Allelic Variation of Helicobacter pylori vacA Gene and Its Association with Gastric Pathologies in Clinical Samples Collected in Jordan
Abstract
1. Introduction
2. Materials and Methods
2.1. Gastric Mucosal Biopsy Collection
2.1.1. Rapid Urease Test
2.1.2. Histopathological Examination
2.2. Molecular Study
2.2.1. DNA Extraction
2.2.2. Primers Preparation
2.2.3. DNA Amplification of the 16S rRNA and vacA Genes by Real-Time PCR
2.2.4. Allelic Detection of vacAs and vacAm by Conventional PCR
2.3. Sequencing of PCR Products of vacA Gene
2.3.1. Cleanup Prior to Sequencing
2.3.2. DNA Quantification by Invitrogen Qubit 4 Fluorometer
2.3.3. Sequencing the Purified DNA
2.4. Statistical Analysis
3. Results
3.1. Profiling and Clinical Characterization of Collected Biopsies
3.2. Rapid Urease Testing
3.3. Histopathological and Endoscopic Examinations of Gastric Biopsy
3.4. Molecular Screening of H. pylori
3.4.1. Diagnosis of H. pylori Using 16Sr RNA, and vacA Genes
3.4.2. Allelic Variants Detection of vacA by Conventional PCR
3.4.3. Diversity of H. pylori Strains by Sanger Sequencing
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sarma, A.; Medhi, D.; Sarma, M.K.; Saikia, L.; Choudhury, B.N.; Bhattacharya, M.; Sarma, V. Helicobacter pylori Genetic Landscape in Northeast India and Its Impact in Peptic Ulcer Disease and Gastric Cancer. Front. Bacteriol. 2025, 4, 1589230. [Google Scholar] [CrossRef]
- Reyes, V.E. Helicobacter pylori and Its Role in Gastric Cancer. Microorganisms 2023, 11, 1312. [Google Scholar] [CrossRef]
- Bakhti, S.Z.; Latifi-Navid, S.; Tobnagh, S.G.; Yazdanbod, K.; Yazdanbod, A. Which Genotype of Helicobacter pylori—cagA or cagE—Is Better Associated with Gastric Cancer Risk? Lessons from an Extremely High-Risk Area in Iran. Infect. Genet. Evol. 2020, 85, 104431. [Google Scholar] [CrossRef]
- Barhoine, M.; Moustaoui, F.; Hammani, O.; Aghrouch, M.; Lemkhente, Z.; Belhabib, Z.; Bajaddoub, Z.; Touyar, A.; Aqoudad, N.; Rherissi, B.; et al. The Effect of Helicobacter pylori Gene Combinations of cagA, cagE, virB11, vacA, and babA on the Outcome of Gastric Disease in a Southern Moroccan Population. Pathogens 2025, 14, 279. [Google Scholar] [CrossRef]
- Kumar, S.; Metz, D.C.; Ellenberg, S.; Kaplan, D.E.; Goldberg, D.S. Risk Factors and Incidence of Gastric Cancer after Detection of Helicobacter pylori Infection: A Large Cohort Study. Gastroenterology 2020, 158, 527–536. [Google Scholar] [CrossRef]
- Ozbey, G.; Sproston, E.; Hanafiah, A. Helicobacter pylori Infection and Gastric Microbiota. Euroasian J. Hepato-Gastroenterol. 2020, 10, 36. [Google Scholar]
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Singh, J.; Kumar, P.; Verma, K.; Tiwary, S.K.; Narayan, G.; Dixit, V.K. Molecular Genetic Changes in Gastric Carcinoma. Int. J. Mol. Immuno-Oncol. 2021, 6, 30–46. [Google Scholar] [CrossRef]
- Anonymous. Schistosomes, Live flukes and Helicobacter pylori. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans, Lyon, 7–14 June 1994. IARC Monogr. Eval. Carcinog. Risks Hum. 1994, 61, 1–241. [Google Scholar]
