UspF Regulates Type III Pili-Mediated Adhesion, Oxidative Stress Resistance, and Virulence in Klebsiella pneumoniae

Abstract

Klebsiella pneumoniae (K. pneumoniae, KP) is a significant opportunistic pathogen responsible for both nosocomial and community-acquired infections. Bacterial adhesion is the critical initial step for host colonization and the establishment of disease. In this study, we utilized a mariner transposon mutagenesis system to construct a mutant library from the clinical KP strain KP20, identifying a mutant with significantly impaired epithelial cell adhesion due to an insertion in the uspF gene. Genetic knockout experiments confirmed that uspF deletion markedly reduced the adhesion to human airway epithelial cells (Calu-3) and downregulated the transcription of type III pili-encoding genes (mrkABDF). Furthermore, uspF deficiency compromised antioxidant stress and serum resistance and increased susceptibility to dendritic cell and macrophage phagocytosis. In vivo challenge experiments further demonstrated that uspF deletion significantly attenuated K. pneumoniae virulence in mice. These findings provide important insights into the molecular pathogenesis of K. pneumoniae and identify UspF as a potential target for therapeutic intervention.

1. Introduction

Klebsiella pneumoniae (K. pneumoniae, KP) is a prominent Gram-negative opportunistic pathogen within the Enterobacteriaceae family that commonly colonizes the mucosal surfaces of the human respiratory and gastrointestinal tracts. It is a leading cause of both community-acquired and nosocomial infections, including pneumonia, bacteremia, meningitis, urinary tract infections, and liver abscesses, posing a severe threat to immunocompromised individuals, particularly neonates and intensive care patients [1].

The pathogenicity of K. pneumoniae is fundamentally driven by specific virulence factors, among which bacterial adhesion is the critical initial step for host colonization. In many Enterobacteriaceae, adhesion is mediated by type I pili (encoded by the fimAICDFGH operon), which are primarily associated with urinary tract infections [2]. In K. pneumoniae, however, type III pili (encoded by the mrkABCDF operon) play a more versatile role, mediating attachment to respiratory and urinary epithelia and facilitating biofilm formation [3]. Consequently, identifying the adhesion-related genes is essential for elucidating K. pneumoniae pathogenesis and may reveal novel targets for antimicrobial or vaccine development.

Transposons are mobile genetic elements capable of “jumping” to different genomic loci. Mariner-family transposons achieve high-efficiency transposition without species-specific host factors, requiring only TA dinucleotide target sites for insertion [4]. Transposon mutant library construction serves as a critical tool for investigating bacterial gene function, enabling the systematic disruption of specific genes to identify those associated with particular phenotypes. In this study, we generated a transposon mutant library in the clinical strain KP20 and identified several genes essential for epithelial cell adhesion. Notably, our screen highlighted the universal stress protein F (UspF) as a significant modulator of both adhesion and oxidative stress resistance.

Universal stress proteins (USPs) represent an evolutionarily conserved family of proteins, first identified in Escherichia coli (E. coli), that are significantly upregulated in response to environmental stressors such as nutrient deprivation, thermal shock, oxidative stress, and osmotic fluctuations [5,6,7,8,9]. Additionally, USPs have been implicated in cellular adhesion, aggregation, and motility [6,10]. Certain USPs exhibit DNA binding, repair, and refolding capabilities, thereby safeguarding nucleic acid structures from stress-induced damage [5,11]. In E. coli, the USP family, comprising UspA, UspC, UspD, UspE, UspF, and UspG, is associated with bacterial adhesion, motility, and antioxidant stress. UspA and UspD are involved not only in bacterial superoxide defense but also in regulating intracellular iron homeostasis. In contrast to UspC and UspE, which inhibit adhesion to promote motility, UspF and UspG have the opposite effect, enhancing adhesion and inhibiting motility. While USPs are primarily recognized for facilitating environmental adaptation, increasing evidence suggests that they also participate in bacterial pathogenesis through diverse mechanisms. Although UspF is known to play a critical role in stress tolerance [10], its specific contribution to K. pneumoniae biological characteristics and virulence remain poorly understood. This study elucidates the essential functions of uspF in oxidative stress resistance and epithelial cell adhesion through the construction and phenotypic characterization of uspF deletion and complementation strains in the K. pneumoniae clinical isolate strain KP20.

2. Materials and Methods

2.1. Animal Ethics Statement

All animal studies were conducted in accordance with protocols approved by the Jiangsu Administrative Committee for Laboratory Animals (Permission number: SYXK(SU)2022-0044) and complied with the guidelines for laboratory animal welfare and ethics of the Jiangsu Administrative Committee for Laboratory Animals.

2.2. Bacterial Strains, Plasmids, and Culture Conditions

The well-characterized virulent Klebsiella pneumoniae clinical strain KP20 was used as the wild-type (WT) strain in this study. A mariner-based transposon mutant library was constructed using the transposon delivery plasmid pBT20. E. coli DH5α was employed for cloning, and E. coli S17-1λpir was employed for conjugation (

Table 1. Bacterial strains and plasmids used in this study.

