Legionella in the City: Unveiling Legionella pneumophila in Hillbrow’s High-Rise Water Systems
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Setting
2.2. Sample Size
2.3. Building Walkthrough Assessment
2.4. Sample Collection
2.5. Physico-Chemical Parameters
2.6. Detection of Escherichia coli and Total Coliforms
2.7. Detection of Legionella pneumophila by the Legiolert Quanti-Tray Assay
2.8. Detection of Legionella spp. by the South African National Standard—SANS 11731:2017 Method
2.9. Detection of Amoeba-Associated Legionella
2.10. DNA Extraction
| Primer Name | Sequence 5′–3′ | Size (bp) | Cycling Conditions | References |
|---|---|---|---|---|
| Leg 225 (F) | AAGATTAGCCTGCGTCCGAT | 658 | 95 °C for 15 min, 95 °C for 1 min, 55 °C for 90 s, 72 °C for 1 min, (30 cycles) 72 °C for 10 min | [35] |
| Leg 858 (R) | GTCAACTTATCGCGTTTGCT | |||
| L. pneu (F) | CCGATGCCACATCATTAGC | 150 | 95 °C for 15 min, 95 °C for 30 s, 55 °C for 30 s, 72 °C for 5 min, (34 cycles) | [36] |
| L. pneu (R) | CCAATTGAGCGCCACTCATAG | |||
| PFLA (F) | CAGGTTAAGGTCTCGTTCGTTAAC | 750–1000 | 95 for 15 min, 94 for 1 min, 62 for 90 s, 72 for 1 min, 72 for 10 min (34 cycles) | [37] |
| PFLA (R) | CAGGTTAAGGTCTCGTTCGTTAAC | |||
| L. pneu | CCGATGCCACATCATTAGC | 150 | 95 °C for 15 min, 95 °C for 30 20 s, 60 °C for 60 s (43 cycles) | [38] |
| CCAATTGAGCGCCACTCATAG | ||||
| Probe | 5′6-carboxyfluorescein (FAM)-TGCCTTTAGCCATTGCTTCCG-BHQ |
2.11. Legionella PCR
2.12. Real-Time Quantitative PCR
2.13. Sequencing
2.14. Data Analysis
3. Results
3.1. Building Walkthrough Assessment
3.2. Physico-Chemical Parameters
3.3. Detection of E. coli and Total Coliforms
3.4. Culture-Based Detection of Legionella pneumophila
3.5. Detection of Free-Living Amoeba and Amoeba-Associated Legionella
3.6. Sequencing
3.7. L. pneumophila Positivity
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yakunin, E.; Kostyal, E.; Agmon, V.; Grotto, I.; Valinsky, L.; Moran-Gilad, J. A snapshot of the prevalence and molecular diversity of Legionella pneumophila in the water systems of Israeli hotels. Pathogens 2020, 9, 414. [Google Scholar] [CrossRef] [Scilit]
- Marino, A.; Stracquadanio, S.; Campanella, E.; Ceccarelli, M.; Zagami, A.; Gussio, M.; Larocca, L.; Nunnari, G.; Cacopardo, B. Legionella pneumophila pneumonia: A 5-year retrospective clinical evaluation and commentary. World Acad. Sci. J. 2023, 5, 18. [Google Scholar] [CrossRef] [Scilit]
- Omiccioli, E.; Schiavano, G.F.; Ceppetelli, V.; Amagliani, G.; Magnani, M.; Brandi, G. Validation according to ISO/TS 12869: 2012 of a molecular method for the isolation and quantification of Legionella spp. in water. Mol. Cell. Probes 2015, 29, 86–91. [Google Scholar] [CrossRef] [Scilit]