- Burz, C.; Pop, V.; Silaghi, C.; Lupan, I.; Samasca, G. Helicobacter pylori Infection in Patients with Gastric Cancer: A 2024 Update. Cancers 2024, 16, 1958. [Google Scholar] [CrossRef]
- Shirani, M.; Pakzad, R.; Haddadi, M.H.; Akrami, S.; Asadi, A.; Kazemian, H.; Moradi, M.; Kaviar, V.H.; Zomorodi, A.R.; Khoshnood, S.; et al. The Global Prevalence of Gastric Cancer in Helicobacter pylori-Infected Individuals: A Systematic Review and Meta-Analysis. BMC Infect. Dis. 2023, 23, 543. [Google Scholar] [CrossRef]
- Eusebi, L.H.; Zagari, R.M.; Bazzoli, F. Epidemiology of Helicobacter pylori Infection. Helicobacter 2014, 19 (Suppl. S1), 1–5. [Google Scholar] [CrossRef]
- Borka Balas, R.; Meliț, L.E.; Mărginean, C.O. Worldwide Prevalence and Risk Factors of Helicobacter pylori Infection in Children. Children 2022, 9, 1359. [Google Scholar] [CrossRef]
- Jarzab, M.; Skorko-Glonek, J. There Are No Insurmountable Barriers: Passage of the Helicobacter pylori VacA Toxin from Bacterial Cytoplasm to Eukaryotic Cell Organelle. Membranes 2024, 14, 11. [Google Scholar] [CrossRef]
- Alzahrani, S.; Lina, T.T.; Gonzalez, J.; Pinchuk, I.V.; Beswick, E.J.; Reyes, V.E. Effect of Helicobacter pylori on Gastric Epithelial Cells. World J. Gastroenterol. 2014, 20, 12767–12780. [Google Scholar] [CrossRef]
- Wang, F.; Meng, W.; Wang, B.; Qiao, L. Helicobacter pylori-Induced Gastric Inflammation and Gastric Cancer. Cancer Lett. 2014, 345, 196–202. [Google Scholar] [CrossRef]
- Ferreira, R.M.; Machado, J.C.; Figueiredo, C. Clinical Relevance of Helicobacter pylori vacA and cagA Genotypes in Gastric Carcinoma. Best Pract. Res. Clin. Gastroenterol. 2014, 28, 1003–1015. [Google Scholar] [CrossRef]
- Jones, K.R.; Whitmire, J.M.; Merrell, D.S. A Tale of Two Toxins: Helicobacter pylori CagA and VacA Modulate Host Pathways That Impact Disease. Front. Microbiol. 2010, 1, 115. [Google Scholar] [CrossRef]
- Nimri, L.F.; Matalka, I.; Bani Hani, K.; Ibrahim, M. Helicobacter pylori Genotypes Identified in Gastric Biopsy Specimens from Jordanian Patients. BMC Gastroenterol. 2006, 6, 27. [Google Scholar] [CrossRef]
- Brasil-Costa, I.; Souza, C.D.O.; Monteiro, L.C.R.; Santos, M.E.S.; Oliveira, E.H.C.D.; Burbano, R.M.R.H. pylori Infection and Virulence Factors cagA and vacA (s and m Regions) in Gastric Adenocarcinoma from Pará State, Brazil. Pathogens 2022, 11, 414. [Google Scholar] [CrossRef]
- Foegeding, N.J.; Caston, R.R.; McClain, M.S.; Ohi, M.D.; Cover, T.L. An Overview of Helicobacter pylori VacA Toxin Biology. Toxins 2016, 8, 173. [Google Scholar] [CrossRef]
- Ansari, S.; Yamaoka, Y. Helicobacter pylori Virulence Factors Exploiting Gastric Colonization and Its Pathogenicity. Toxins 2019, 11, 677. [Google Scholar] [CrossRef]
- Palframan, S.L.; Kwok, T.; Gabriel, K. Vacuolating Cytotoxin A (VacA), a Key Toxin for Helicobacter pylori Pathogenesis. Front. Cell. Infect. Microbiol. 2012, 2, 92. [Google Scholar] [CrossRef]
- Miftahussurur, M.; Yamaoka, Y.; Graham, D.Y. Helicobacter pylori as an Oncogenic Pathogen, Revisited. Expert Rev. Mol. Med. 2017, 9, e4. [Google Scholar] [CrossRef]