Strains or Plasmids	Characteristics	Source
KP20	Wild-type K. pneumoniae clinical isolate strain	Gifted
KP20 ΔuspF	KP20 isogenic mutant with uspF gene deleted	This study
KP20 ΔuspF-compl	Complementation of KP20 ΔuspF	This study
DH5α	endA1 hsdR17(rk-mk+)supE44 thi-1 recA1 gyrA (NalR) RelA1Δ(lacIZYA-argF) U169deoR (ϕ80d lac Δ(lacZ) M15)	Gifted
S17-1λpir	F-, thi, pro, hsdR, hsdM+, recA[chr::RP4-2-Tc::Km::Tn7]	Gifted
pBT20	Mariner transposon mutagenesis vector, AmpR GmR	Gifted
pKD46	Expresses λ Red recombinase, AmpR	Gifted
pDM4	Suicide plasmid, sacB, mobRP4, oriR6K, CmR	Gifted
pACYC184	Complementary vector, CmR TcR	Gifted

). All bacterial strains were cultured in Luria–Bertani (LB) broth at 37 °C and 220 r/min. Antibiotic selection was performed by supplementing the antibiotic with the following concentrations: kanamycin (Kan) at 50 μg/mL, gentamicin (Gm) at 50 μg/mL, ampicillin (Amp) at 50 μg/mL, and chloramphenicol (Cm) at 30 μg/mL.

2.3. Construction of Transposon Mutant Library and Screening for Mutants with Reduced Adhesion Ability to Epithelial Cells

To identify the adhesion-related genes in KP20, we constructed a transposon mutant library via the mariner-based transposon system using our advanced method, as reported in [12]. E. coli S17-1λpir harboring plasmid pBT20 served as the donor strain, whereas the KP20-pKD46-Kan recombinant strain was used as the recipient. The donor and recipient cell suspensions were mixed at a 1∶1 ratio and spotted onto the center of an antibiotic-free LB agar plate for static incubation at 30 °C for 18 h. After incubation, the bacterial lawn was resuspended in 1 mL of sterile PBS, serially diluted, and 100 μL aliquots of the dilutions were spread onto selective plates containing both gentamicin and kanamycin. Following overnight incubation at 30 °C, the emergence of single colonies confirmed the successful construction of the KP20 transposon mutant library.

Mutants with reduced adhesion ability to epithelial cells were screened using an epithelial cell adhesion assay. Briefly, bacterial cultures were adjusted to an OD₆₀₀ of 0.8. Calu-3 cells were seeded into 24-well plates, and after forming confluent monolayers, the culture supernatant was removed. Bacterial suspensions were added at a multiplicity of infection (MOI) of 10 and incubated at 37 °C with 5% CO₂ for 1 h. After incubation, the supernatant was discarded, and the cells were washed with sterile PBS. Each well was treated with 200 μL of 0.5% Triton X-100 at 37 °C for 10 min, serially diluted, and plated for colony counting. The adhesion rate was calculated as (number of adherent bacteria)/(number of initially inoculated bacteria). Mutants displaying significantly reduced adhesion rates compared to the wild-type strain were selected for further analysis.

2.4. Identification of Transposon Insertion Sites

Transposon insertion sites were identified by arbitrary primed PCR following the method described by Chen et al. [13]. The procedure involved two consecutive PCR reactions. The first reaction employed genomic DNA extracted from serum-sensitive mutants as a template, with a transposon-specific primer (P7–1) and an arbitrary primer (ARB1) (

Table 2. Primers designed and used in this study.

Primers	Primer Sequence (5′ to 3′)
ARB1	GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC
P7–1	TATAATGTGTGGAATTGTGAGCGG
ARB2	GGCCACGCGTCGACTAGTAC
P7–2	ACAGGAAACAGGACTCTAGAGG
XbaI-KuspF-A	TGCTCTAGATACAGGTGGTGTCAAAAGGC
KuspF-B	GAGCCCAGCAGATAAGTTGTGCTTCCGATTCAACGTGACT
KuspF-C	AGTCACGTTGAATCGGAAGCACAACTTATCTGCTGGGCTC
XhoI-KuspF-D	CCGCTCGAGGACGTTTCTGCAGCTTATCGA
HindIII-KuspF-F	GCTAAGCTTCCTGCTGGATGGTAACGACAAA
BamHI-KuspF-R	AGTGGATCCGACGTTTCTGCAGCTTATCGA
MrkA-F	CATGACTGCTGCCCATGCAG
MrkA-R	CTTCAGTCAGGGTTACCGGAG
MrkB-RT-F	AGGCCTGGCTGGATAACGG
MrkB-RT-R	AATGTAGAACGGCGTCGGGT
MrkC-RT-F	GCCCGGG AAGATTAAGCACC
MrkC-RT-R	CTTCAGCAGCCAGCCGTCC
MrkD-RT-F	ATGTCGCTGAGGAAATTACTAACG
MrkD-RT-R	GCTGAAACGCATGCCGAT
MrkF-RT-F	ATGAAGGGATTGCCGAAAAA
MrkF-RT-R	GCTCCATCCGGCAAGGTA
FimA-RT-F	GTGGATGCCGGCTCTATCGATC
FimA-RT-R	CGCTTTGGTGGCTACCGTAG
FimB-RT-F	GACAGTAACCCAATCCCTTTCG
FimB-RT-R	TTTTTCCATCAGCCACGCC
FimC-RT-F	AGGATGTGTGCTTTTCGCC
FimC-RT-R	GCATTTTCCACCCATGACTG
FimD-RT-F	GCGAACATCAGGGGCAGTC
FimD-RT-R	CGGTAAGTGGTATCGGCAAAG
FimE-RT-F	GCAGTTTTATGCCGTTGGG
FimE-RT-R	GGCTGGTGTTGATGCTGTCC
FimF-RT-F	TTTAGCCTGATCGGTGCGG
FimF-RT-R	CGTTCCCTGGTTTTTGTAATAGC
FimG-RT-F	CTATGGCGGTGTGCTGTCG
FimG-RT-R	GGGTTTATCGGTCCGTGAATC
FimH-RT-F	TGACGGCGTTTGAACAGGA
FimH-RT-R	GTGCGGCAGAAAGGTCTGG
KP-16S-RT-F	ATGACCAGCCACACTGGAAC
KP-16S-RT-R	CTTCCTCCCCGCTGAAAGTG
GAPDH-F	CAAGGCTGTGGGCAAGGTCA
GAPDH-R	AGGTGGAAGAGTGGGAGTTGCTG
TNF-α-F	CTCAGCAAGGACAGCAGAGG
TNF-α-R	ATGTGGCGTCTGAGGGTTGTT
IL-6-F	AAGCCAGAGCTGTGCAGATGAGTA
IL-6-R	TGTCCTGCAGCCACTGGTTC
TGF-β1-F	TGACGTCACTGGAGTTGTACGG
TGF-β1-R	GGTTCATGTCATGGATGGTGC