- Khodr, A.; Kay, E.; Gomez-Valero, L.; Ginevra, C.; Doublet, P.; Buchrieser, C.; Jarraud, S. Molecular epidemiology, phylogeny and evolution of Legionella. Infect. Genet. Evol. 2016, 43, 108–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buultjens, A.H.; Vandelannoote, K.; Mercoulia, K.; Ballard, S.; Sloggett, C.; Howden, B.P.; Seemann, T.; Stinear, T.P. High performance Legionella pneumophila source attribution using genomics-based machine learning classification. Appl. Environ. Microbiol. 2024, 90, e0129223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cunha, B.A. Legionnaires’ disease: Clinical differentiation from typical and other atypical pneumonias. Infect. Dis. Clin. 2010, 24, 73–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Phin, N.; Parry-Ford, F.; Harrison, T.; Stagg, H.R.; Zhang, N.; Kumar, K.; Lortholary, O.; Zumla, A.; Abubakar, I. Epidemiology and clinical management of Legionnaires’ disease. Lancet Infect. Dis. 2014, 14, 1011–1021. [Google Scholar] [CrossRef] [Scilit]
- Paranjape, K.; Bédard, É.; Shetty, D.; Hu, M.; Choon, F.C.P.; Prévost, M.; Faucher, S.P. Unravelling the importance of the eukaryotic and bacterial communities and their relationship with Legionella spp. ecology in cooling towers: A complex network. Microbiome 2020, 8, 157. [Google Scholar] [CrossRef] [Scilit]
- Viasus, D.; Gaia, V.; Manzur-Barbur, C.; Carratalà, J. Legionnaires’ disease: Update on diagnosis and treatment. Infect. Dis. Ther. 2022, 11, 973–986. [Google Scholar] [CrossRef] [Scilit]
- Hilbi, H.; Jarraud, S.; Hartland, E.; Buchrieser, C. Update on Legionnaires’ disease: Pathogenesis, epidemiology, detection and control. Mol. Microbiol. 2010, 76, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Svetlicic, E.; Jaén-Luchoro, D.; Klobucar, R.S.; Jers, C.; Kazazic, S.; Franjevic, D.; Klobucar, G.; Shelton, B.G.; Mijakovic, I. Genomic characterization and assessment of pathogenic potential of Legionella spp. isolates from environmental monitoring. Front. Microbiol. 2023, 13, 1091964. [Google Scholar] [CrossRef] [Scilit]
- Abu Khweek, A.; Amer, A.O. Factors mediating environmental biofilm formation by Legionella pneumophila. Front. Cell. Infect. Microbiol. 2018, 8, 38. [Google Scholar] [CrossRef] [Scilit]
- Mraz, A.L.; Weir, M.H. Knowledge to predict pathogens: Legionella pneumophila life cycle systematic review part II growth within and egress from host cell. Microorganisms 2022, 10, 141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- LeChevallier, M.W.; Prosser, T.; Stevens, M. Opportunistic pathogens in drinking water distribution systems—A review. Microorganisms 2024, 12, 916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Donohue, M.J.; Pham, M.; Brown, S.; Easwaran, K.M.; Vesper, S.; Mistry, J.H. Water quality influences Legionella pneumophila determination. Water Res. 2023, 238, 119989. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- 9260 Introduction to Detecting Pathogenic Bacteria. In Standard Methods for the Examination of Water and Wastewater; American Public Health Association Press: Washington, DC, USA, 2023.
- ISO 11731-2017; Water Quality-Enumeration for Legionella. International Standard Organization: Geneva, Switzerland, 2017.