- Pajavand, H.; Alvandi, A.; Mohajeri, P.; Bakhtyari, S.; Bashiri, H.; Kalali, B.; Abiri, R. High Frequency of vacA s1m2 Genotypes among Helicobacter pylori Isolates from Patients with Gastroduodenal Disorders in Kermanshah, Iran. Jundishapur J. Microbiol. 2015, 8, e25425. [Google Scholar] [CrossRef]
- Xue, Z.; Yang, H.; Su, D.; Song, X.; Deng, X.; Yu, C.; Sun, C.; He, L.; You, Y.; Gong, Y.; et al. Geographic Distribution of the cagA, vacA, iceA, oipA and dupA Genes of Helicobacter pylori Strains Isolated in China. Gut Pathog. 2021, 13, 39. [Google Scholar] [CrossRef]
- Sheikh, A.F.; Yadyad, M.J.; Goodarzi, H.; Hashemi, S.J.; Aslani, S.; Assarzadegan, M.A.; Ranjbar, R. CagA and vacA Allelic Combination of Helicobacter pylori in Gastroduodenal Disorders. Microb. Pathog. 2018, 122, 144–150. [Google Scholar] [CrossRef]
- Alm, R.A.; Ling, L.L.; Moir, D.T.; King, B.L.; Brown, E.D.; Doig, P.C.; Smith, D.R.; Noonan, B.; Guild, B.C.; deJonge, B.L.; et al. Genomic-Sequence Comparison of Two Unrelated Isolates of the Human Gastric Pathogen Helicobacter pylori. Nature 1999, 397, 176–180. [Google Scholar] [CrossRef]
- Suerbaum, S.; Achtman, M. Evolution of Helicobacter pylori: The Role of Recombination. Trends Microbiol. 1999, 7, 182–184. [Google Scholar] [CrossRef]
- Solca, N.M.; Bernasconi, M.V.; Valsangiacomo, C.; Van Doorn, L.J.; Piffaretti, J.C. Population Genetics of Helicobacter pylori in the Southern Part of Switzerland Analysed by Sequencing of Four Housekeeping Genes (atpD, glnA, scoB and recA) and by vacA, cagA, iceA and IS605 Genotyping. Microbiology 2001, 147, 1693–1707. [Google Scholar] [CrossRef]
- Sonnenberg, A. Epidemiology of Helicobacter pylori. Aliment. Pharmacol. Ther. 2022, 55 (Suppl. S1), S1–S13. [Google Scholar] [CrossRef]
- Go, M.F. Review Article: Natural History and Epidemiology of Helicobacter pylori Infection. Aliment. Pharmacol. Ther. 2002, 16 (Suppl. S1), 3–15. [Google Scholar] [CrossRef]
- Falush, D.; Wirth, T.; Linz, B.; Pritchard, J.K.; Stephens, M.; Kidd, M.; Blaser, M.J.; Graham, D.Y.; Vacher, S.; Perez-Perez, G.I.; et al. Traces of Human Migrations in Helicobacter pylori Populations. Science 2001, 292, 1582–1585. [Google Scholar] [CrossRef]
- Jorgensen, M.; Daskalopoulos, G.; Warburton, V.; Mitchell, H.M.; Hazell, S.L. Multiple Strain Colonization and Metronidazole Resistance in Helicobacter pylori-Infected Patients: Identification from Sequential and Multiple Biopsy Specimens. J. Infect. Dis. 1996, 174, 631–635. [Google Scholar] [CrossRef]
- Yamaoka, Y. Mechanisms of Disease: Helicobacter pylori Virulence Factors. Nat. Rev. Gastroenterol. Hepatol. 2010, 7, 629–641. [Google Scholar] [CrossRef]
- Salih, B. Helicobacter pylori Infection in Developing Countries: The Burden for How Long? Saudi J. Gastroenterol. 2009, 15, 201–207. [Google Scholar] [CrossRef]
- Peek, R.M.; Crabtree, J.E. Helicobacter Infection and Gastric Neoplasia. J. Pathol. 2006, 208, 233–248. [Google Scholar] [CrossRef]
- Thorell, K.; Muñoz-Ramírez, Z.Y.; Wang, D.; Sandoval-Motta, S.; Agostini, R.B.; Ghirotto, S.; Torres, R.C.; HpGP Research Network; Falush, D.; Camargo, M.C.; et al. The Helicobacter pylori Genome Project: Insights into H. pylori Population Structure from Analysis of a Worldwide Collection of Complete Genomes. Nat. Commun. 2023, 14, 8184. [Google Scholar] [CrossRef]