). The PCR program began with initial denaturation at 95 °C for 5 min, followed by 6 cycles of 95 °C for 30 s, 30 °C for 30 s, and 72 °C for 1.5 min. This was then followed by 30 cycles of 95 °C for 30 s, 45 °C for 30 s, and 72 °C for 2 min, with a final extension at 72 °C for 4 min. The purified product from the first PCR reaction served as the template for the second reaction, which employed a nested transposon-specific primer P7–2 and ARB2 (Table 2). The PCR program consisted of an initial denaturation at 95 °C for 1 min, followed by 30 cycles of 95 °C for 30 s, 52 °C for 30 s, and 72 °C for 2 min, with a final extension at 72 °C for 4 min. The final purified PCR product was then sequenced using primer P7–2. All primer syntheses and sequencing were performed by Sangon Co., Ltd. (Shanghai, China).

2.5. Generation of uspF Mutant and Complemented Strains

To investigate the function of the uspF gene in KP20, this study constructed a gene deletion mutant. First, KP20 was used as the template, and primer pairs XbaI-KuspF-A/K_uspFB and KuspF-C/XhoI-K_uspF-D (Table 2) were employed to amplify the fragments containing the 5′ and 3′ homologous arms of the target gene, respectively. These fragments were used to construct the recombinant plasmid pDM4-AD. Single crossover events were selected on double-antibiotic plates, followed by double crossover selection on sucrose plates to achieve specific gene deletion. Successful construction of the deletion mutant was confirmed via PCR and sequencing. The deletion mutant was named KP20 ΔuspF.

To generate the complemented strain, the coding sequence of uspF along with its predicted promoter region was amplified from the wild-type KP20 genome and cloned into the pACYC184 vector. The recombinant plasmid was then transformed into the deletion mutant, enabling expression of the target gene under the control of its native promoter. The complemented strain was named KP20 ΔuspF-compl.

2.6. Detection of Bacterial Growth Curves

Single colonies of KP20, KP20 ΔuspF, and KP20 ΔuspF-compl were inoculated into LB broth and cultured overnight at 37 °C, with shaking at 220 r/min. The cultures were then sub-cultured into 10 mL of fresh LB broth, adjusting the initial OD₆₀₀ to 0.1, followed by incubation at 37 °C, with shaking at 220 r/min. The OD₆₀₀ values were measured every hour, and each experiment was performed in triplicate. The growth curves were plotted with time on the x-axis and OD₆₀₀ on the y-axis.

2.7. Detection of Biofilm

The biofilm formation was quantitatively analyzed using a crystal violet staining assay [14]. The bacterial cultures were diluted 1:10 in LB broth and transferred into sterile test tubes. Following 24 h of static incubation at 37 °C, the absorbance was measured at 600 nm. Planktonic cells were then removed by washing with sterile PBS. Biofilms were then stained with 4 mL of 0.4% (w/v) crystal violet solution (Sangon Biotech, Shanghai, China) for 30 min at room temperature in the dark. After removing the excess stain and washing with sterile PBS, the biofilm was observed. For quantitative assessment, the crystal violet of biofilm was dissolved in 4 mL of an ethanol: acetone (3:1, v/v) solution, and the absorbance was measured at 550 nm. The ratio of OD₅₅₀ to OD₆₀₀ was calculated to comparatively evaluate the biofilm-forming capacity of each strain.

2.8. Detection of Capsule

The capsule staining was performed according to the reference [14]. A 5% (w/v) Congo red solution was prepared by dissolving 5 g of Congo red (Sangon Biotech, Shanghai, China) in 100 mL of distilled water. An appropriate amount of Congo red solution was mixed with serum at a ratio of 5:1 and placed at one end of a glass slide. Bacterial colonies were collected from plates with an inoculation loop and thoroughly mixed with the staining solution. Following the blood smear preparation method, the staining solution was spread into a thin film on the slide and air-dried. The film was covered with 5% dilute hydrochloric acid for 1 min and then rinsed under running water. Crystal violet staining solution was applied for 1 min, rinsed again, and air-dried. The capsule thickness was observed under an optical microscope.