- Niu, C.; Zhang, Y.; Zhang, Y. Evaluation of a most probable number method for detection and quantification of Legionella pneumophila. Pathogens 2022, 11, 789. [Google Scholar] [CrossRef] [Scilit]
- Graham, C.I.; MacMartin, T.L.; de Kievit, T.R.; Brassinga, A.K.C. Molecular regulation of virulence in Legionella pneumophila. Mol. Microbiol. 2024, 121, 167–195. [Google Scholar] [CrossRef] [Scilit]
- Checa, J.; Carbonell, I.; Manero, N.; Martí, I. Comparative study of Legiolert with ISO 11731-1998 standard method-conclusions from a Public Health Laboratory. J. Microbiol. Methods 2021, 186, 106242. [Google Scholar] [CrossRef] [Scilit]
- Donohue, M.J. Quantification of Legionella pneumophila by qPCR and culture in tap water with different concentrations of residual disinfectants and heterotrophic bacteria. Sci. Total Environ. 2021, 774, 145142. [Google Scholar] [CrossRef] [Scilit]
- Garrido, M.C.A.; Villanueva-Suárez, M.J.; Martín, M.J.M.; Garcia-Alonso, A.; Sanz, M.D.T. Prevalence and distribution of Legionella in municipal drinking water supply systems in Madrid (Spain) and risk factors associated. Sci. Total Environ. 2024, 954, 176655. [Google Scholar] [CrossRef] [Scilit]
- Cervero-Aragó, S.; Rodríguez-Martínez, S.; Puertas-Bennasar, A.; Araujo, R.M. Effect of common drinking water disinfectants, chlorine and heat, on free Legionella and amoebae-associated Legionella. PLoS ONE 2015, 10, e0134726. [Google Scholar] [CrossRef] [Scilit]
- Dobrowsky, P.H.; Khan, S.; Cloete, T.E.; Khan, W. Molecular detection of Acanthamoeba spp., Naegleria fowleri and Vermamoeba (Hartmannella) vermiformis as vectors for Legionella spp. in untreated and solar pasteurized harvested rainwater. Parasites Vectors 2016, 9, 539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matshedisho, R.; Wafer, A. Hillbrow, Johannesburg. In Diversities Old and New: Migration and Socio-Spatial Patterns in New York, Singapore and Johannesburg; Palgrave Macmillan UK: London, UK, 2015; pp. 67–83. [Google Scholar]
- Mkhabela, F.F.; Onatu, G.O. A comparative study of overcrowding and its impact on basic urban facilities in Hillbrow and Alexandra. Plan Africa 2014, 606. [Google Scholar]
- Stone, W.; Louw, T.M.; Gakingo, G.K.; Nieuwoudt, M.J.; Booysen, M.J. A potential source of undiagnosed Legionellosis: Legionella growth in domestic water heating systems in South Africa. Energy Sustain. Dev. 2019, 48, 130–138. [Google Scholar] [CrossRef] [Scilit]
- Matuszewska, R.; Orych, I.; Bartosik, M. Comparison of the method of quantitative determination of Legionella pneumophila according to PN-EN ISO 11731: 2017 with the Legiolert™/Quanti-Tray® (IDEXX). Ann. Agric. Environ. Med. 2024, 31, 24–28. [Google Scholar] [CrossRef] [Scilit]
- Gauteng Research Triangle. Inner City, Informal and Township Formal: The Sites and the Node. 2023. Available online: https://grt.ac.za/inspired/geographic-area/ (accessed on 18 August 2025).
- SANS 241:2015; Drinking Water Specification. South African Bureau of Standards: Pretoria, South Africa, 2015.
- ISO 19458:2006; Water Quality-Sampling for Microbial Analysis. International Standard Organization: Geneva, Switzerland, 2006.
- SANS 11731:2017; Water Quality—Enumeration of Legionella. South African Bureau of Standards: Pretoria, South Africa, 2017.