- Baj, J.; Forma, A.; Sitarz, M.; Portincasa, P.; Garruti, G.; Krasowska, D.; Maciejewski, R. Helicobacter pylori Virulence Factors—Mechanisms of Bacterial Pathogenicity in the Gastric Microenvironment. Cells 2020, 10, 27. [Google Scholar] [CrossRef]
- Wroblewski, L.E.; Peek, R.M.; Wilson, K.T. Helicobacter pylori and Gastric Cancer: Factors That Modulate Disease Risk. Clin. Microbiol. Rev. 2010, 23, 713–739. [Google Scholar] [CrossRef]
- Aziz, Z.W.; Saleem, S.H.; Al-Nuaimy, H.A. Helicobacter pylori in Gastric Biopsy: A Histochemical and Immunohistochemical Assessment. Ann. Coll. Med. Mosul 2019, 41, 139–144. [Google Scholar] [CrossRef]
- Dănilă, C.; Cardos, I.A.; Pop-Crisan, A.; Marc, F.; Hoza, A.; Chirla, R.; Pascalău, A.; Magheru, C.; Cavalu, S. Correlations Between Endoscopic and Histopathological Assessment of Helicobacter pylori-Induced Gastric Pathology: A Cross-Sectional Retrospective Study. Life 2022, 12, 2096. [Google Scholar] [CrossRef]
- Obaidat, M.M.; Roess, A.A. First Nationwide Seroepidemiology and Risk Factors Report of Helicobacter pylori in Jordan. Helicobacter 2019, 24, e12572. [Google Scholar] [CrossRef]
- Alaridah, N.; Jarrar, R.F.; Joudeh, R.M.; Aljarawen, M.; Jum’ah, M.; Nassr, H.; AlHmoud, R.R.; Allouzi, A.; Wadi, E.M.; Abu-Humaidan, A.H. Knowledge and Information Sources Towards Helicobacter pylori in Jordan. PLoS ONE 2023, 18, e0278078. [Google Scholar] [CrossRef]
- Kim, J.M. H. pylori virulence factors: Toxins (CagA, VacA, DupA, OipA, IceA). In Helicobacter pylori; Springer: Singapore, 2016; pp. 77–88. [Google Scholar] [CrossRef]
- Yamaoka, Y.; Kodama, T.; Gutierrez, O.; Kim, J.G.; Kashima, K.; Graham, D.Y. Relationship between Helicobacter pylori IceA, CagA, and VacA Status and Clinical Outcome: Studies in Four Different Countries. J. Clin. Microbiol. 1999, 37, 2274–2279. [Google Scholar] [CrossRef]
- Shanjana, A.; Archana, A. Cytotoxic Isolates of Helicobacter pylori from Peptic Ulcer Diseases Decrease K+-Dependent ATPase Activity in HeLa Cells. BMC Gastroenterol. 2003, 3, 31. [Google Scholar] [CrossRef]
- Figura, N.; Di Cairano, G.; Lore, F.; Guarino, E.; Gragnoli, A.; Cataldo, D.; Gennari, C. The Infection by Helicobacter pylori Strains Expressing CagA Is Highly Prevalent in Women with Autoimmune Thyroid Disorders. J. Physiol. Pharmacol. 1999, 50, 817–826. [Google Scholar]
- Asrat, D.; Nilsson, I.; Mengistu, Y.; Ashenafi, S.; Ayenew, K.; Al-Soud, W.A.; Wadström, T.; Kassa, E. Prevalence of Helicobacter pylori Infection among Adult Dyspeptic Patients in Ethiopia. Ann. Trop. Med. Parasitol. 2004, 98, 181–189. [Google Scholar] [CrossRef]
- Akeel, M.; Elmakki, E.; Shehata, A.; Elhafey, A.; Aboshouk, T.; Ageely, H.; Mahfouz, M.S. Prevalence and Factors Associated with H. pylori Infection in Saudi Patients with Dyspepsia. Electron. Physician 2018, 10, 7279–7286. [Google Scholar] [CrossRef]
- Ibrahim, A.; Morais, S.; Ferro, A.; Lunet, N.; Peleteiro, B. Sex-Differences in the Prevalence of Helicobacter pylori Infection in Pediatric and Adult Populations: Systematic Review and Meta-Analysis of 244 Studies. Dig. Liver Dis. 2017, 49, 742–749. [Google Scholar] [CrossRef]