2.9. String Test and Mucoviscosity Assay

The strains were inoculated onto LB agar plates and incubated at 37 °C for 12–18 h. A standard bacteriological loop was used to lift the colony and assess the mucoviscosity by observing the formation of an extended viscous string. The positive result of the string test was defined as the formation of viscous strings ≥ 5 mm [15]. The mucoviscosity assay was performed as previously described [16]. Both the string test and mucoviscosity test were used to detect the viscosity of KP20, KP20 ΔuspF, and KP20 ΔuspF-compl.

2.10. Serum Resistance Assay

To assess the bacterial resistance to serum, a bactericidal assay was conducted using mice serum [17]. Whole blood was collected from mice and centrifuged to obtain the serum. The concentration of K. pneumoniae was adjusted to 1 × 10⁵ CFU/mL. Then, 50 μL of bacterial suspension was mixed with 450 μL of serum and incubated at 37 °C with rotation for 1 h, and then the mixture was plated on LB agar. Following cultivation, the colonies were counted to determine the number of viable bacteria. The survival rate (%) was calculated using the formula [(CFU·mL⁻¹) at t = 1 h/(CFU·mL⁻¹) at t = 0 h] × 100.

2.11. Adhesion Assay of K. pneumoniae to Calu-3 Cells

The adhesion assay of epithelial cells by Klebsiella pneumoniae was mainly based on the relevant references [18]. Calu-3 cells were cultured in Dulbecco’s modified Eagle medium (DMEM, Gibco, New York, NY, USA) with 10% fetal bovine serum (Gibco, New York, NY, USA) at 37 °C and 5% CO₂. The bacterial strains were co-cultured with cells at a 100:1 ratio (MOI = 100) for 1 h. After incubation, the supernatant was discarded, and the cells were washed with sterile PBS. Each well was treated with 200 μL of 0.5% Triton X-100 at 37 °C for 10 min, serially diluted, and plated for colony counting.

The bacterial adhesion was also assessed via immunofluorescence microscopy. Following the incubation of bacteria with Calu-3 cells, the cells were washed with PBS and fixed with 4% paraformaldehyde. The KP20 polyclonal antibody (1:250, produced by immunizing mice) was diluted and incubated at 4 °C overnight, followed by adding Alexa Fluor 647-conjugated goat anti-mouse IgG (1:200, Abcam, Cambridge, England) for 1 h at room temperature in the dark. DAPI (Abcam, Cambridge, England) was used to stain the nuclei. After washing with PBS, the samples were visualized and imaged using confocal laser scanning microscopy (CLSM, Leica TCS SP8 STED).

2.12. Phagocytosis and Clearance Assay

To evaluate the resistance of KP20, KP20 ΔuspF, and KP20 ΔuspF-compl to phagocytosis by dendritic cells (DCs) and macrophages, we utilized DCs, which were isolated and cultured via an optimized protocol developed in our laboratory [19]. Immature DCs were cultured in RPMI 1640 medium (Gibco, New York, NY, USA) with 10% fetal bovine serum, 1% GM-CSF (Peprotech, Rocky Hill, CT, USA), and 1% IL-4 (Peprotech, Rocky Hill, CT, USA) at 37 °C and 5% CO₂. RAW264.7 cells were cultured in DMEM with 10% fetal bovine serum at 37 °C and 5% CO₂. Bacterial strains were co-cultured with cells at a 100:1 ratio (MOI = 100) for 0.5 h or 2 h. After incubation, the cells were washed with sterile PBS. Then, 100 μg/mL gentamicin was added and incubated at 37 °C for 1 h. Next, the cells were washed with sterile PBS and lysed with 0.5% TritonX-100 at 37 °C for 10 min. The cell lysates were plated on LB agar and cultured; then, the colonies were counted to determine the number of viable bacteria. For the clearance assay, after 1 h of incubation with 100 μg/mL gentamicin, the cells were washed with sterile PBS, 10 μg/mL gentamicin was added, and the mix was incubated at 37 °C for 6 h, 12 h, and 18 h. The Cell viability was detected by using the CCK-8 assay (Beyotime Biotechnology, Shanghai, China). At each time point, cells were collected, lysed, and plated on LB agar plates for cultivation. The number of viable bacteria was determined via colony counting.

2.13. The Pathogenicity of K. pneumoniae to Mice

The concentrations of K. pneumoniae were adjusted to 5 × 10³, 5 × 10⁴, 5 × 10⁵, and 5 × 10⁶ CFU/mL in sterile PBS; then 20 μL of the bacterial suspension was intratracheally administered to six-week-old specific-pathogen-free (SPF) C57BL/6 mice. The body weight changes (n = 5 per group) were monitored for 14 days, and the median lethal dose (LD₅₀) values were calculated using the modified Karber method [20]. Lung tissues (n = 5 per group) were collected at 48 h post-infection for histopathological examination, lung wet weight determination (lung weight/body weight), and transcript levels of cytokines (TNF-α, IL-6, and TGF-β1). The bronchoalveolar lavage fluid (BALF) was collected at 48 h post-infection, and cytokines (TNF-α and IL-6) were detected using commercial ELISA kits (Multi Sciences, Hangzhou, China), according to the manufacturer protocols. The lung and spleen tissues (n = 5 per group) were collected at 48 h post-infection for bacterial load enumeration. After the experiment, the mice were euthanized with CO₂, packed in sealed bags, and frozen for preservation. Then, the Animal Carcasses Harmless Treatment Center of Yangzhou University carried out pollution-free treatment. There were no extra experimental animals.