- Muchesa, P.; Leifels, M.; Jurzik, L.; Barnard, T.G.; Bartie, C. Detection of amoeba-associated L. pneumophila in hospital water networks of Johannesburg. S. Afr. J. Infect. Dis. 2018, 33, 72–75. [Google Scholar] [CrossRef] [Scilit]
- Omar, K.B.; Barnard, T.G. Detection of diarrhoeagenic Escherichia coli in clinical and environmental water sources in South Africa using single-step 11-gene m-PCR. World J. Microbiol. Biotechnol. 2014, 30, 2663–2671. [Google Scholar] [CrossRef] [Scilit]
- Rafiee, M.; Mesdaghinia, A.; Hajjaran, H.; Hajaghazadeh, M.; Miahipour, A.; Jahangiri-Rad, M. The efficacy of residual chlorine content on the control of Legionella spp. in hospital water systems. Iran. J. Public Health 2014, 43, 637. [Google Scholar]
- Schwake, D.O.; Alum, A.; Abbaszadegan, M. Legionella occurrence beyond cooling towers and premise plumbing. Microorganisms 2021, 9, 2543. [Google Scholar] [CrossRef] [Scilit]
- Coşkun, K.A.; Özçelik, S.; Tutar, L.; Elaldı, N.; Tutar, Y. Isolation and identification of free-living amoebae from tap water in Sivas, Turkey. BioMed Res. Int. 2013, 2013, 675145. [Google Scholar] [CrossRef] [Scilit]
- Pinel, I.S.M.; Hankinson, P.M.; Moed, D.H.; Wyseure, L.J.; Vrouwenvelder, J.S.; van Loosdrecht, M.C. Efficient cooling tower operation at alkaline pH for the control of Legionella pneumophila and other pathogenic genera. Water Res. 2021, 197, 117047. [Google Scholar] [CrossRef] [Scilit]
- SANS 10400-A:2022; The Application of the National Building Regulations—Part A: General Principles and Requirements. South African Bureau of Standards: Pretoria, South Africa, 2022.
- Steege, L.; Moore, G. The presence and prevalence of Legionella spp. in collected rainwater and its aerosolization during common gardening activities. Perspect. Public Health 2018, 138, 254–260. [Google Scholar] [CrossRef] [Scilit]
- Kader, C.B.; de Smidt, O. Water quality and biofilm formation in dental unit waterline systems in Mangaung, South Africa. Int. Dent. J. 2025, 75, 2132–2149. [Google Scholar] [CrossRef] [Scilit]
- Lukhele, T.; Selvarajan, R.; Nyoni, H.; Mamba, B.B.; Msagati, T.A.M. Diversity and functional profile of bacterial communities at Lancaster acid mine drainage dam, South Africa as revealed by 16S rRNA gene high-throughput sequencing analysis. Extremophiles 2019, 23, 719–734. [Google Scholar] [CrossRef] [Scilit]
- Poopedi, E.; Singh, T.; Gomba, A. Respiratory and enteric bacterial pathogens in municipal wastewater: A potential risk of infection to workers. Water 2025, 17, 268. [Google Scholar] [CrossRef] [Scilit]
- Makuwa, S.; Green, E.; Fosso-Kankeu, E.; Moroaswi, V.; Tlou, M. A snapshot of the influent and effluent bacterial populations in a wastewater treatment plant in the North-West Province, South Africa. Appl. Microbiol. 2023, 3, 764–773. [Google Scholar] [CrossRef] [Scilit]
- Alegbeleye, O.; Alisoltani, A.; Abia, A.L.K.; Awe, A.A.; Adetunji, A.T.; Rabiu, S.; Opeolu, B.O. Investigation into the bacterial diversity of sediment samples obtained from Berg River, Western Cape, South Africa. Folia Microbiol. 2021, 66, 931–947. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moodley, S.J.; Muchesa, P.; Bartie, C.; Barnard, T.G.; Clarke, R.; Masenge, A.; Venter, S.N. Prevalence of free-living Acanthamoeba and its associated bacteria in energy-efficient hot water systems in South Africa. Water SA 2023, 49, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Mnisi, Z.F.; Delair, Z.; Singh, A. Legionella in urban and rural water, a tale of two environments. Water 2025, 17, 1491. [Google Scholar] [CrossRef] [Scilit]
- National Institute of Communicable Diseases. Notifiable Medical Conditions Surveillance System Epidemiology Report. 2025. Available online: https://www.nicd.ac.za/nmc-overview/nmc-monthly-surveillance-report/ (accessed on 16 April 2025).
