
| Strong | 19 (73.1) | 10 (47.6) | 7 (46.7) | 10 (38.5) | 6 (75) | 1 (12.5) |
| Moderate | 6 (23.1) | 10 (47.6) | 7 (46.7) | 16 (61.5) | 2 (25) | 6 (75) |
| Weak | 1 (3.9) | 1 (4.8) | 1 (6.7) | 0 | 0 | 1 (12.5) |
| Group 1 | Group 2 | Group 3 | ||||
|---|---|---|---|---|---|---|
| Antibiotics | Cluster A (%) | Cluster B (%) | Cluster C (%) | Cluster D (%) | Cluster E (%) | Cluster F (%) |
| Ampicillin | 7 (26.9) | 4 (19.1) | 5 (33) | 12 (46.2) | 2 (25) | 1 (12.5) |
| Amikacin | 1 (3.9) | 0 (0) | 1 (6.7) | 0 (0) | 0 (0) | 0 (0) |
| Imipenem | 0 | 0 | 1 (6.7) | 0 (0) | 0 (0) | 0 (0) |
| Kanamycin | 11 (42.3) | 6 (28.6) | 8 (53.3) | 13 (50) | 4 (50) | 2 (25) |
| Cefoxitin | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
| Trimethoprim/ sulfamethoxazole | 12 (46.2) | 11 (52.4) | 9 (60) | 12 (46.2) | 6 (75) | 2 (25) |
| Ciprofloxacin | 7 (26.9) | 3 (14.3) | 6 (40) | 5 (19.2) | 3 (37.5) | 2 (25) |
| Piperacillin/ tazobactam | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
| Gentamicin | 8 (30.8) | 7 (33.3) | 4 (26.7) | 9 (34.6) | 2 (25) | 0 (0) |
| Ceftriaxone | 2 (7.69) | 3 (14.3) | 4 (26.7) | 6 (23.1) | 1 (12.5) | 1 (12.5) |
| Levofloxacin | 8 (30.8) | 3 (14.3) | 6 (40) | 7 (26.9) | 2 (25) | 2 (25) |
| Ofloxacin | 8 (30.8) | 3 (14.3) | 3 (20) | 8 (30.8) | 1 (12.5) | 1 (12.5) |
| Meropenem | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
| Cefotaxime | 6 (23.1) | 4 (19.1) | 3 (20) | 7 (26.9) | 1 (12.5) | 2 (25) |
| Cefepime | 3 (11.5) | 1 (4.8) | 2 (13.3) | 2 (7.7) | 1 (12.5) | 0 (0) |
| Amoxicillin/ clavulanate | 1 (3.9) | 0 (0) | 1 (6.7) | 1 (3.9) | 0 (0) | 0 (0) |
| Ceftazidime | 5 (19.2) | 2 (9.5) | 3 (20) | 2 (7.7) | 1 (12.5) | 1 (12.5) |
| Virulence Genes | Group 1 | Group 2 | Group 3 | |||
|---|---|---|---|---|---|---|
| Cluster A (%) | Cluster B (%) | Cluster C (%) | Cluster D (%) | Cluster E (%) | Cluster F (%) | |
| zapA | 26 (100) | 21 (100) | 15 (100) | 25 (96.2) | 8 (100) | 8 (100) |
| zapD | 25 (96.2) | 21 (100) | 15 (100) | 26 (100) | 8 (100) | 8 (100) |
| rsbA | 26 (100) | 20 (95.2) | 15 (100) | 26 (100) | 8 (100) | 8 (100) |
| hmpA | 26 (100) | 19 (90.5) | 15 (100) | 25 (96.2) | 8 (100) | 8 (100) |
| atfA | 25 (96.2) | 19 (90.5) | 15 (100) | 25 (96.2) | 8 (100) | 8 (100) |
| pta | 25 (96.2) | 18 (85.7) | 15 (100) | 26 (100) | 7 (87.5) | 8 (100) |
| acrB | 26 (100) | 21 (100) | 14 (93.3) | 22 (84.6) | 8 (100) | 7 (87.5) |
| rsmA | 25 (96.2) | 19 (90.5) | 14 (93.3) | 24 (92.3) | 8 (100) | 8 (100) |
| pmfA | 25 (96.2) | 21 (100) | 13 (86.7) | 23 (88.5) | 8 (100) | 7 (87.5) |
| mrpA | 24 (92.3) | 18 (85.7) | 15 (100) | 23 (88.5) | 8 (100) | 7 (87.5) |
| uca | 24 (92.3) | 17 (81) | 12 (80) | 22 (84.6) | 8 (100) | 7 (87.5) |
| mrpH | 20 (76.9) | 16 (76.2) | 10 (66.7) | 20 (76.9) | 6 (75) | 6 (75) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Choori, M.; Rahimi, F.; Qasemi, A.; Katouli, M. Biofilm Formation, Virulence-Associated Genes, and Antimicrobial Resistance in Proteus mirabilis Isolates from Urinary Tract Infections in Iran. Microorganisms 2026, 14, 1242. https://doi.org/10.3390/microorganisms14061242
Choori M, Rahimi F, Qasemi A, Katouli M. Biofilm Formation, Virulence-Associated Genes, and Antimicrobial Resistance in Proteus mirabilis Isolates from Urinary Tract Infections in Iran. Microorganisms. 2026; 14(6):1242. https://doi.org/10.3390/microorganisms14061242
Chicago/Turabian StyleChoori, Mehdi, Fateh Rahimi, Ali Qasemi, and Mohammad Katouli. 2026. "Biofilm Formation, Virulence-Associated Genes, and Antimicrobial Resistance in Proteus mirabilis Isolates from Urinary Tract Infections in Iran" Microorganisms 14, no. 6: 1242. https://doi.org/10.3390/microorganisms14061242
APA StyleChoori, M., Rahimi, F., Qasemi, A., & Katouli, M. (2026). Biofilm Formation, Virulence-Associated Genes, and Antimicrobial Resistance in Proteus mirabilis Isolates from Urinary Tract Infections in Iran. Microorganisms, 14(6), 1242. https://doi.org/10.3390/microorganisms14061242