2.14. Quantification of Transcript Levels for Bacterial Adhesion Genes

Bacterial cultures were grown overnight and harvested by centrifugation for total RNA extraction. To quantify the transcript levels of the adhesion genes (Table 2), real-time quantitative reverse transcription PCR (qRT-PCR) was performed. The 16S rRNA gene served as the endogenous reference control, and the relative gene expression was calculated using the 2^−ΔΔCt method.

2.15. Statistical Analysis

All results were analyzed using GraphPad Prism 8 software (San Diego, CA, USA) and presented as the means ± SD. One-way ANOVA analysis of variance was used to compare the variance between different groups. Asterisks in the figure indicate statistically significant differences. ** p < 0.01, * p < 0.05.

3. Results

3.1. Identification of the Adhesion-Associated Gene uspF

To identify novel genes contributing to K. pneumoniae adhesion, a mariner-based transposon mutant library was constructed and screened for mutants with impaired adherence. Among the 275 transposon-inserted mutants screened, seven strains exhibited significantly reduced adhesion rates compared to the wild-type strain (Figure 1A,B). Subsequent sequencing analysis identified four specific adhesion-associated genes (

Table 3. Identification and characterization of the insertion sites in adhesion-deficient mutants of KP20.

Mutant	Gene Name	Description
Tn208	BAU11_00175	terminase
Tn212	uspF	universal stress protein UspF
Tn217	BAU11_00175	terminase
Tn218	BAU11_00175	terminase
Tn223	HJW73_23160	hypothetical protein
Tn224	BAU11_00175	terminase
Tn273	MYF59_24105	type 1 fimbrial protein

). Given that universal stress proteins are known to play critical roles in bacterial growth, motility, biofilm formation, and pathogenicity [5,10,21,22], uspF was selected for further functional investigation.

3.2. Impact of uspF Deletion on Growth, Biofilm Formation, and Capsule Biosynthesis in KP20

To assess whether uspF influences the fitness of K. pneumoniae strain KP20, the growth kinetics were compared among the wild-type (WT), the deletion strain (KP20 ΔuspF), and the complemented strain (KP20 ΔuspF-compl). Monitoring of the optical density (OD₆₀₀) in LB broth revealed no significant differences in growth among the three strains, indicating that uspF is not essential for the growth of K. pneumoniae (Figure 2A). Similarly, the impact of uspF deletion on biofilm formation was evaluated using a test-tube assay. The results showed that under identical inoculation conditions, the three strains formed comparable amounts of biofilm on the tube walls, with no statistically significant differences observed (Figure 2B–E). We next assessed the capsule biosynthesis using capsule staining, mucoviscosity assays, and string tests. No significant differences in the capsule thickness were observed between the WT and its derivatives (Figure 2D). In the mucoviscosity assay, all three strains exhibited similarly high levels of sedimentation resistance (Figure 2E). These results were corroborated by the string test, where the WT, ΔuspF, and complemented strains all formed long strings, indicating a hypermucoviscous phenotype (Figure 2F). Collectively, these findings demonstrate that uspF deletion does not impair the growth, biofilm formation, or capsule biosynthesis of strain KP20.

3.3. The uspF Gene Does Not Alter Antibiotic Susceptibility in KP20

To investigate the role of uspF in antimicrobial resistance, the susceptibility of KP20, ΔuspF, and ΔuspF-compl was tested against a panel of 22 antibiotics representing 12 distinct classes (

Table 4. Antimicrobial susceptibility profiles of three strains of K. pneumoniae.

Antibiotic	Strain
	KP20	KP20 ΔuspF	KP20 ΔuspF-compl
C	S	S	R
E	R	R	R
RA	R	R	R
AK	S	S	S
FON	S	S	I
TE	R	R	R
CIP	I	I	I
DX	R	R	R
GM	S	S	S
CA	I	I	I
CB	R	R	R
AM	R	R	R
K	S	I	S
NOR	S	S	I
SXT	S	S	I
PB	S	S	S
CTX	S	S	S
FOX	S	S	S
MEM	S	S	S
IPM	S	S	S
AT	S	S	S
FD	I	I	R

R: resistant. S: susceptible. I: intermediate. C: chloramphenicol. E: erythromycin. RA: rifampicin. AK: amikacin. FON: florfenicol. TE: tetracycline. CIP: ciprofloxacin. DX: doxycycline. GM: gentamicin. CA: cefalexin. CB: carbenicillin. AM: ampicillin. K: kanamycin. NOR: norfloxacin. SXT: co-trimoxazole. PB: polymyxin B. CTX: cefotaxime. FOX: cefoxitin. MEM: meropenem. IPM: imipenem. AT: aztreonam. FD: nitrofurantoin.

, Microbial Reagent, Hangzhou, China). Both the WT and ΔuspF strains exhibited identical resistance to six antibiotics. While the complemented strain ΔuspF-compl was resistant to eight antibiotics, the newly acquired resistance to chloramphenicol (C) is a direct result of the cat (chloramphenicol acetyltransferase) selection marker present on the pACYC184 vector used for complementation. Other minor shifts in the complemented strain, specifically the resistance to nitrofurantoin (FD) and intermediate susceptibility to florfenicol (FON), norfloxacin (NOR), and co-trimoxazole (SXT), may stem from the metabolic burden associated with harboring a multi-copy plasmid or potential pleiotropic effects resulting from uspF overexpression under a non-native genetic context. Crucially, no significant shifts in the fundamental resistance profile were observed following the deletion of uspF when compared to the WT strain. These results indicate that uspF does not play a major role in modulating the antibiotic resistance of K. pneumoniae KP20.