- Donohue, M.J.; Mistry, J.H.; Tucker, N.; Vesper, S.J. Hot water plumbing in residences and office buildings have distinctive risk of L. pneumophila contamination. Int. J. Hyg. Environ. Health 2022, 245, 114023. [Google Scholar] [CrossRef] [Scilit]
- Yao, X.H.; Shen, F.; Hao, J.; Huang, L.; Keng, B. A review of Legionella transmission risk in built environments: Sources, regulations, sampling, and detection. Front. Public Health 2024, 12, 1415157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Çakmak, Ö.; Aldemir, T.; Ergene, E.; Acaröz, U.; Arslan-Acaroz, D.; Taş, N. Presence of Legionella pneumophila in tap water and its importance for public health. Vet. Farmakoloji Ve Toksikoloji Derneği Bülteni 2024, 15, 64–76. [Google Scholar] [CrossRef] [Scilit]
- Salehi, M. Global water shortage and potable water safety: Today’s concern and tomorrow’s crisis. Environ. Int. 2022, 158, 106936. [Google Scholar] [CrossRef] [Scilit]
- Slavik, I.; Oliveira, K.R.; Cheung, P.B.; Uhl, W. Water quality aspects related to domestic drinking water storage tanks and consideration in current standards and guidelines throughout the world–a review. J. Water Health 2020, 18, 439–463. [Google Scholar] [CrossRef] [Scilit]
- Proctor, C.R.; Dai, D.; Edwards, M.A.; Pruden, A. Interactive effects of temperature, organic carbon, and pipe material on microbiota composition and Legionella pneumophila in hot water plumbing systems. Microbiome 2017, 5, 130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, S.A.; Lubna, M.A.; Razeeb, S.R.; Acharjee, M. A proportional study on the existence of coliform and faecal coliform in the post-treatment (filtered and boiled) water samples. Int. J. Sci. Rep. 2021, 7, 215–220. [Google Scholar] [CrossRef] [Scilit]
- Montagna, M.T.; Brigida, S.; Fasano, F.; Leone, C.M.; D’Ambrosio, M.; Spagnuolo, V.; Lopuzzo, M.; Apollonio, F.; Triggiano, F.; Caringella, M.E.; et al. The role of air temperature in Legionella water contamination and legionellosis incidence rates in southern Italy (2018–2023). Ann. Med. Prev. Comunità 2023, 35, 631–640. [Google Scholar]
- Gavaldà, L.; Garcia-Nuñez, M.; Quero, S.; Gutierrez-Milla, C.; Sabrià, M. Role of hot water temperature and water system use on Legionella control in a tertiary hospital: An 8-year longitudinal study. Water Res. 2019, 149, 460–466. [Google Scholar] [CrossRef] [Scilit]
- Springston, J.P.; Yocavitch, L. Existence and control of Legionella bacteria in building water systems: A review. J. Occup. Environ. Hyg. 2017, 14, 124–134. [Google Scholar] [CrossRef] [Scilit]
- LeChevallier, M.W. Monitoring distribution systems for L. pneumophila using Legiolert®. AWWA Water Sci. 2019, 1, e1122. [Google Scholar] [CrossRef] [Scilit]
- Campaña, M.; Del Hoyo, R.; Monleón-Getino, A.; Checa, J. Predicting Legionella contamination in cooling towers and evaporative condensers from microbiological and physicochemical parameters. Int. J. Hyg. Environ. Health 2023, 248, 114117. [Google Scholar] [CrossRef] [Scilit]
- Monteiro, S.N.; Robalo, A.M.; Santos, R.J. Evaluation of LegiolertTM for the detection of Legionella pneumophila and comparison with spread-plate culture and qPCR methods. Curr. Microbiol. 2021, 78, 1792–1797. [Google Scholar] [CrossRef] [Scilit]