- Aqel, A.; Khader, Y.; Arqoub, K.; Nimri, O. Survival Rate of Gastric Cancer Patients in Jordan: Secondary Data Analysis. JMIR Public Health Surveill. 2020, 6, e14359. [Google Scholar] [CrossRef]
- Pucułek, M.; Machlowska, J.; Wierzbicki, R.; Baj, J.; Maciejewski, R.; Sitarz, R. Helicobacter pylori-Associated Factors in the Development of Gastric Cancer with Special Reference to the Early-Onset Subtype. Oncotarget 2018, 9, 31146–31162. [Google Scholar] [CrossRef]
- Lima, V.P.; de Lima Silva-Fernandes, I.J.; Alves, M.K.S.; Rabenhorst, S.H.B. Prevalence of Helicobacter pylori Genotypes (vacA, cagA, cagE and virB11) in Gastric Cancer in Brazilian Patients: An Association with Histopathological Parameters. Cancer Epidemiol. 2011, 35, e32–e37. [Google Scholar] [CrossRef]
- Vega, A.E.; Cortiñas, T.I.; Puig, O.N.; Silva, H.J. Molecular Characterization and Susceptibility Testing of Helicobacter pylori Strains Isolated in Western Argentina. Int. J. Infect. Dis. 2010, 14 (Suppl. S3), e85–e92. [Google Scholar] [CrossRef]
- Hussein, N.R.; Napaki, S.M.; Atherton, J.C. A Study of Helicobacter pylori Associated Gastritis Patterns in Iraq and Their Association with Strain Virulence. Saudi J. Gastroenterol. 2009, 15, 125–127. [Google Scholar] [CrossRef]
- Al Mutawa, O.A.; Izhari, M.A.; Alharbi, R.A.; Sindi, A.A.A.; Alqarni, A.M.; Alotaibi, F.E.; Gosady, A.R.A.; Dardari, D.M.M.; Almutairi, A.M.; Alshehri, M.; et al. Helicobacter pylori (H. pylori) Infection-Associated Anemia in the Asir Region, Saudi Arabia. Diagnostics 2023, 13, 2404. [Google Scholar] [CrossRef]
- Malekzadeh, R.; Derakhshan, M.H.; Malekzadeh, Z. Gastric Cancer in Iran: Epidemiology and Risk Factors. Arch. Iran. Med. 2009, 12, 576–583. [Google Scholar] [PubMed]
- Hu, Y.; Wang, Y.; Mi, M.; Deng, Z.; Zhu, J.; Liu, Q.; Chen, X.; Chen, Z. Correlation Analysis of Gastric Mucosal Lesions with Helicobacter pylori Infection and Its Virulence Genotype in Guiyang, Guizhou Province, China. Ann. Transl. Med. 2022, 10, 1320. [Google Scholar]
- Hussein, N.R. Helicobacter pylori and Gastric Cancer in the Middle East: A New Enigma? World J. Gastroenterol. 2010, 16, 3226–3234. [Google Scholar] [CrossRef]
- El-Shenawy, A.; Diab, M.; Shemis, M.; El-Ghannam, M.; Salem, D.; Abdelnasser, M.; Shahin, M.; Abdel-Hady, M.; El-Sherbini, E.; Saber, M. Detection of Helicobacter pylori vacA, cagA and iceA1 Virulence Genes Associated with Gastric Diseases in Egyptian Patients. Egypt. J. Med. Hum. Genet. 2017, 18, 365–371. [Google Scholar] [CrossRef]
- El-Khlousy, M.; Rahman, E.A.; Mostafa, S.; Bassam, A.; Elgawad, H.A.; Elnasr, M.S.; Ghaith, D. Study of the Clinical Relevance of Helicobacter pylori Virulence Genes to Gastric Diseases among Egyptian Patients. Arab J. Gastroenterol. 2016, 17, 90–94. [Google Scholar] [CrossRef]
- Chattopadhyay, S.; Datta, S.; Chowdhury, A.; Chowdhury, S.; Mukhopadhyay, A.K.; Rajendran, K.; Bhattacharya, S.K.; Berg, D.E.; Nair, G.B. Virulence Genes in Helicobacter pylori Strains from West Bengal Residents with Overt H. pylori-Associated Disease and Healthy Volunteers. J. Clin. Microbiol. 2002, 40, 2622–2625. [Google Scholar] [CrossRef]