3.4. The uspF Gene Specifically Mediates Resistance to Oxidative Stress and Serum

To determine the role of uspF in stress adaptation and serum resistance, we compared the survival of the WT, ΔuspF, and complemented strains under various challenges. The deletion of uspF did not significantly impact the bacterial fitness under acidic, alkaline, or hyperosmotic conditions (Figure 3A–C). However, the ΔuspF mutant was significantly more vulnerable to oxidative stress (3.5 mM H₂O₂) and serum than the WT strain. This phenotype was reversed in the complemented strain, which exhibited a restored survival rate (Figure 3D,E). These findings indicate that uspF plays a specific and important role in protecting K. pneumoniae against oxidative damage and serum-mediate is not essential for surviving pH or osmotic variations.

3.5. Deletion of uspF Impairs Epithelial Adhesion and Increases Phagocytic Susceptibility

To evaluate the contribution of uspF to K. pneumoniae adherence, we infected Calu-3 epithelial cell monolayers with the WT, ΔuspF, and complemented strains. The quantitative analysis revealed that both the WT and ΔuspF-compl strains adhered to Calu-3 cells at a significantly higher rate than the ΔuspF mutant (Figure 4A). These findings were corroborated via confocal microscopy, which showed a substantial reduction in the number of adherent mutant bacteria compared to the WT and complemented strains (Figure 4G). Furthermore, we assessed the susceptibility of these strains to phagocytosis by dendritic cells (DCs) and macrophages. The results showed that at 0.5 h post-infection, the phagocytic rates of the ΔuspF mutant by both DCs and macrophages were significantly higher than those of the wild-type and complemented strains (Figure 4B,C). Similarly, at 2 h post-infection, the phagocytic rate of the ΔuspF mutant by DCs remained significantly higher than that of the wild-type and complemented strains (Figure 4D). Subsequently, we measured the viability of DCs and the number of intracellular bacteria at 6 h, 12 h, and 18 h post-infection. The results indicated that none of the strains affected the DCs’ viability (Figure 4E), while the number of intracellular bacteria decreased over time (Figure 4F). At 6 h post-infection, the quantity of the ΔuspF mutant was lower than that of the wild-type and complemented strain. Collectively, these data suggest that uspF plays an important role in promoting adhesion to epithelial cells and conferring resistance against phagocytosis by DCs and macrophages.

3.6. The Effect of uspF Deletion on Bacterial Virulence in Mice

To investigate the contribution of uspF to K. pneumoniae pathogenesis, mice were intratracheally challenged with varying doses of the WT, ΔuspF, and complemented strains. At doses of 1 × 10⁴ and 1 × 10⁵ CFU, all groups exhibited significant weight loss (Figure 5B,D,F). However, the ΔuspF mutant showed markedly attenuated virulence. Under the high-dose challenge (1 × 10⁵ CFU), the WT group reached 100% mortality by day 3 (Figure 5A), whereas mortality in the ΔuspF group was delayed, reaching 100% by day 5 (Figure 5C). At the medium dose (1 × 10⁴ CFU), the ΔuspF mutant significantly extended survival compared to the WT, which reached full mortality by day 4 (Figure 5C). Notably, at the low-dose (1 × 10³ CFU), the ΔuspF group maintained a 40% survival rate through the end of the 15-day observation period (Figure 5C), while the WT group reached 100% mortality by day 6 (Figure 5A). Accordingly, the LD₅₀ values calculated via the modified Karber method revealed that the LD₅₀ of the ΔuspF mutant was 2.5-fold higher than those of the WT and complemented strains (

Table 5. The results of LD₅₀ in mice.

Strain	Challenge Dose (CFU)				LD50 (CFU)
	1.0 × 102	1.0 × 103	1.0 × 104	1.0 × 105
KP20	1/5	5/5	5/5	5/5	2.00 × 102
ΔuspF	1/5	3/5	5/5	5/5	5.01 × 102
ΔuspF-compl	1/5	5/5	5/5	5/5	2.00 × 102

).

To further characterize this attenuation, we performed histopathological and immunological analyses at 48 h post-infection (1 × 10⁴ CFU). H&E staining revealed that the mice infected with the WT or complemented strains developed severe pneumonia, characterized by extensive inflammatory cellular infiltration and alveolar wall thickening (Figure 6A). In contrast, ΔuspF-infected mice exhibited only mild histopathological changes and a significantly lower pathological index (Figure 6A,B). Furthermore, the ΔuspF group showed significantly lower lung wet weights, suggesting reduced pulmonary edema (Figure 6E). The bacterial burden analysis demonstrated that the ΔuspF mutant had a significantly reduced capacity for colonization and dissemination, as evidenced by lower CFU counts in the lungs and spleen compared to the WT and complemented groups (Figure 6C,D,F,G).