- Kozak-Muiznieks, N.A.; Morrison, S.S.; Mercante, J.W.; Ishaq, M.K.; Johnson, T.; Caravas, J.; Lucas, C.E.; Brown, E.; Raphael, B.H.; Winchell, J.M. Comparative genome analysis reveals a complex population structure of Legionella pneumophila subspecies. Infect. Genet. Evol. 2018, 59, 172–185. [Google Scholar] [CrossRef] [Scilit]
- Brief, A. Water quality and health-review of turbidity: Information for regulators and water suppliers. WHO/FWC/WSH 2017, 17, 1–10. [Google Scholar]
- Karia, K.; Yui, S.; Muzslay, M.; Ali, S. Concordance between IDEXX Legiolert™ (liquid culture assay) and plate culture (ISO 11731:2017) for the detection and quantification of Legionella pneumophila in water samples. J. Hosp. Infect. 2024, 150, 163–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khleifat, K.M.; Hanafy, A.M.M.; Al Omari, J. Prevalence and molecular diversity of Legionella pneumophila in domestic hot water systems of private apartments. Br. Microbiol. Res. J. 2014, 4, 306. [Google Scholar] [CrossRef] [Scilit]
- Valcina, O.; Pule, D.; Makarova, S.; Berzins, A.; Krumina, A. Occurrence of Legionella pneumophila in potable water supply systems in apartment buildings in Riga and evaluation of sampling strategies. Acta Biol. Univ. Daugavp. 2013, 13, 157–163. [Google Scholar]
- Logan-Jackson, A.R.; Rose, J.B. Water age effects on the occurrence and concentration of Legionella species in the distribution system, premise plumbing, and the cooling towers. Microorganisms 2021, 10, 81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Donohue, M.J.; O’Connell, K.; Vesper, S.J.; Mistry, J.H.; King, D.; Kostich, M.; Pfaller, S. Widespread molecular detection of Legionella pneumophila serogroup 1 in cold water taps across the United States. Environ. Sci. Technol. 2014, 48, 3145–3152. [Google Scholar] [CrossRef] [Scilit]
- Bartram, J. Legionella and the Prevention of Legionellosis; World Health Organization: Geneva, Switzerland, 2007. [Google Scholar]
- Valciņa, O.; Pūle, D.; Mališevs, A.; Trofimova, J.ū.; Makarova, S.; Konvisers, G.; Bērziņš, A.; Krūmiņa, A. Co-occurrence of free-living Amoeba and Legionella in drinking water supply systems. Medicina 2019, 55, 492. [Google Scholar] [CrossRef] [Scilit]
- Logan-Jackson, A.; Rose, J.B. Co-occurrence of five pathogenic Legionella spp. and two free-living amoebae species in a complete drinking water system and cooling towers. Pathogens 2021, 10, 1407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Falkinham III, J.O.; Pruden, A.; Edwards, M. Opportunistic premise plumbing pathogens: Increasingly important pathogens in drinking water. Pathogens 2015, 4, 373–386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Giglio, O.; D’Ambrosio, M.; Spagnuolo, V.; Diella, G.; Fasano, F.; Leone, C.M.; Lopuzzo, M.; Trallo, V.; Calia, C.; Olivac, M.; et al. Legionella anisa or Legionella bozemanii? Traditional and molecular techniques as support in the environmental surveillance of a hospital water network. Environ. Monit. Assess. 2023, 195, 496. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Sample Type | Number of Samples Collected | |
|---|---|---|
| Water (n = 67) | Hot water (30–55 °C) | 23 (34%) |
| Cold water (17–29 °C) | 44 (66%) | |
| Swabs (n = 121) | Bathroom faucet | 67 (56%) |
| Showerhead | 11 (9%) | |
| Toilet Bowl | 39 (32%) | |
| Storage tank | 4 (3%) | |
| Total number of samples (n = 188) | ||
| Detection Method | Water Samples (n = 67) | Swab Samples (n = 121) | |||||