- Abu-Lubad, M.; Alzoubi, H.; Jarajreh, D.; Sawalqa, A.A.; Bruggemann, H.; Albataineh, E.; Aqel, A.; Al-Zeer, M. Analysis of Helicobacter pylori Genotypes amongst Jordanians’ Dental Plaque Samples. Gastroenterol. Res. 2018, 11, 46–51. [Google Scholar] [CrossRef]
- Perez-Perez, G.I.; Peek, R.M., Jr.; Atherton, J.C.; Blaser, M.J.; Cover, T.L. Detection of Anti-VacA Antibody Responses in Serum and Gastric Juice Samples Using Type s1/m1 and s2/m2 Helicobacter pylori VacA Antigens. Clin. Diagn. Lab. Immunol. 1999, 6, 489–493. [Google Scholar] [CrossRef]
- Al-Karawi, A.S.; Rasool, K.H.; Atoom, A.M.; Kadhim, A.S. Correlation between H. pylori Infection and Serum Levels of Inflammatory Markers: A Retrospective Study. Al-Salam J. Med. Sci. 2023, 2, 20–24. [Google Scholar] [CrossRef]
- Melfi, F.; Fantacuzzi, M.; Carradori, S.; D’Agostino, I.; Ammazzalorso, A.; Mencarelli, N.; Gallorini, M.; Spano, M.; Guglielmi, P.; Agamennone, M.; et al. Azo Derivatives of Monoterpenes as Anti-Helicobacter pylori Agents: From Synthesis to Structure-Based Target Investigation. RSC Med. Chem. 2024, 16, 346–366. [Google Scholar] [CrossRef]
- Al Tawalbeh, D.; Aburjai, T.; Al Balas, Q.; Al Samydai, A. In Silico and In Vitro Investigation of Anti Helicobacter Activity of Selected Phytochemicals. J. Pharm. Bioallied Sci. 2022, 14, 132–139. [Google Scholar] [CrossRef]
- Malfertheiner, P.; Megraud, F.; Rokkas, T.; Gisbert, J.P.; Liou, J.M.; Schulz, C.; Gasbarrini, A.; Hunt, R.H.; Leja, M.; O’Morain, C.; et al. Management of Helicobacter pylori Infection: The Maastricht VI/Florence Consensus Report. Gut 2022, 71, 1724–1762. [Google Scholar] [CrossRef]
- Nguyen, T.K.C.; Do, H.D.K.; Nguyen, T.L.P.; Pham, T.T.; Mach, B.N.; Nguyen, T.C.; Pham, T.L.; Katsande, P.M.; Hong, H.A.; Duong, H.T.; et al. Genomic and Vaccine Preclinical Studies Reveal a Novel Mouse-Adapted Helicobacter pylori Model for the hpEastAsia Genotype in Southeast Asia. J. Med. Microbiol. 2024, 73. [Google Scholar] [CrossRef]











| Gene or Allelic Variant | Primer | Primer Sequence (5′-3′) | Product Size (bp) |
|---|---|---|---|
| vacA | Forward (F) | AAGTGTGGGGGAATACAC | 177 |
| Reverse (R) | CTAGCGTCAAAATAATTCCAAGG | 177 | |
| vacAs | Forward (F) | ATGGAAATACAACAAACACAC | 259–286 |
| Reverse (R) | CTGCTTGAATGCGCCAAAC | 259–286 | |
| vacAm | Forward (F) | CAATCTGTCCAATCAAGCGAG | 567–642 |
| Reverse (R) | GCGTCAAAATAATTCCAAGG | 567–642 | |
| 16S rRNA | Forward (F) | ATTTGCGATTACTAGCGATT | 205 |
| Reverse (R) | AGGATACTGCCTCCGTAAG | 205 |
| Findings of the Endoscopy Examination | ||||||
|---|---|---|---|---|---|---|
| Histological Diagnosis | Normal Mucosa | Gastritis | Peptic Ulcer | Gastric Carcinoma | Biopsies (n) | Total % |
| Normal gastric mucosa | 23 | 0 | 0 | 0 | 23 | |
| 21.7% | 0.0% | 0.0% | 0.0% | 21.7% | ||
| Mild chronic gastritis | 31 | 9 | 0 | 0 | 40 | |
| 29.2% | 8.5% | 0.0% | 0.0% | 37.7% | ||
| Moderate chronic gastritis | 0 | 24 | 2 | 0 | 26 | |
| 0.0% | 22.6% | 1.9% | 0.0% | 24.5% | ||