Finally, we assessed the inflammatory response in the bronchoalveolar lavage fluid (BALF) and lung tissue. The ΔuspF mutant elicited significantly lower secretion and transcriptional levels of pro-inflammatory cytokines TNF-α and IL-6 (Figure 6H–K). Conversely, the expression of the anti-inflammatory cytokine TGF-β1 was significantly upregulated in the lungs of ΔuspF-infected mice (Figure 6L). Collectively, these findings demonstrate that uspF is essential for the full virulence, colonization, and immune modulation of K. pneumoniae in a murine model.

3.7. The Effect of uspF Deletion on the Transcriptional Level of Adhesion-Related Genes in K. pneumoniae

Quantitative RT-PCR analysis revealed that the ΔuspF mutant exhibits distinct transcriptional responses across the two primary fimbrial operons. Within the type I fimbrial operon, the expression of the regulatory recombinases (fimB, fimE) and assembly-related genes (fimC, fimD, fimF, and fimG) were significantly upregulated (Figure 7B–G). Conversely, transcript levels of the major structural subunit (fimA) and the primary adhesin (fimH) remained unchanged compared to the wild-type strain (Figure 7A,H). The type III fimbrial operon displayed a contrasting expression pattern, with significant downregulation of the major subunit (mrkA), the chaperone (mrkB), the adhesin (mrkD), and the assembly factor (mrkF) (Figure 7I,J,L,M). Notably, expression of the usher gene mrkC was not significantly affected (Figure 7K). Collectively, these findings indicate that uspF deletion results in a gene-selective and operon-specific dysregulation of fimbriae. This differential transcriptional pattern suggests that uspF may influence the synthesis, assembly, and function of fimbriae through complex transcriptional or post-transcriptional regulatory networks, ultimately affecting the adhesion and biofilm formation phenotypes of K. pneumoniae.

4. Discussion

K. pneumoniae is a Gram-negative opportunistic pathogen of the Enterobacteriaceae family that frequently colonizes human mucosal surfaces, particularly the respiratory and gastrointestinal tracts. It is a leading cause of diverse infections, including pneumonia, bloodstream infections, urinary tract infections, meningitis, and liver abscesses [1]. The initial stage of K. pneumoniae pathogenesis is adhesion, a process mediated by type I pili, type III pili, and various non-pilus adhesins [23]. Successful adhesion prevents mechanical clearance, facilitating subsequent colonization, invasion, and systemic dissemination. Our research focused on identifying genes essential to K. pneumoniae adhesion to uncover potential therapeutic targets. In this study, we identified uspF as a novel contributor to the adhesive capacity of K. pneumoniae.

Universal Stress Proteins (USPs) were initially discovered in E. coli using protein separation techniques [24,25]. These proteins are characterized by significant upregulation in response to diverse environmental stressors, such as oxidative stress, high temperature, pH extremes, hypoxia, and DNA-damaging agents [26]. This adaptive expression enables bacteria to survive hostile conditions through various, often species-specific, molecular mechanisms. Furthermore, USPs play important roles in the pathogenicity of various clinically significant bacteria. For instance, usp genes facilitate intracellular persistence in Mycobacterium tuberculosis [27], while uspA deletion in Salmonella typhimurium impairs oxidative stress resistance and attenuates virulence in murine models [25,28,29]. Similarly, UspA protects Acinetobacter baumannii against H₂O₂ and acidic conditions, playing a crucial role in the pathogenesis of pneumonia and sepsis [30,31,32].

To identify novel genes involved in K. pneumoniae adhesion, we constructed a mariner-based transposon mutant library in the clinical strain KP20. The screening of 275 mutant strains revealed seven mutants with significantly reduced adhesion to epithelial cells. The sequencing of these insertion sites identified four candidate genes associated with the adhesion-deficient phenotype. Among these, uspF was selected for detailed functional study via targeted gene knockout and genetic complementation. The initial assays confirmed that uspF deletion did not affect the growth rates in LB broth, suggesting that uspF gene is dispensable for core metabolism under standard laboratory conditions.

Furthermore, the ΔuspF mutant exhibited no significant defects in in vitro biofilm formation. This contrasts with reports that E. coli USPs regulate biofilm development [33], a discrepancy that likely reflects the functional divergence of USPs across different bacterial species. Capsule staining and assessments of the hypermucoviscosity phenotype also showed no significant difference between the wild-type, mutant, and complemented strains. Collectively, these results indicate that uspF does not influence the physical properties of the bacterial cell surface or the production of extracellular matrix components independent of canonical capsular polysaccharide synthesis.

Given the challenge of multidrug resistance in K. pneumoniae, we evaluated the susceptibility of the ΔuspF mutant to 22 antibiotics across 12 distinct classes. The mutant displayed a resistance profile identical to the wild-type strain, suggesting uspF does not contribute to intrinsic or acquired resistance. This differs from A. baumannii, where UspA is linked to the resistance phenotype [32], further highlighting the functional specificity of USPs.

While USPs often mediate resistance to diverse environmental stressors [10], we found no significant differences in growth between the wild-type, mutant, and complemented strains under acid base or hyperosmotic stress. This suggests that uspF is not directly involved in these specific adaptive responses, or that other USPs provide compensatory functions. However, under oxidative stress (H₂O₂ treatment) and serum-mediated killing conditions, the ΔuspF mutant exhibited a significant decrease in survival, which was fully restored in the complemented strain. This provides clear evidence that uspF plays a critical role in protecting K. pneumoniae from oxidative damage and evading serum -mediated killing, processes in which oxidative damage serves as a key defense mechanism of host immune cells. This result is consistent with findings showing that USPs confer oxidative stress resistance in Listeria monocytogenes [34].