|---|---|---|---|---|---|---|---|
| Hot Water (n = 23) | Cold Water (n = 44) | ||||||
| Legionella Positive | Legionella Negative | Legionella Positive | Legionella Negative | Legionella Positive | Legionella Negative | ||
| Culture (SANS 11731:2017) | BCYE agar | 0% (0/23) | 100% (23/23) | 0% (0/44) | 100% (44/44) | 0% (0/67) | 100% (67/67) |
| Legiolert | 48% (11/23) | 52% (12/23) | 45% (20/44) | 55% (24/44) | n/a | n/a | |
| PCR | Legionella spp. | 18% (2/11) | 82% (9/11) | 55% (11/20) | 45% (9/20) | n/a | n/a |
| L. pneumophila | 18% (2/11) | 82% (9/11) | 55% (11/20) | 58% (18/31) | n/a | n/a | |
| Real-time PCR | L. pneumophila | 18% (2/11) | 82% (9/11) | 55% (11/20) | 58% (18/31) | n/a | n/a |
| Amoeba-associated Legionella | BCYE agar | 9% (2/23) | 91% (21/23) | 0% (0/44) | 100% (67/67) | 2% (2/121) | 98% (119/121) |
| Isolate | Description | Query Cover | E-Value | % Identity | Accession Number |
|---|---|---|---|---|---|
| 1 | Legionella pneumophila strain NCTC12180 genome assembly, chromosome: 1 | 96% | 1 × 10−50 | 100 | LR133933.1 |
| 2 | Legionella pneumophila strain SPF585 chromosome, complete genome | 93% | 4 × 10−46 | 99.09 | CP174240.1 |
| 3 | Legionella pneumophila strain C11_O chromosome, complete genome | 99% | 2 × 10−43 | 94.83 | CP015945.1 |
| Sample Type | Detection Method | Samples Tested | Samples Positive | % Positive | 95% CI | Odds Ratio vs. Geyser (95% CI) |
|---|---|---|---|---|---|---|
| Geyser | Legiolert (MPN/100 mL) | 45 | 21 | 46.7 | 32.9–60.9 | Reference |
| Boiler | Legiolert (MPN/100 mL) | 12 | 6 | 50.0 | 25.4–74.6 | 1.14 (0.34–3.80) |
| Storage Tank | Legiolert (MPN/100 mL) | 4 | 2 | 50.0 | 15.0–85.0 | 1.20 (0.16–8.98) |
| Cold tap | Legiolert (MPN/100 mL) | 5 | 1 | 20.0 | 3.6–62.4 | 0.31 (0.03–2.94) |
| Borehole | Legiolert (MPN/100 mL) | 1 | 0 | 0.0 | 0.0–79.3 | 0.17 (0.01–4.54) |
| Parameter | N Negative | N Positive | OR (95% CI) | Chi-Square (χ2) p-Value | Fisher’s Exact p-Value |
|---|---|---|---|---|---|
| Temperature < 50 °C | 34 vs. 32 | 1 vs. 1 | 1.06 (0.11–10.73) | 0.966 | 1.000 |
| Free chlorine < 0.5 mg/L | 19 vs. 16 | 16 vs. 17 | 1.25 (0.49–3.21) | 0.632 | 0.808 |
| pH outside 6.5–8.5 | 34 vs. 22 | 1 vs. 11 | 11.8 (2.0–69.9) | 0.001 | 0.001 |
| Turbidity > 1 NTU * | 35 vs. 32 | 0 vs. 1 | 3.3 (0.13–83.3) | 0.299 | 0.485 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Buthane, K.E.; Delair, Z.; Barnard, T.G.; Singh, A. Legionella in the City: Unveiling Legionella pneumophila in Hillbrow’s High-Rise Water Systems. Microorganisms 2025, 13, 2152. https://doi.org/10.3390/microorganisms13092152
Buthane KE, Delair Z, Barnard TG, Singh A. Legionella in the City: Unveiling Legionella pneumophila in Hillbrow’s High-Rise Water Systems. Microorganisms. 2025; 13(9):2152. https://doi.org/10.3390/microorganisms13092152
Chicago/Turabian StyleButhane, Keletso Emily, Zaakirah Delair, Tobias George Barnard, and Atheesha Singh. 2025. "Legionella in the City: Unveiling Legionella pneumophila in Hillbrow’s High-Rise Water Systems" Microorganisms 13, no. 9: 2152. https://doi.org/10.3390/microorganisms13092152
APA StyleButhane, K. E., Delair, Z., Barnard, T. G., & Singh, A. (2025). Legionella in the City: Unveiling Legionella pneumophila in Hillbrow’s High-Rise Water Systems. Microorganisms, 13(9), 2152. https://doi.org/10.3390/microorganisms13092152