| Severe chronic gastritis | 1 | 4 | 10 | 0 | 15 | |
| 0.9% | 3.8% | 9.4% | 0.0% | 14.1% | ||
| Gastric atrophy | 0 | 1 | 0 | 0 | 1 | |
| 0.0% | 0.9% | 0.0% | 0.0% | 0.9% | ||
| Gastric metaplasia | 0 | 0 | 0 | 1 | 1 | |
| 0.0% | 0.0% | 0.0% | 0.9% | 0.9% | ||
| Number of biopsies | 55 | 38 | 12 | 1 | 106 | |
| Percentage of biopsies | 51.9% | 35.8% | 11.3% | 0.9% | ~100% | |
| Gender | Count | Age (y) | PCR Detection of vacA Alleles |
|---|---|---|---|
| Male | 3 | 39, 58, 58 | s2m2, s1m2, s1m1 |
| Female | 1 | 27 | m2 |
| Diagnostic Category | Subcategory | vacAm1 (n, %) | vacAm2 (n, %) | vacAs1 (n, %) | vacAs2 (n, %) |
|---|---|---|---|---|---|
| Endoscopic Findings | Normal gastric mucosa | 6 (50.0%) | 16 (34.04%) | 8 (42.1%) | 7 (28.0%) |
| Gastritis | 4 (33.3%) | 24 (51.06%) | 9 (47.4%) | 15 (60.0%) | |
| Gastric ulcer | 2 (16.7%) | 7 (14.9%) | 2 (10.5%) | 3 (12.0%) | |
| Gastric carcinoma | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | |
| Allele positive samples | n = 12 | n = 47 | n = 19 | n = 25 | |
| n = 59 (vacAm positive) | n = 44 (vacAs positive) | ||||
| p-value (* significant) | <0.001 * | <0.001 * | 0.021 | 0.021 | |
| Histopathological Findings | Normal gastric mucosa | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) |
| Mild gastritis | 7 (6.6%) | 21 (19.8%) | 10 (9.4%) | 12 (11.3%) | |
| Moderate gastritis | 2 (1.9%) | 15 (14.2%) | 6 (5.7%) | 7 (6.6%) | |
| Severe gastritis | 3 (2.8%) | 11 (10.4%) | 3 (2.8%) | 6 (5.7%) | |
| Gastric atrophy | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | |
| Gastric metaplasia | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | |
| allele positive (total) | n = 12 | n = 47 | n = 19 | n = 25 | |
| n = 59 (vacAm positive) | n = 44 (vacAs positive) | ||||
| p-value (* significant) | <0.001 * | <0.001 * | <0.001 * | <0.001 * |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al-Hyassat, M.M.; Al-Daghistani, H.I.; Abu-Niaaj, L.F.; Zein, S.; Al-Qaisi, T. Allelic Variation of Helicobacter pylori vacA Gene and Its Association with Gastric Pathologies in Clinical Samples Collected in Jordan. Microorganisms 2025, 13, 1841. https://doi.org/10.3390/microorganisms13081841
Al-Hyassat MM, Al-Daghistani HI, Abu-Niaaj LF, Zein S, Al-Qaisi T. Allelic Variation of Helicobacter pylori vacA Gene and Its Association with Gastric Pathologies in Clinical Samples Collected in Jordan. Microorganisms. 2025; 13(8):1841. https://doi.org/10.3390/microorganisms13081841
Chicago/Turabian StyleAl-Hyassat, Mamoon M., Hala I. Al-Daghistani, Lubna F. Abu-Niaaj, Sima Zein, and Talal Al-Qaisi. 2025. "Allelic Variation of Helicobacter pylori vacA Gene and Its Association with Gastric Pathologies in Clinical Samples Collected in Jordan" Microorganisms 13, no. 8: 1841. https://doi.org/10.3390/microorganisms13081841
APA StyleAl-Hyassat, M. M., Al-Daghistani, H. I., Abu-Niaaj, L. F., Zein, S., & Al-Qaisi, T. (2025). Allelic Variation of Helicobacter pylori vacA Gene and Its Association with Gastric Pathologies in Clinical Samples Collected in Jordan. Microorganisms, 13(8), 1841. https://doi.org/10.3390/microorganisms13081841