Adhesion assays using human airway epithelial cells (Calu-3) confirmed that the ΔuspF mutant has a significantly lower adhesion rate than the wild-type and complemented strains. This aligns with findings that Usp76 in Burkholderia cepacia mediates host adhesion by interacting with epithelial receptors [7]. Additionally, we observed an increased phagocytic rate of the ΔuspF mutant by DCs and macrophages, suggesting that uspF contributes to anti-phagocytic defense. This observation is consistent with a study showing that a ΔuspE mutant displays weakened anti-phagocytic capacity against macrophages [35], suggesting a conserved role for certain USPs in resisting phagocytic clearance.

However, the increased phagocytosis of the ΔuspF mutant presents an interesting paradox, as our results confirmed that the capsule thickness and mucoviscosity remained unaltered. In K. pneumoniae, the capsule is a primary anti-phagocytic factor; however, its presence alone was insufficient to protect the ΔuspF mutant from increased uptake. This phenotype is likely not a result of capsule loss, but rather a consequence of altered surface protein profiles or, more crucially, the mutant’s significantly compromised antioxidant stress resistance. The inability of the ΔuspF mutant to withstand the oxidative burst generated by phagocytes may facilitate its engulfment and subsequent clearance. These findings suggest that UspF coordinates a complex regulatory network that balances the fimbrial expression and stress endurance to facilitate both host colonization and immune evasion.

In this study, mice infected with the uspF deletion strain exhibited significantly reduced weight loss and higher survival rates compared to those infected with the WT and complemented strains. The LD₅₀ of the ΔuspF mutant was 2.5-fold higher than that of the WT and complemented strains, indicating that uspF deletion significantly attenuates the bacterial virulence. These results demonstrate that uspF plays an important role in the pathogenicity of K. pneumoniae, likely by supporting bacterial adaptation and fitness within the host. These findings are consistent with previous studies, where the deletion of universal stress protein genes increased survival in L. monocytogenes-infected greater wax moth larvae and mice [34] and reduced the pathogenicity of Salmonella enterica serovar Typhimurium and Mycobacterium tuberculosis [11,36]. The lung wet weight is an important indicator for assessing the degree of lung inflammation and edema, and pathological changes directly reflect the ability of bacteria to damage the lung tissue. Our study revealed that the ΔuspF mutant caused significantly milder lung tissue damage and lower wet weights than the WT and complemented strains. These findings indicate that uspF is crucial in determining the ability of K. pneumoniae to damage lung tissue. Furthermore, bacterial loads in the lungs and spleens were significantly lower in ΔuspF-infected mice, suggesting that uspF deficiency impairs colonization and systemic dissemination. This aligns with observations in L. monocytogenes, where usp deletion resulted in reduced bacterial burdens in the livers and spleens of infected mice [34]. This reduction may stem from the compromised stress adaptation or weakened immune evasion. Notably, the pro-inflammatory response in the lungs of ΔuspF-infected mice was significantly attenuated, while the anti-inflammatory response was enhanced. These further underscores the role of uspF in modulating host immune responses, likely by maintaining bacterial virulence or stress adaptation.

To investigate the molecular basis underlying the adhesion defect, we analyzed the transcription of type I (fim) and type III (mrk) fimbrial operons via qRT-PCR. While several genes involved in the assembly and regulation of the type I (fim) operon were upregulated, the type III (mrk) fimbrial operon—specifically recognized for mediating attachment to respiratory epithelia—was significantly downregulated. Interestingly, the major structural gene fimA and the primary adhesin fimH remained unchanged, despite the upregulation of other fim components. This suggests that the loss of adhesion to Calu-3 cells is primarily driven by the suppression of the mrk operon, which appears to be the dominant adhesin for this cell type in our model, overriding any partial upregulation of the type I fimbrial system.

The molecular mechanisms by which USPs, and UspF in particular, coordinate such diverse physiological processes remain a subject of active investigation. In E. coli, USPs are known to function not as direct transcription factors, but rather as molecular hubs that modulate various signaling pathways. One proposed mechanism involves the ability of UspF to bind small signaling molecules, such as ATP, which may trigger conformational changes allowing it to interact with specific protein partners or DNA [37]. Specifically, studies have shown that UspF is required for the full expression of phenotypes controlled by the global regulator RpoS, including resistance to oxidative damage and the regulation of surface structures [10]. The loss of uspF may lead to a failure in signaling that normally triggers RpoS-dependent protective genes, explaining the compromised H₂O₂ resistance observed in our study. Additionally, some USPs function as molecular chaperones, stabilizing key proteins involved in fimbrial assembly or metabolic pathways during periods of environmental stress [5]. Our findings that UspF influences the transcriptional profile of both fim and mrk operons suggest that UspF likely acts as a pivotal regulatory hub in K. pneumoniae, potentially coordinating the balance between metabolic conservation and the expression of virulence factors like adhesins.

5. Conclusions

This study identified uspF as a pivotal regulator of K. pneumoniae pathogenicity. By coordinating the oxidative stress resistance and adhesive capacity during early infection, uspF promoted host establishment and immune evasion. Given that targeting uspF attenuates the virulence without compromising the bacterial growth or antibiotic susceptibility, this protein represents a highly promising candidate for the development of novel anti-virulence therapeutics.